ID: 1073419722

View in Genome Browser
Species Human (GRCh38)
Location 10:103414867-103414889
Sequence CTGTTATTCCAGATGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073419722_1073419732 14 Left 1073419722 10:103414867-103414889 CCATGTGCCATCTGGAATAACAG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1073419732 10:103414904-103414926 GGAAGTTGGCTGTGAAGGGGAGG 0: 1
1: 0
2: 0
3: 33
4: 407
1073419722_1073419727 9 Left 1073419722 10:103414867-103414889 CCATGTGCCATCTGGAATAACAG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1073419727 10:103414899-103414921 GCCCAGGAAGTTGGCTGTGAAGG 0: 1
1: 0
2: 0
3: 32
4: 276
1073419722_1073419731 11 Left 1073419722 10:103414867-103414889 CCATGTGCCATCTGGAATAACAG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1073419731 10:103414901-103414923 CCAGGAAGTTGGCTGTGAAGGGG 0: 1
1: 0
2: 4
3: 32
4: 307
1073419722_1073419725 -7 Left 1073419722 10:103414867-103414889 CCATGTGCCATCTGGAATAACAG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1073419725 10:103414883-103414905 ATAACAGGCACAGTTAGCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1073419722_1073419726 0 Left 1073419722 10:103414867-103414889 CCATGTGCCATCTGGAATAACAG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1073419726 10:103414890-103414912 GCACAGTTAGCCCAGGAAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 174
1073419722_1073419729 10 Left 1073419722 10:103414867-103414889 CCATGTGCCATCTGGAATAACAG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1073419729 10:103414900-103414922 CCCAGGAAGTTGGCTGTGAAGGG 0: 1
1: 0
2: 3
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073419722 Original CRISPR CTGTTATTCCAGATGGCACA TGG (reversed) Intronic
902540154 1:17149000-17149022 CCTTTATTCCAGAGGGGACAAGG + Intergenic
903010160 1:20324169-20324191 CTGTTTTTCCAGATGGCCAAGGG - Intronic
904486879 1:30830798-30830820 CTGTTATACCATATTTCACAAGG - Intergenic
905107091 1:35570428-35570450 CAGGTATCCCAGAGGGCACATGG - Intergenic
906172106 1:43735244-43735266 TTGTTACTCGACATGGCACAAGG + Intronic
908268093 1:62397809-62397831 ATGTTATCCCACATGGCAAAAGG + Intergenic
908826024 1:68133507-68133529 ATCTCATTCAAGATGGCACAAGG + Intronic
909252782 1:73380160-73380182 CTGTTATCCTACATGGCAAAAGG - Intergenic
909699035 1:78499826-78499848 CTGTTATTCCAAATGGTGCTTGG + Intronic
910084593 1:83384558-83384580 CTATTATTCCACATGGCAGAAGG + Intergenic
911957976 1:104262124-104262146 ATGTTATTTCAGATGGCACGAGG + Intergenic
915466017 1:156098506-156098528 CAGTTATTCCTGATGTAACATGG - Intronic
920182521 1:204141226-204141248 CTGTTCTTCCGGCTGGCACTTGG - Intronic
921193014 1:212726449-212726471 CTGTTTATCAAGATGGCATATGG + Intronic
921631316 1:217437351-217437373 CTGTCATTCCAGGTGCCACTGGG - Intronic
921998982 1:221454707-221454729 CTGTTGCTCCAGATGACACAGGG - Intergenic
923067001 1:230527292-230527314 CTGGTGTTCCAGGTGCCACAGGG + Intergenic
924019392 1:239765020-239765042 CTGTGATTCCAGATGGCCCAAGG - Intronic
924416715 1:243863542-243863564 CTGTTGTTTCCCATGGCACAGGG - Intergenic
1063138764 10:3238757-3238779 CTCTTATTCCCGCTGCCACAGGG - Intergenic
1064329542 10:14380652-14380674 CTATTATTTCAGATGGGCCAAGG + Intronic
1067069953 10:43124104-43124126 AGGTAATTCCAGATGGCCCAGGG + Intronic
1073419722 10:103414867-103414889 CTGTTATTCCAGATGGCACATGG - Intronic
1075352009 10:121732613-121732635 CTTTTATTCCACATGCCACTTGG + Intergenic
1076603825 10:131676773-131676795 CTGTTGCTCCAGATGTCAGAAGG + Intergenic
1081221561 11:40469500-40469522 CTGGTATTCCAGATGCTACTGGG - Intronic
1081361605 11:42187040-42187062 CCTGAATTCCAGATGGCACATGG + Intergenic
1081363266 11:42205472-42205494 CTGGTATTCCAGGTGCCACTGGG - Intergenic
1085831353 11:79904759-79904781 CTGGAATTCCAGGTAGCACATGG - Intergenic
1086039688 11:82460798-82460820 CTGTTATTCCTGATGGCTTTTGG - Intergenic
1086505263 11:87497799-87497821 CTGGTGTTCCAGATGCCACTGGG - Intergenic
1086918174 11:92555447-92555469 CTGTTATCCCAGAGGGCACTTGG - Intronic
1089997549 11:122923186-122923208 GTGTTATTCCAGAGGGCAGAGGG + Intronic
1091719224 12:2800522-2800544 CTGTAGTTTCAGATGACACATGG - Exonic
1093564629 12:20588215-20588237 CTTTTATTACAGCTGTCACATGG + Intronic
1097433723 12:59536246-59536268 ATGTTATTCCTAATGTCACAGGG + Intergenic
1097435677 12:59549854-59549876 ATGTTATTCCTGAGGTCACAGGG + Intergenic
1098151903 12:67555731-67555753 CTGGCATTCCAGGTGGCACTAGG + Intergenic
1099179354 12:79459548-79459570 ATGTTACTCCTGATGTCACAGGG + Intergenic
1099182014 12:79479923-79479945 ATGTTACTCCTGATGTCACAGGG + Intergenic
1103255684 12:119539703-119539725 CTGGCATTCCAGGTGCCACAGGG + Intronic
1104318911 12:127731732-127731754 CCGTTTTTCCAAATGCCACAGGG + Intergenic
1104780379 12:131416097-131416119 CTGTGATTCAAGATGGCTCCAGG - Intergenic
1105769378 13:23594222-23594244 CTGGTGTTCCAGATGCCACTAGG - Intronic
1108052707 13:46461978-46462000 ATGTTATTCCTAATGTCACACGG - Intergenic
1108120484 13:47180682-47180704 CTGTAATTCCTCATAGCACATGG + Intergenic
1108477046 13:50830757-50830779 ATGTTACCCCACATGGCACAGGG + Intronic
1108803081 13:54123398-54123420 CTTTTATTCCAGATGCCACCTGG + Intergenic
1109538513 13:63743662-63743684 GTGTTATTCCTAATGTCACACGG - Intergenic
1109545326 13:63836107-63836129 GTGTTATTCCTAATGTCACACGG + Intergenic
1110751745 13:79122868-79122890 ATGTTTTTCCTGATGGCCCAAGG - Intergenic
1110813288 13:79834414-79834436 CTGTGATGCCAGGGGGCACAGGG - Intergenic
1110882614 13:80590740-80590762 CTGGTTTTGCAGATGGCAGAGGG - Intergenic
1111007557 13:82267891-82267913 TTGTTATTCCACTTAGCACAAGG - Intergenic
1111290201 13:86156621-86156643 ATAGTATTCCAGATGGCAGATGG - Intergenic
1114391635 14:22315087-22315109 CTCTAATTCCAGGGGGCACAGGG + Intergenic
1117104237 14:52382272-52382294 CTGTCATTCCAGGTGTCACTGGG - Intergenic
1117413066 14:55468174-55468196 CTGGCACTCCAGAGGGCACAAGG + Intergenic
1118695701 14:68382942-68382964 CTGTTCTTCCTGATAACACATGG + Intronic
1120554144 14:85907977-85907999 CTGGGATTCCAGGTGCCACAGGG + Intergenic
1124893917 15:33758261-33758283 CTGGTATTCCAGGTGCCACTGGG - Intronic
1125227137 15:37408267-37408289 CTGGTATTCCAGGTGCCACTTGG - Intergenic
1126926291 15:53590859-53590881 TTGTTATTCCAGAAGGCTAAGGG + Intronic
1127317907 15:57815117-57815139 CTGGTATTCCAGGTGCCACTGGG + Intergenic
1129851284 15:78795343-78795365 CTTTTATTCCATATGGAACAGGG + Intronic
1132777539 16:1603949-1603971 CTGTGTTTCCAGTTGGCACAAGG - Intronic
1133025222 16:2986273-2986295 CAGTTATGCCAGATGGGACGAGG - Intergenic
1133183744 16:4079955-4079977 CTGTTTTGGCAGATGGCAAAGGG - Intronic
1133490149 16:6260359-6260381 ATCTGATTCCAGATGACACATGG + Intronic
1136222205 16:28835935-28835957 CTGTGATTCCAGTTTGGACATGG - Exonic
1137791189 16:51176211-51176233 CTGTTATTCCCTATGGCTCAGGG - Intergenic
1139199088 16:64954512-64954534 CTGTGCTTCCAGAAGGCTCAGGG + Intronic
1139353475 16:66352748-66352770 ATGTTATGCCACATGGCAAATGG - Intergenic
1139945697 16:70640353-70640375 CTGTGATTACAGTTGACACAAGG - Intronic
1144360997 17:14492671-14492693 CTGTGATTTCACATGGCAAAAGG + Intergenic
1144607201 17:16677401-16677423 CTGTGAGTGCAGATGGCTCAGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148982706 17:51592477-51592499 CTGATCTACCAGAAGGCACATGG - Intergenic
1152671492 17:81610371-81610393 GTTATATTCCAGATGGCACATGG + Intronic
1155006659 18:21735493-21735515 CTGGTGTTCCAGATGCCACCGGG - Intronic
1155384907 18:25266896-25266918 CTGGTGTTCCAGATGTCACTGGG - Intronic
1158186044 18:54772892-54772914 TTATTCTTCCAGATGGCAAAGGG - Intronic
1160545855 18:79654559-79654581 GTCTTATTCCAGATGGTAAAGGG - Intergenic
1167257201 19:48437859-48437881 CTTATATTCCAGATGTCATATGG + Intronic
1168441554 19:56372017-56372039 CTGTTGTTACAGATGGTGCAAGG + Intergenic
925678862 2:6395828-6395850 CTGTTCTTCCACCTGTCACATGG + Intergenic
926019274 2:9481182-9481204 CTGTTATTCATGATGTCACTGGG - Intronic
927010312 2:18897252-18897274 CTGTCATTGCAGATGGGACTTGG + Intergenic
927630699 2:24771523-24771545 ATGTGATTCCAGAGGGCTCAAGG + Intergenic
932858207 2:75261102-75261124 CTGTTATTCAAGAAGCCTCAGGG + Intergenic
934515380 2:94982860-94982882 CTGTTCCTCCAGATGAGACAGGG + Intergenic
936681984 2:114784531-114784553 ATATTATTCCAGAGAGCACATGG + Intronic
938199030 2:129357797-129357819 GTGTGTTTCCAGATGCCACAAGG - Intergenic
938948523 2:136236300-136236322 CTGATATTCCAGCTGGATCATGG - Intergenic
939717030 2:145596811-145596833 CTGATATTCCTGAGGGCAAAGGG - Intergenic
939953188 2:148500422-148500444 ATGTTATTACAGATGGGACTCGG - Intronic
940541802 2:155029838-155029860 ATGTTACTCCATATGGCAGAGGG + Intergenic
941244947 2:163085121-163085143 CCATTATTTCAGATGTCACAAGG + Intergenic
941531360 2:166675240-166675262 CTGCTGTTCAAGATGGCCCAGGG - Intergenic
942227441 2:173829699-173829721 CTGGTACTGCAGATGGCTCAGGG + Intergenic
942813067 2:180020266-180020288 CTGTTACTCCTAATGTCACAGGG - Intergenic
942898721 2:181089338-181089360 CTGGCATTCCAGATGCCACTGGG - Intergenic
944009974 2:194963775-194963797 CTGTTATTCCTGCTGTCAGAGGG + Intergenic
944738165 2:202587015-202587037 ATGTTATTCCTAATGTCACAGGG + Intergenic
945137365 2:206642545-206642567 CTCTACTCCCAGATGGCACAAGG - Intergenic
1171513433 20:25706723-25706745 CTGGCATTCCAGATGCCACGGGG + Intergenic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1177184222 21:17775763-17775785 CTGGCATTCCAGATGCCACTGGG + Intergenic
1177519485 21:22200405-22200427 CTGCTACTCCAGAAGGCACATGG - Intergenic
1178344461 21:31812947-31812969 TTATTATACCAGCTGGCACATGG - Intergenic
1179671378 21:42951527-42951549 CTGTTACTCCTAATGTCACACGG + Intergenic
1182037029 22:27206936-27206958 CTGTCATTCAAGGTGGCTCATGG + Intergenic
1182038930 22:27221038-27221060 CTGTTATACCAGAGAGCACTAGG - Intergenic
1183313333 22:37123596-37123618 CTGTGGTTCCAGGTGCCACATGG - Intergenic
1183452464 22:37904615-37904637 CTGTTATCCCACAGGGGACAGGG + Intergenic
1184396493 22:44244994-44245016 CTTGTCTTCCAGAGGGCACAGGG + Exonic
1184750302 22:46482177-46482199 GCGTTATGCCACATGGCACAGGG + Intronic
1184807560 22:46805292-46805314 CTGGTTTTCCAGTTGACACAGGG + Intronic
949768962 3:7557334-7557356 CTGATTTTCTAAATGGCACATGG + Intronic
950808235 3:15626854-15626876 CTGAGACTCTAGATGGCACAAGG + Intronic
951737422 3:25883401-25883423 ATGTTGATCCAGATGGCAGAAGG + Intergenic
952728419 3:36613920-36613942 GTGTTATTCCAAAGGGGACAAGG + Intergenic
953168031 3:40482614-40482636 CTGATATTCCAGCTGGAGCAAGG + Exonic
954007527 3:47603635-47603657 CTGCCATTCCAGATGGCAAAAGG - Intronic
956070575 3:65445859-65445881 ATGTAATTCCAGATGTGACAAGG - Intronic
958899291 3:99866795-99866817 CTGTAATTAGAGATGGCATATGG - Intronic
960375196 3:116892316-116892338 CTGTAATTTCACATGGCAGAAGG + Intronic
960401203 3:117201253-117201275 CTGTTATTGCAGAGAGCAGAAGG + Intergenic
961993484 3:131216909-131216931 CTGTTACTCCACATGCCAAATGG - Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
963024884 3:140909844-140909866 CTGTAATCCCAGATGGCTGAGGG - Intergenic
965561662 3:170067619-170067641 CTGTGATTGCAGAGGTCACATGG - Intronic
967304003 3:188043148-188043170 GTTTTATTCCAGAAGGCACTGGG - Intergenic
968888846 4:3355329-3355351 CTCTTGTTCCTGATGGCAAAGGG - Intronic
969240936 4:5897006-5897028 ATGTTACTCCACATGGCAAATGG + Intergenic
969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG + Intronic
973272972 4:48280032-48280054 CTGGCATTCCAGATGCCACCAGG - Intergenic
975110303 4:70616041-70616063 CTGATAATCCTGATGGTACATGG + Intergenic
975458672 4:74624509-74624531 CTGTTCTACCTGACGGCACAAGG + Intergenic
976017954 4:80582270-80582292 CTGTTATTCCAGTTATCACATGG + Intronic
977432836 4:96953705-96953727 CTGTTTTTCCTGATGACTCAAGG - Intergenic
979218466 4:118193783-118193805 CTGTAGTTTCAGATGACACATGG + Intronic
979395444 4:120182561-120182583 CTGTTATTCAACATGGTACTGGG + Intergenic
979835436 4:125361358-125361380 TTGTTAATCCGGAAGGCACAGGG + Intronic
979992480 4:127391636-127391658 TTGTTATTCCATATGACTCAAGG + Intergenic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
980682462 4:136181071-136181093 CTGTTATTTCAGATTTTACATGG - Intergenic
981131549 4:141162923-141162945 CTGGCATTCCAGATGCCACTAGG - Intronic
981296629 4:143140486-143140508 CTGATGTTCCAGGTGCCACAGGG - Intergenic
981749829 4:148082688-148082710 CTGGTGTTCCAGATGCCACTGGG - Intronic
982090998 4:151879855-151879877 CTGTTCTTACAGATGCCACAGGG - Intergenic
982323844 4:154108900-154108922 CTGGTATTCCAGGTGCCACTGGG - Intergenic
984574412 4:181430391-181430413 CTTTTGTTCCAGATGTCCCAGGG + Intergenic
988772616 5:34447822-34447844 CTGGTATTCCAGGTGCCACTGGG + Intergenic
990128573 5:52550442-52550464 CTGTTATTCCAGATGTTTCTCGG - Intergenic
993738468 5:91506875-91506897 CTGTTACCCCATATGGCAAAGGG - Intergenic
993777751 5:92022333-92022355 CTGTTCTTGCTGTTGGCACAGGG - Intergenic
995187296 5:109285575-109285597 CTGTTAATCCATATGGCTCTTGG - Intergenic
997193688 5:131963196-131963218 CTGACATGCCAGATGGCACTAGG + Intronic
997685877 5:135787980-135788002 ATGTTACTCCAAATGTCACAGGG + Intergenic
999935392 5:156480596-156480618 CTGCTACCCCAGATGGCACATGG + Intronic
1000196269 5:158961904-158961926 GTCTTATTCCAGATGAAACAGGG + Intronic
1000356432 5:160400363-160400385 CATTTATTCCACATGGAACATGG - Intergenic
1000582245 5:163048662-163048684 CTGTTGTTCCAGGTGCCACTGGG + Intergenic
1003158560 6:3616897-3616919 CTGGGATTCTAGAAGGCACAGGG - Intergenic
1004117760 6:12787814-12787836 CTGCTATTCCAGAGGGCACTTGG + Intronic
1006486911 6:34350308-34350330 CTGGTACCCCAGATGGCACCAGG + Intronic
1007051840 6:38839259-38839281 CTGTTGGTCCAGATGGTAAATGG - Intronic
1007088847 6:39169458-39169480 TTGTGCTTCCAGACGGCACAAGG + Intergenic
1010496978 6:76545805-76545827 CTGTAATTTCACATGGCAAAAGG - Intergenic
1012506317 6:99950817-99950839 TTGTTATTTCTGATGGCAAAAGG - Intronic
1013362779 6:109410144-109410166 CTGATCTTCCACATGGGACACGG - Intronic
1013829125 6:114251930-114251952 CTGTTATAACAGAAGACACAAGG - Intronic
1014270127 6:119327044-119327066 ATGTTATTTCACATGGCAAAGGG + Intronic
1015409938 6:132882795-132882817 ATGTTATTCTAGTGGGCACATGG - Intergenic
1015507384 6:134003266-134003288 CTGCTTTTCTAGCTGGCACAGGG + Intronic
1018751926 6:166813965-166813987 CTGGTATTCTATCTGGCACATGG + Intronic
1020358307 7:7301328-7301350 CTGGCATTCCAGATGCCACTGGG + Intergenic
1021100592 7:16583930-16583952 CTGTGATTCCAGTTTGGACATGG + Intergenic
1023511655 7:40959687-40959709 CTGGTGTTCCAGATGCCACTGGG + Intergenic
1027301411 7:76840674-76840696 CTATTATTCCACAAGGCAGAAGG + Intergenic
1028743874 7:94306274-94306296 AAGCTATTCCAGAGGGCACAGGG - Intergenic
1028874864 7:95810037-95810059 CTGATATCCCAGAAGGGACAAGG + Intronic
1030801307 7:113856388-113856410 CTGGTATTCCAGGTGCCACTGGG - Intergenic
1030968059 7:116018358-116018380 CAGTTATTACAGATGGCTCCAGG + Intronic
1035477775 7:159155803-159155825 CTTCTATTCCAGCTGGCACAGGG + Intergenic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1036904298 8:12694812-12694834 ATGTTACTCCAAATGTCACAGGG + Intergenic
1040013343 8:42680456-42680478 CTGGTATCCCACATGGCAGAGGG - Intergenic
1040713760 8:50222179-50222201 CCATTATTCCAGAGGTCACAAGG - Intronic
1041717637 8:60946437-60946459 CTGTAATACCAGATTGAACATGG + Intergenic
1044405238 8:91818862-91818884 CTGGTATTCCAGGTGCCACTGGG - Intergenic
1044503533 8:92990871-92990893 CTGTCATTCCAGGTGCCACTGGG - Intronic
1045651870 8:104348842-104348864 CTTTGATTGCAGCTGGCACAGGG + Exonic
1048370783 8:133774316-133774338 ATGTTATTTCACATGGCAAAGGG + Intergenic
1049666030 8:143843092-143843114 CTGTCATGTCCGATGGCACAGGG - Intergenic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1051698316 9:19792172-19792194 ATGTTATTTCAGATGGGGCAAGG - Intergenic
1052336428 9:27324634-27324656 CTGGTATTCCAGGTGCCACTGGG + Intergenic
1054986019 9:71262537-71262559 CTGGTATTCCAGGTGCCACTGGG + Intronic
1055456383 9:76476080-76476102 TCCTTATTCCAGATGGCAAAAGG - Intronic
1056282160 9:85052113-85052135 CTGTTTTTTCAGATGACAGAAGG - Intergenic
1057080996 9:92174634-92174656 CTGTTCTCCCAGATGGTGCACGG - Intergenic
1058393152 9:104520289-104520311 CTGGCATTCCAGGTGCCACAGGG - Intergenic
1059164046 9:112062060-112062082 CTGGGATTCCAGATGGCATTAGG - Intronic
1059798497 9:117726139-117726161 CTGTTCTGCCTGATGTCACAAGG + Intergenic
1061255338 9:129451907-129451929 CTGTTAGCCAAGATGGCCCAGGG + Intergenic
1187613259 X:20965871-20965893 CTGTTTTTCCTGGTGGGACAGGG - Intergenic
1188154529 X:26724236-26724258 CTGTTCTTCAAGATGGTAAATGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1190726983 X:53196154-53196176 CTGTTATTCCTGCTGTCACTTGG + Intronic
1192137940 X:68622211-68622233 CTGTTATTCAACATAGCACTGGG - Intergenic
1192740995 X:73892650-73892672 CTGGCATTCCAGATGCCACTGGG - Intergenic
1192931770 X:75814317-75814339 CTGGTATTCCAGGTGACACTGGG - Intergenic
1193562632 X:83037910-83037932 CTGGCATTCCAGATGCCACAGGG - Intergenic
1194402924 X:93460623-93460645 CTGATATTCCAGAGGGCCCCTGG - Intergenic
1195540250 X:106055225-106055247 TTGGTACTCCAGATGGCAAACGG - Intergenic
1196458525 X:115906540-115906562 CTTTAATAACAGATGGCACAGGG - Intergenic
1197042673 X:121958342-121958364 TTGGTACTCCAGATGGCAAAGGG - Intergenic
1197157195 X:123283364-123283386 CTGGCATTCCAGATGCCACTGGG - Intronic
1198002303 X:132451691-132451713 CTGGTATTCCAGGTGCCACTGGG + Intronic
1198259765 X:134955405-134955427 CTGATATTCAATATGGCTCATGG + Intergenic
1200256393 X:154585268-154585290 CTGGCATTCCTGATGGCCCAGGG + Exonic
1200261376 X:154619135-154619157 CTGGCATTCCTGATGGCCCAGGG - Exonic
1200267359 X:154653432-154653454 CTGGCATTCCTGATGGCCCAGGG - Exonic