ID: 1073420686

View in Genome Browser
Species Human (GRCh38)
Location 10:103421499-103421521
Sequence CTGATTCAGGAGGAGGAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1461
Summary {0: 1, 1: 0, 2: 7, 3: 82, 4: 1371}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073420686_1073420697 27 Left 1073420686 10:103421499-103421521 CCAGCCTCCTCCTCCTGAATCAG 0: 1
1: 0
2: 7
3: 82
4: 1371
Right 1073420697 10:103421549-103421571 AGCCTTATGAGCAACCGAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1073420686_1073420694 -3 Left 1073420686 10:103421499-103421521 CCAGCCTCCTCCTCCTGAATCAG 0: 1
1: 0
2: 7
3: 82
4: 1371
Right 1073420694 10:103421519-103421541 CAGTGCCTGGAGGAGCTGCAGGG 0: 1
1: 0
2: 6
3: 53
4: 440
1073420686_1073420696 24 Left 1073420686 10:103421499-103421521 CCAGCCTCCTCCTCCTGAATCAG 0: 1
1: 0
2: 7
3: 82
4: 1371
Right 1073420696 10:103421546-103421568 CGCAGCCTTATGAGCAACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 62
1073420686_1073420698 28 Left 1073420686 10:103421499-103421521 CCAGCCTCCTCCTCCTGAATCAG 0: 1
1: 0
2: 7
3: 82
4: 1371
Right 1073420698 10:103421550-103421572 GCCTTATGAGCAACCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
1073420686_1073420700 29 Left 1073420686 10:103421499-103421521 CCAGCCTCCTCCTCCTGAATCAG 0: 1
1: 0
2: 7
3: 82
4: 1371
Right 1073420700 10:103421551-103421573 CCTTATGAGCAACCGAGGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1073420686_1073420693 -4 Left 1073420686 10:103421499-103421521 CCAGCCTCCTCCTCCTGAATCAG 0: 1
1: 0
2: 7
3: 82
4: 1371
Right 1073420693 10:103421518-103421540 TCAGTGCCTGGAGGAGCTGCAGG 0: 1
1: 0
2: 2
3: 54
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073420686 Original CRISPR CTGATTCAGGAGGAGGAGGC TGG (reversed) Exonic
900271636 1:1792952-1792974 GCTATTCAGGAGGATGAGGCAGG + Intronic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
900860968 1:5230702-5230724 CTAATTCAAGAGGCTGAGGCAGG + Intergenic
900987258 1:6080366-6080388 CACATCCGGGAGGAGGAGGCTGG + Intronic
901178621 1:7323632-7323654 CCGACTCAGGAGGCTGAGGCAGG - Intronic
901347807 1:8562598-8562620 CTTACTCAGGAGGCTGAGGCGGG - Intronic
901399779 1:9007846-9007868 CAGCTACAGGAGGCGGAGGCAGG - Intronic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
901526964 1:9829595-9829617 GTGAGTCAGGAGGCTGAGGCAGG - Intergenic
901627110 1:10630596-10630618 CTCACTCCGGAGGAGGAGCCAGG + Exonic
901854646 1:12036960-12036982 CCTATTCAGGAGGCTGAGGCGGG - Intergenic
901916941 1:12507179-12507201 CTCATTTAGGAGGTTGAGGCTGG + Intronic
901935121 1:12621451-12621473 CTGATTCAGGAGGGCCAGGGTGG - Intergenic
902043746 1:13510645-13510667 CAAATGCAGGAGGAGGAGGGAGG + Intronic
902070079 1:13727037-13727059 CTGAGGCAGGAGGGGCAGGCAGG - Intronic
902083575 1:13838793-13838815 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
902210772 1:14902977-14902999 CTACTTCAGGAGGCTGAGGCAGG - Intronic
902345536 1:15814199-15814221 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
902524048 1:17042664-17042686 GTTACTCAGGAGGATGAGGCAGG + Intronic
902602672 1:17550833-17550855 CTGGTGGAGGAGGAGGAGCCAGG + Intronic
902648233 1:17819054-17819076 CTGACCTGGGAGGAGGAGGCTGG - Intronic
902821790 1:18947891-18947913 CTGGCTCAGGGTGAGGAGGCAGG - Intronic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
903151744 1:21414796-21414818 CTGATTTAGGAGGCTGAGGGAGG - Intergenic
903386444 1:22930185-22930207 CTCAGGTAGGAGGAGGAGGCAGG + Intergenic
903489456 1:23717113-23717135 CTCAGTCAGGAGGCTGAGGCAGG + Intergenic
903496300 1:23769876-23769898 GTTACTCAGGAGGAAGAGGCAGG + Intergenic
903595010 1:24487434-24487456 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
903604260 1:24563408-24563430 CTACTTCAGGAGGCTGAGGCAGG + Intronic
903630128 1:24762309-24762331 CTACTTCAGGAGGCTGAGGCAGG + Intronic
903694436 1:25196606-25196628 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
903777507 1:25802100-25802122 CTTACTCAGGAGGCTGAGGCAGG - Exonic
903897564 1:26618434-26618456 CTTACTCAGGAGGTTGAGGCAGG - Intergenic
903912688 1:26739377-26739399 CTGATTCAGTAGGTGTGGGCTGG + Intronic
903940192 1:26924663-26924685 CTTACTCAGGAGGCTGAGGCAGG - Intronic
903948314 1:26978411-26978433 GCTATTCAGGAGGATGAGGCAGG + Intergenic
904168606 1:28575264-28575286 GCTATTCAGGAGGATGAGGCAGG - Intronic
904349961 1:29898745-29898767 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
904352629 1:29918867-29918889 CTGATGGATGAGGAGGAGTCAGG + Intergenic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
904770581 1:32878961-32878983 CTGGGTCATGAGGAGCAGGCTGG + Intergenic
905098376 1:35495762-35495784 GTTATTCAGGAGGCTGAGGCAGG - Intronic
905433164 1:37939250-37939272 CCTATTCAGGAGGCTGAGGCAGG + Intronic
905443646 1:38010360-38010382 CTTCTTCAGGGGGAAGAGGCAGG + Intronic
905574257 1:39030606-39030628 CTGAGGCAGGAGGCTGAGGCAGG + Intronic
905587374 1:39131273-39131295 CTTACTCAGGAGATGGAGGCAGG - Intronic
905588774 1:39143884-39143906 CTGAGGCAGGAGGCTGAGGCAGG - Intronic
905599317 1:39235394-39235416 CTGAGTCAGGAGAATCAGGCAGG + Intronic
905817231 1:40960990-40961012 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
906046116 1:42832300-42832322 CTAACTCAGGAGGCTGAGGCAGG - Intronic
906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG + Intergenic
906465117 1:46071580-46071602 CAGACTCAGGAGGCTGAGGCAGG + Intronic
906622012 1:47289824-47289846 TTTATTCAGGAGGCTGAGGCAGG + Intronic
906952552 1:50346751-50346773 CTGACACACAAGGAGGAGGCTGG - Intergenic
907034992 1:51208249-51208271 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
907311241 1:53540313-53540335 CTGCTTCAGGAGGAAGAAGAGGG + Intronic
907547670 1:55276296-55276318 CTGATCCTGGAGGTGGAGTCAGG - Intergenic
908233617 1:62129825-62129847 CAGCTACAGGAGGATGAGGCAGG + Intronic
908528138 1:65007855-65007877 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
908566982 1:65367205-65367227 CTGATTCAGAAGGACAAGGGAGG + Intronic
908780387 1:67685323-67685345 CTGGCACAGGAGGAGGAGCCCGG + Exonic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
909155961 1:72077004-72077026 CCTATTCAGGAGGCTGAGGCAGG - Intronic
909246934 1:73298531-73298553 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
909409735 1:75336265-75336287 CACATTCAGGAGGCTGAGGCAGG - Intronic
909458206 1:75874566-75874588 GTGACTCAGGAGGATGAGGCAGG - Intronic
909914762 1:81303157-81303179 GGGATGCAGGAGGAGAAGGCCGG - Intergenic
910020995 1:82589451-82589473 CTGACTCGGGAGGCTGAGGCAGG - Intergenic
910400761 1:86835804-86835826 CTAACTCAGGAGGCTGAGGCAGG - Intergenic
910504411 1:87933595-87933617 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
911041861 1:93597731-93597753 CTGATGCAGGAGGCTGAGGGAGG + Intronic
911260827 1:95682981-95683003 CTCACTCTGGAGGAAGAGGCGGG + Intergenic
911612503 1:99972007-99972029 CTACTTCAGGAGGCTGAGGCAGG - Intronic
912431986 1:109632842-109632864 CTGGAGCAGGAGGGGGAGGCTGG + Intergenic
912474806 1:109928615-109928637 CTGATTCCCCAGGAGGAGGTAGG + Intronic
912481169 1:109983248-109983270 CTCACTCAGGAGGCTGAGGCAGG + Intergenic
912618378 1:111130586-111130608 GTGACTCAGGAGGCTGAGGCAGG + Intronic
912705081 1:111905600-111905622 CTGCTTCCAGAGGTGGAGGCTGG + Intronic
912862381 1:113225521-113225543 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
912922189 1:113879986-113880008 CTGATTCTGTAGGGGTAGGCTGG - Intronic
913022951 1:114805230-114805252 CTGATGCAGGAGAAGCAGGCAGG + Intergenic
913070227 1:115292005-115292027 GAGATGGAGGAGGAGGAGGCTGG - Intronic
913187551 1:116382948-116382970 CTGCTTCAGGGGGAGGTGTCTGG + Intronic
913222340 1:116669088-116669110 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
913292583 1:117287637-117287659 GTTACTCAGGAGGATGAGGCAGG + Intergenic
913995225 1:143646351-143646373 GTTACTCAGGAGGATGAGGCAGG + Intergenic
914268266 1:146056185-146056207 CTGATTTAGGAGGCGAAGGGAGG - Intergenic
914368830 1:147004676-147004698 CTGATTTAGGAGGCGAAGGGAGG + Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914719141 1:150274799-150274821 GTTATTCAGGAGGCTGAGGCAGG + Intronic
914893990 1:151652090-151652112 CTGAGTCAGGAGAATCAGGCAGG + Intronic
914946370 1:152070393-152070415 CTACTGAAGGAGGAGGAGGCAGG + Intergenic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
915366967 1:155322071-155322093 CTGAGTGAGGAGGAGCAGCCTGG - Exonic
915387703 1:155511615-155511637 GTGACTCAGGAGGCTGAGGCAGG - Intronic
915496761 1:156287302-156287324 GCTATTCAGGAGGCGGAGGCAGG + Intronic
915581003 1:156813432-156813454 CTGACTCAGGAGGCTGAGGCAGG + Intronic
916421990 1:164646207-164646229 TTGATTCAGGAGCAGCATGCTGG + Intronic
916483132 1:165233341-165233363 GTTATTCAGGAGTATGAGGCAGG + Intronic
916763391 1:167836911-167836933 GTTATTCAGGAGGCTGAGGCAGG + Intronic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917124920 1:171678610-171678632 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
917165337 1:172106307-172106329 CTTACTCAGGAGGCTGAGGCAGG + Intronic
917928356 1:179807216-179807238 CTGATGGTGGAGGGGGAGGCAGG - Intronic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
919541485 1:198851133-198851155 CTCACTCAGGAGGCTGAGGCAGG + Intergenic
919700982 1:200630845-200630867 CTCAGTCAGGAGGCTGAGGCAGG - Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920129141 1:203717751-203717773 CTAACTCAGGAGGCTGAGGCAGG - Intronic
921391961 1:214625324-214625346 CCTATTCAGGAGGATGAGGCAGG - Intronic
921473108 1:215571740-215571762 CTTACTCAGGAGGCTGAGGCAGG - Intronic
922198451 1:223380895-223380917 CCTACTCAGGAGGCGGAGGCAGG - Intergenic
922217493 1:223532267-223532289 CTGTCTCAGGAGGCTGAGGCAGG - Intergenic
922450290 1:225731980-225732002 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
922588561 1:226754549-226754571 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
922634849 1:227158067-227158089 CTCACTCAGGAGGCTGAGGCAGG - Intronic
922650274 1:227331921-227331943 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
922886207 1:229022841-229022863 CTGGTGCATGGGGAGGAGGCGGG + Intergenic
922962428 1:229659892-229659914 CTAACACAGGAGGAGCAGGCAGG - Exonic
923109479 1:230879656-230879678 GTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109515 1:230879771-230879793 CTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109528 1:230879808-230879830 CTGATTGAGGAGGGGGAGGCCGG - Intergenic
923109541 1:230879845-230879867 GTGATTGTGGAGGGGGAGGCCGG - Intergenic
923109576 1:230879958-230879980 GTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109596 1:230880032-230880054 TTGATTGAGGAGGGGGAGGCTGG - Intergenic
923292884 1:232563824-232563846 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
923707675 1:236357982-236358004 GTTATTCAGGAGGCTGAGGCAGG - Intronic
923793178 1:237128273-237128295 CTGAGTCAGGAGAATCAGGCAGG + Intronic
924387883 1:243516663-243516685 TTGCTTCAGGAGGCTGAGGCAGG - Intronic
924745077 1:246824302-246824324 CTGATTGAGAAGAAGTAGGCTGG - Intergenic
1062884797 10:1008291-1008313 CCTATTCAGGAGGCTGAGGCGGG + Intronic
1062892602 10:1075604-1075626 CTGATTCTGTAGGAGGAGATTGG + Intronic
1063169541 10:3495215-3495237 CTCCTTTAGGAGGTGGAGGCAGG - Intergenic
1063231290 10:4067872-4067894 CTGATGAATGAGGAGGAGCCGGG - Intergenic
1063277314 10:4584345-4584367 GTGATTTAGGAGGACGAGGTTGG - Intergenic
1063278234 10:4595371-4595393 ATGATTCAGGAGGCTGAGGTGGG + Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1063530161 10:6822980-6823002 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1063695464 10:8330916-8330938 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1063924402 10:10963150-10963172 CTGAGGCAGGAGGCTGAGGCAGG - Intergenic
1063950838 10:11221953-11221975 CTGATCCAATCGGAGGAGGCAGG + Intronic
1064201707 10:13290181-13290203 GCTATTCAGGAGGATGAGGCAGG + Intronic
1064446399 10:15397703-15397725 GCTACTCAGGAGGAGGAGGCAGG + Intergenic
1064576099 10:16747784-16747806 GTGCTTCAGGAGGCTGAGGCAGG + Intronic
1065127941 10:22592426-22592448 GTGCCCCAGGAGGAGGAGGCAGG + Intronic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065759418 10:28968149-28968171 CTGATTCAGGTGGTGGGGGCTGG + Intergenic
1065769719 10:29066543-29066565 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1065872776 10:29970246-29970268 CTGATTCAGCAGGACTGGGCTGG - Intergenic
1065874157 10:29982813-29982835 CTGATTCAGTAGGACTGGGCTGG + Intergenic
1066049714 10:31621974-31621996 CTTATGCAGGGGGAGGAGCCTGG + Intergenic
1066460063 10:35605417-35605439 CTGAGCCAGGAGTAGGAGGTGGG - Exonic
1066575727 10:36822309-36822331 GTGATTCAGGAGGCTGAGACAGG - Intergenic
1067099296 10:43322992-43323014 CTGAGTCAGTTGGAGGGGGCGGG + Intergenic
1067338731 10:45384112-45384134 CTGATGCAGGGGGAGGGGGAAGG + Intronic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1067813227 10:49447590-49447612 CTGAGGCAGGAGGCCGAGGCAGG + Intergenic
1068186328 10:53591154-53591176 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1068663450 10:59647521-59647543 CTGATCTAGGTGGAGGAGACAGG + Intergenic
1068797942 10:61104869-61104891 CTGATTCAGGATGAGTAGATAGG - Intergenic
1068815914 10:61312849-61312871 CTGCTTCAGGAGGCTGAGACAGG - Intergenic
1069555473 10:69394927-69394949 CTGAGACAGGAGGAGGGGCCTGG - Intronic
1069926153 10:71851995-71852017 CTATTTCAGGAGGCAGAGGCAGG + Intergenic
1070004866 10:72413620-72413642 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1070151804 10:73809981-73810003 CAGACTCAGGAGGCTGAGGCCGG - Intronic
1070172196 10:73941177-73941199 CTGATTCAGAAAGAGGGAGCAGG + Intergenic
1070843317 10:79503061-79503083 CTGAGACAGGGAGAGGAGGCTGG - Intergenic
1070930342 10:80256541-80256563 CTGAGACAGGGAGAGGAGGCTGG + Intergenic
1072027779 10:91479101-91479123 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1072249814 10:93572621-93572643 CTGAGTGGGGAGGAGGAGGTGGG + Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072278001 10:93841605-93841627 CTGCTTCGGGAGGAGGAGTGTGG - Intergenic
1072619040 10:97067809-97067831 CTGGCCCAGGAGGAGGAGGTGGG - Intronic
1072684871 10:97530324-97530346 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1072737717 10:97890226-97890248 GTTACTCAGGAGGATGAGGCAGG - Intronic
1073013032 10:100376490-100376512 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1073193037 10:101665803-101665825 CACATTCCAGAGGAGGAGGCTGG + Intronic
1073356501 10:102859252-102859274 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1073463904 10:103682643-103682665 GCTATTCAGGAGGCGGAGGCAGG + Intronic
1074181932 10:111073184-111073206 CTGATTCAGTAGGATGAAGGCGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074679797 10:115893685-115893707 ATGATTCAGGAGGCTGCGGCTGG + Intronic
1074979251 10:118606488-118606510 CTGATTCAGGAGGTCTGGGCTGG - Intergenic
1076101756 10:127785922-127785944 CTGAGACAGGAGGCTGAGGCAGG + Intergenic
1076501486 10:130939757-130939779 GTGAGGCTGGAGGAGGAGGCAGG + Intergenic
1076546534 10:131249139-131249161 CTGATTCATCAGGTGGGGGCTGG + Intronic
1076589491 10:131573594-131573616 CTGATGGAGAAGCAGGAGGCAGG + Intergenic
1076751381 10:132545191-132545213 CTGATTTTGGGGGAAGAGGCTGG + Intronic
1077104056 11:834245-834267 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1077513306 11:2983872-2983894 CCAATTCAGGAGGCTGAGGCAGG + Intronic
1077520470 11:3030326-3030348 TTGATTCAGGAGCTGTAGGCAGG - Intronic
1077548088 11:3185206-3185228 ATGTTGGAGGAGGAGGAGGCTGG - Intergenic
1077836926 11:5934113-5934135 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1078068007 11:8090423-8090445 CTGATTCAGGAGGTGTCAGCTGG - Intronic
1078211754 11:9275674-9275696 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1078258317 11:9680525-9680547 GCTATTCAGGAGGATGAGGCAGG - Intronic
1078460812 11:11514047-11514069 GTGATTACAGAGGAGGAGGCTGG + Intronic
1078593199 11:12663732-12663754 CTGATTTAGGAGGAAGAGAAGGG - Intergenic
1078756700 11:14217950-14217972 CTGATTCAGTAGGTGTAGGCTGG - Intronic
1079067076 11:17304304-17304326 ATGACTCAGGAGGCTGAGGCAGG - Intronic
1079664669 11:23089751-23089773 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1079836662 11:25342941-25342963 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1080150240 11:29044195-29044217 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1080299906 11:30772312-30772334 TTGACTCAGGAGGCTGAGGCAGG - Intergenic
1080632748 11:34094262-34094284 CTGAGGCAGGAGGCCGAGGCAGG - Intronic
1080655986 11:34258721-34258743 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1081071711 11:38618062-38618084 ATGATGCAGAAGGAGAAGGCAGG - Intergenic
1081089641 11:38847224-38847246 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1081293770 11:41360069-41360091 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1081546442 11:44075320-44075342 CTGAGCCAGGAAGAGGGGGCTGG - Intronic
1081629266 11:44677582-44677604 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1082045721 11:47724623-47724645 GTGATTCTGGAGGTGGAGGTGGG + Exonic
1082086973 11:48058314-48058336 GCTATTCAGGAGGTGGAGGCAGG - Intronic
1083035508 11:59633586-59633608 CTAACTCAGGAGGCTGAGGCAGG - Intergenic
1083114831 11:60450792-60450814 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1083118749 11:60491024-60491046 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083154446 11:60814577-60814599 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083160655 11:60852277-60852299 CTGATCCAGGAGGCCGGGGCCGG - Exonic
1083455968 11:62778787-62778809 GTGGTTGAGGGGGAGGAGGCTGG + Intronic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1083606232 11:63980598-63980620 GTTACTCAGGAGGCGGAGGCAGG - Intronic
1083650211 11:64199086-64199108 ATTACTCAGGAGGATGAGGCAGG + Intronic
1083825634 11:65201932-65201954 CTTACTCGGGAGGATGAGGCAGG - Intronic
1084076923 11:66786184-66786206 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1084405137 11:68967709-68967731 CTGATGAAGGAGGCAGAGGCTGG - Intergenic
1084503625 11:69552015-69552037 ATCCTTCAGGAGGAAGAGGCAGG + Intergenic
1084509084 11:69591898-69591920 CTGTTTCAGGAGGAGATGGTGGG - Intergenic
1084576686 11:69993136-69993158 CTGTCTCAGGAGGGGGTGGCTGG - Intergenic
1084868264 11:72078106-72078128 CTGAGGCAGGAGGAGCAGGCGGG - Intronic
1085234803 11:75006148-75006170 CTGAGGCTGGAGGAGGAAGCTGG + Exonic
1085299541 11:75450178-75450200 CTGAGGCAGGAGGAGGCAGCAGG + Intronic
1085453927 11:76655276-76655298 CTGGTTCCGGCAGAGGAGGCGGG + Intergenic
1085505930 11:77059049-77059071 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1085667864 11:78431643-78431665 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1085688306 11:78645708-78645730 GTGATTCAGGATGAGGCAGCAGG - Intergenic
1086365086 11:86100920-86100942 CTCACTCAGGAGGCTGAGGCAGG - Intergenic
1086420294 11:86631842-86631864 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1086507266 11:87518805-87518827 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
1086778001 11:90863836-90863858 ATGAGTCGGGAGGATGAGGCAGG + Intergenic
1087392608 11:97557104-97557126 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1087533509 11:99414105-99414127 GTGGTTTAGGAGGAAGAGGCAGG - Intronic
1087940185 11:104087305-104087327 CTGAGGCAGGAGGCCGAGGCAGG - Intronic
1088322049 11:108564174-108564196 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1088559578 11:111099093-111099115 CTAATTCAGGAAGAGGAGGCGGG + Intergenic
1088571446 11:111227679-111227701 GCTATTCAGGAGGATGAGGCAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088975565 11:114813304-114813326 CTGATTTACAAGGAGGAAGCTGG - Intergenic
1089037167 11:115406836-115406858 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1089246230 11:117122420-117122442 GTGACTCAGGAGGCTGAGGCGGG - Intergenic
1089487733 11:118860169-118860191 CTGATTCAGTAGGACCAGGGTGG + Intergenic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1089854677 11:121532795-121532817 CAGACTCAGGAGGCTGAGGCAGG - Intronic
1089996020 11:122908264-122908286 CTGATTCAGCAGGTGTAGGGTGG + Intronic
1090020959 11:123127923-123127945 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1090197858 11:124832326-124832348 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1090359014 11:126159991-126160013 CAGCTTTAGAAGGAGGAGGCTGG - Intergenic
1090389499 11:126379587-126379609 GTTACTCAGGAGGATGAGGCAGG - Intronic
1091026197 11:132143296-132143318 CTGATTCAGTAGGCCCAGGCAGG - Intronic
1091282566 11:134390350-134390372 CTGATGAAGGATGGGGAGGCTGG + Exonic
1091889776 12:4044374-4044396 CTGAATGATCAGGAGGAGGCTGG - Intergenic
1092129747 12:6101662-6101684 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1092151761 12:6253779-6253801 CTAATTCGGGAGGCTGAGGCAGG + Intergenic
1092181784 12:6451375-6451397 CTGGCTCAGGGGGAGCAGGCAGG - Exonic
1092197090 12:6555988-6556010 CTGCTGCAGGAGGAAGAGGTTGG + Exonic
1092393247 12:8100522-8100544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1092500219 12:9038147-9038169 CCTATTCAGGAGGCTGAGGCTGG + Intergenic
1092607003 12:10131775-10131797 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1092822121 12:12362749-12362771 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1092901377 12:13062676-13062698 CTTACTGAGGAGGAGGAAGCAGG - Intronic
1092942549 12:13423772-13423794 CTAATTCAGGAGGCTGAGGCAGG + Intergenic
1093136979 12:15463853-15463875 CTGACACAGGAGGGGTAGGCTGG + Intronic
1093376425 12:18433412-18433434 CTGAGGCAGGAGGCTGAGGCAGG + Intronic
1093486892 12:19662058-19662080 CTGGTTTGGGAGGACGAGGCGGG + Intronic
1093626265 12:21351664-21351686 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094293608 12:28879131-28879153 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1094554251 12:31482688-31482710 CTGACTCAGGAGGCTGAGGCGGG - Intronic
1094584292 12:31763289-31763311 ATGACTCAGGAGGCTGAGGCAGG + Intergenic
1094614521 12:32024143-32024165 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1094624848 12:32113819-32113841 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1094750508 12:33400912-33400934 CTAATTCAGGAGGCTGAGGCGGG + Intronic
1095076383 12:37932782-37932804 GCTATTCAGGAGGATGAGGCAGG - Intergenic
1095221841 12:39625545-39625567 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1095434834 12:42176132-42176154 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1096074510 12:48794397-48794419 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1096121301 12:49091108-49091130 CTGGTACAGTAGGAGGAGGGTGG - Exonic
1096245418 12:49982355-49982377 CTGGTTCTGGAGCAGCAGGCTGG + Intronic
1096366614 12:51033578-51033600 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1096622725 12:52874452-52874474 CTGACTCAGCAGGGGGAGCCTGG + Intergenic
1096640081 12:52987399-52987421 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1096657612 12:53101457-53101479 CTGATTCAGGAGGTGTGGGGTGG + Intronic
1097006233 12:55920089-55920111 GCTACTCAGGAGGAGGAGGCAGG + Intronic
1097287147 12:57887128-57887150 ATGACTCAGGAGGCCGAGGCAGG + Intergenic
1097328323 12:58304348-58304370 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1097514289 12:60585186-60585208 CTTATTCAAGGGGAGGAGCCCGG - Intergenic
1098229805 12:68361991-68362013 CTGATGGATGAGGAGGATGCTGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098271760 12:68776399-68776421 CTCACTCAGGAGGCTGAGGCAGG + Exonic
1098383159 12:69890621-69890643 CTTACTCAGGAGGTTGAGGCAGG + Intronic
1098634973 12:72771777-72771799 CTGCTTTAGGTGGAGGAGACTGG + Intergenic
1098889286 12:75992539-75992561 GTGAGTCAGGAGGCTGAGGCAGG - Intergenic
1098898876 12:76092411-76092433 CTGATTCTGAGGTAGGAGGCAGG + Intergenic
1098905222 12:76155009-76155031 GTGATTCAGGAGGGTGAGGCAGG - Intergenic
1098924490 12:76334443-76334465 CTGTTCCAGGAGGCCGAGGCGGG + Intergenic
1099169103 12:79342341-79342363 GTGACTCAGGAGGCTGAGGCAGG - Intronic
1099598723 12:84703218-84703240 CTGAGTCAGGAGGCTGAGACAGG - Intergenic
1100508636 12:95245731-95245753 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1100881498 12:99022796-99022818 GTGACTCAGGAGGCTGAGGCAGG - Intronic
1100990307 12:100244580-100244602 ATTATTCAGCAGGATGAGGCAGG - Intronic
1100998691 12:100331976-100331998 ATGATTCAGTAGGAGGACTCAGG + Intronic
1101808139 12:108082923-108082945 CTGATTCAGGAGGAAAAGTGAGG - Intergenic
1102501758 12:113358253-113358275 CCTACTCAGGAGGATGAGGCAGG + Intronic
1102620706 12:114192444-114192466 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1102638817 12:114348113-114348135 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1102833165 12:116026540-116026562 CTGATTCAGGAGGTTTAGGGTGG + Intronic
1102922018 12:116798678-116798700 CAGATTCAGGAGGCTGAGGCGGG - Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103014018 12:117480243-117480265 ATGAGTCAGGAAGAGGTGGCAGG - Intronic
1103297091 12:119896964-119896986 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103489924 12:121309324-121309346 CATATTCAGGAGGCTGAGGCAGG + Intronic
1103500445 12:121397747-121397769 AGGCTTCAGGAGGCGGAGGCGGG - Intronic
1103525708 12:121566682-121566704 GCTATTCAGGAGGATGAGGCAGG + Intronic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1104067321 12:125316671-125316693 CTCATTCCGGAAGAGGGGGCAGG + Intronic
1104534980 12:129610158-129610180 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1104749588 12:131229861-131229883 CTGCTCCATCAGGAGGAGGCGGG + Intergenic
1104862556 12:131931505-131931527 GTGACTCAGGAGGCTGAGGCAGG - Intronic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1105451263 13:20502335-20502357 CTGAGTGAGGAGGGGGAAGCGGG - Intronic
1105527235 13:21187302-21187324 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1105578911 13:21675576-21675598 CTGCTGCCGGAGGAGGAGGAGGG - Intronic
1105700132 13:22929562-22929584 GTGACTCAGGAGGTTGAGGCAGG - Intergenic
1106095596 13:26640511-26640533 GCTACTCAGGAGGAGGAGGCAGG - Intronic
1106398086 13:29401097-29401119 GGTATTCAGGAGGATGAGGCAGG - Intronic
1106598462 13:31167090-31167112 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1106607762 13:31247030-31247052 CTGATGAAGGAGGAGGACACTGG - Exonic
1106724131 13:32467367-32467389 CTTATTCAGGAAGCTGAGGCAGG - Intronic
1107271828 13:38628188-38628210 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1107474242 13:40720054-40720076 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1107644628 13:42481005-42481027 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
1107713067 13:43169794-43169816 TGAACTCAGGAGGAGGAGGCTGG - Intergenic
1107945662 13:45415909-45415931 GTTACTCAGGAGGATGAGGCAGG - Intronic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108303542 13:49106422-49106444 GTTATTCAGGAGGCTGAGGCGGG - Intronic
1109288688 13:60445620-60445642 CTGATTCAGTAGGACTAGGATGG + Intronic
1109753737 13:66730788-66730810 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1109997851 13:70153461-70153483 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1110225730 13:73117614-73117636 GTGACTCAGGAGGCTGAGGCGGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110524660 13:76522133-76522155 CTTATTCAGGGGGAGGAGCCTGG - Intergenic
1110782660 13:79484125-79484147 GTGACTCAGGAGGCTGAGGCAGG - Intronic
1110899914 13:80809330-80809352 TTAACTCAGGAGGTGGAGGCAGG - Intergenic
1111172460 13:84545470-84545492 GTGATTCAGAAGGCAGAGGCAGG - Intergenic
1112172379 13:96987487-96987509 GTGAATCAGGAAGGGGAGGCTGG + Exonic
1112365669 13:98752899-98752921 CTGACTCAGGAGGTCGGGGCTGG + Intergenic
1112427567 13:99317238-99317260 CTGATTGTGGAAGAAGAGGCAGG - Intronic
1112573164 13:100612068-100612090 CTGGTGCAGGAGGAGGACTCAGG - Intronic
1113165346 13:107434502-107434524 GTGATTCAGGAGAGGTAGGCTGG - Intronic
1113346436 13:109482723-109482745 GTGATTCTGGTGGAGGGGGCAGG + Intergenic
1113536738 13:111072919-111072941 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1113636805 13:111925064-111925086 CTGATTCAGGAGGTCTAGGTGGG + Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113845725 13:113389734-113389756 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1113936158 13:113996203-113996225 CTGCTTCTCTAGGAGGAGGCTGG - Intronic
1114428736 14:22642448-22642470 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1114830888 14:26140190-26140212 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115654205 14:35427742-35427764 CTCACTCAGGAGGCTGAGGCAGG - Intergenic
1115830809 14:37338518-37338540 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1115914168 14:38291732-38291754 CTGATTCAGGGGGAGAAATCAGG + Intergenic
1116626155 14:47266481-47266503 ATGATTGAGCATGAGGAGGCAGG - Intronic
1116942984 14:50809336-50809358 CAGATCCTGGAGGAGAAGGCAGG - Intronic
1117162550 14:53003390-53003412 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1117665912 14:58055671-58055693 CTGATTCAGGAGGTGTAGGGTGG - Intronic
1118015044 14:61651897-61651919 GTGATTGAGAGGGAGGAGGCAGG + Intronic
1118275510 14:64382974-64382996 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1118323542 14:64767084-64767106 CTGGTGCGGGAGGAGGGGGCTGG - Intronic
1118925102 14:70185076-70185098 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1119040723 14:71271940-71271962 GCGACTCAGGAGGATGAGGCAGG + Intergenic
1119114769 14:72009106-72009128 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1119189571 14:72671316-72671338 CTCATTTGGGAGGAGAAGGCAGG - Exonic
1119242459 14:73072516-73072538 CTGATTCAGGGGGATGGAGCAGG - Intronic
1119254744 14:73185494-73185516 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1119511969 14:75218806-75218828 GCTATTCAGGAGGATGAGGCAGG + Intergenic
1119973443 14:78998708-78998730 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1120359714 14:83483260-83483282 TGGATTCTGGAGGAGGTGGCTGG + Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120864245 14:89282154-89282176 ATGATTGAGGAGGAGTAGGAGGG + Intronic
1120879554 14:89404390-89404412 GCTATTCAGGAGGATGAGGCAGG + Intronic
1120881606 14:89418229-89418251 CTGGCTCAGGAGGGGGTGGCAGG - Intronic
1121144707 14:91573966-91573988 CCGATGGGGGAGGAGGAGGCTGG + Intergenic
1121176450 14:91894289-91894311 CTCACTCAGGAGGCTGAGGCAGG + Intronic
1121618263 14:95328297-95328319 CTGAGGCAGGAGGCTGAGGCAGG + Intergenic
1121696639 14:95918680-95918702 CTGACTCAGGAGGAAGTGGAGGG - Intergenic
1122180439 14:99950539-99950561 CTGATTCACACAGAGGAGGCAGG + Intergenic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122391290 14:101387349-101387371 CCTATTCAGGAGGATGATGCAGG - Intergenic
1122454870 14:101842346-101842368 CTGAAACAGGAGGAGAGGGCAGG + Intronic
1122549052 14:102540096-102540118 CAGGCTCTGGAGGAGGAGGCCGG - Intergenic
1122655458 14:103256283-103256305 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1122675737 14:103411732-103411754 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1123125326 14:105941828-105941850 CTGGTGCAGGATGAGGAGGTGGG + Intergenic
1123702663 15:22927369-22927391 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1123808161 15:23896699-23896721 TGGATTCAGGATGGGGAGGCTGG + Intergenic
1123887427 15:24740503-24740525 CCTATTCAGGAGGCTGAGGCGGG - Intergenic
1123894313 15:24813283-24813305 TGGATTGAGGATGAGGAGGCTGG + Intergenic
1123981232 15:25606475-25606497 TTTACTCAGGAGGTGGAGGCAGG - Intergenic
1124106905 15:26746873-26746895 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1124425543 15:29559684-29559706 CTGAGTCAGTAGTAGGAGGTGGG - Intronic
1124723244 15:32131973-32131995 CTGAAACAGCAGGAGGCGGCTGG + Intronic
1125061856 15:35435519-35435541 CTTATGCAGGGGGAGGAGTCAGG + Intronic
1125287433 15:38108916-38108938 CTGTTTCTGGAGGCCGAGGCAGG + Intergenic
1125459819 15:39895119-39895141 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1125531909 15:40419022-40419044 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1125595350 15:40881903-40881925 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1125635077 15:41181196-41181218 GCTATTCAGGAGGCGGAGGCGGG - Intergenic
1125657222 15:41367801-41367823 CTGATTCTGGTAGAGGAGACAGG + Intronic
1125866492 15:43055330-43055352 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1126011889 15:44310903-44310925 CTTATTCGGGAGGCTGAGGCAGG + Intronic
1126028841 15:44476178-44476200 GCTATTCAGGAGGATGAGGCAGG - Intronic
1126137227 15:45403319-45403341 CTCGTCCAGGAAGAGGAGGCTGG - Exonic
1126473581 15:49042914-49042936 CAGCTTCAGGAGGCTGAGGCAGG + Intronic
1127486778 15:59425735-59425757 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1127527993 15:59812996-59813018 TTGTTTAAGGAGGAGGAGACAGG - Intergenic
1127659000 15:61082375-61082397 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1127797549 15:62451543-62451565 GTTACTCAGGAGGCGGAGGCAGG + Intronic
1127828684 15:62730138-62730160 CTGAGGCAGGAGGCTGAGGCAGG - Intronic
1127959259 15:63878915-63878937 CTGGGTCAAGCGGAGGAGGCAGG + Intergenic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1127991058 15:64117678-64117700 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1128244252 15:66122150-66122172 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1128380918 15:67111897-67111919 GTGACTCAGGAGGCTGAGGCAGG - Intronic
1128556372 15:68634662-68634684 CTGATTCAGGAAGTCGAGGGTGG - Intronic
1128614837 15:69100995-69101017 CTGATTCAGCTGGGAGAGGCAGG + Intergenic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128760948 15:70215586-70215608 CTCATTCAGGAGGAAGAATCAGG + Intergenic
1129274883 15:74438468-74438490 CTGGTCTAGGAGGAAGAGGCAGG - Intergenic
1129277666 15:74457623-74457645 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1129362327 15:75031590-75031612 GTTACTCAGGAGGCGGAGGCAGG + Intronic
1129418493 15:75403316-75403338 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1129465186 15:75720783-75720805 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1129709999 15:77816098-77816120 CTGTTTCAGAAGGAGGGGACTGG - Intronic
1129824509 15:78625823-78625845 ATGATGCAGCAGGAGGAGGCTGG - Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130724598 15:86425767-86425789 CTGATTCAAGAGGGAGAGGTGGG + Intronic
1130761746 15:86828049-86828071 CTTATTCAGGAGGCTGAAGCAGG - Intronic
1130957348 15:88637074-88637096 CTGCTTCAGGTGGAAGAGACAGG - Intronic
1131085760 15:89574674-89574696 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1131309844 15:91280045-91280067 CTGGTTCAAGAGGTGTAGGCTGG + Intronic
1131713869 15:95087260-95087282 CTGGTTCAGGAGGAAGATGTTGG - Intergenic
1131777590 15:95819138-95819160 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1132145087 15:99424927-99424949 TAGATTCAGGAGGAAGAGGTGGG - Intergenic
1132366913 15:101264475-101264497 CTGTTTCTGCAGGAGGAAGCAGG - Intergenic
1132627854 16:900619-900641 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1132906749 16:2286425-2286447 TAGATTTAGGAGGAGAAGGCAGG + Intronic
1132942750 16:2516222-2516244 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1133159540 16:3901285-3901307 CAGCTTCAGGAGGCTGAGGCTGG + Intergenic
1133302739 16:4792688-4792710 GTGATTCGGGAGGCCGAGGCAGG + Intronic
1133491056 16:6268482-6268504 CTGATTCAGGAGGTCTATGCTGG - Intronic
1134174687 16:11996086-11996108 CTGGTTCAGGAGGTTGAGGATGG - Intronic
1134211061 16:12277286-12277308 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1134222005 16:12362394-12362416 CTGCAGCAGGTGGAGGAGGCTGG - Intronic
1134322836 16:13179205-13179227 CCTATTCAGGAGGCTGAGGCGGG + Intronic
1134468431 16:14499762-14499784 GCTACTCAGGAGGAGGAGGCAGG + Intronic
1134621446 16:15692519-15692541 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1134767852 16:16777147-16777169 ATGCTTCAGGAGGCTGAGGCAGG - Intergenic
1134794253 16:17020262-17020284 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1134806925 16:17134000-17134022 CTGATCCGGGAGGAGGCGGAAGG + Intronic
1134975066 16:18564046-18564068 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1135322836 16:21508368-21508390 CTGAGGCAGGAGGCTGAGGCAGG - Intergenic
1135654373 16:24234833-24234855 GTGATTTAGGAGGCTGAGGCGGG - Intergenic
1135664829 16:24326906-24326928 CTGGTTCAGGATCAGGTGGCAGG - Intronic
1135695613 16:24583716-24583738 GTTATTCAGGAGGCTGAGGCGGG - Intergenic
1136028389 16:27484958-27484980 CTGGTGCAGCTGGAGGAGGCAGG - Intronic
1136155035 16:28376825-28376847 CTGAGACAGGAGAATGAGGCAGG - Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136230177 16:28881083-28881105 GTGATGGAGGAGGAGGAGACTGG - Intronic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136271014 16:29148257-29148279 CTGATTCAGGAGGCTGGGGCAGG + Intergenic
1136334321 16:29601553-29601575 CTGAGGCAGGAGGCTGAGGCAGG - Intergenic
1136387132 16:29935703-29935725 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1136494384 16:30633357-30633379 GAGATTCAGGAGGCTGAGGCAGG - Intergenic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137493331 16:48951203-48951225 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137830311 16:51537921-51537943 CTGAATTAGAAGGAGGAGTCTGG - Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138079649 16:54077761-54077783 CTGAGTCAGAAGGAAGAGGTAGG + Intronic
1138366868 16:56486872-56486894 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1138578839 16:57926407-57926429 CTGAGTCAAGATGATGAGGCTGG - Intronic
1138608542 16:58104838-58104860 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1138644337 16:58412770-58412792 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1138644760 16:58416523-58416545 GTGATTCAGGAGGCTGAGGCAGG - Intergenic
1138746629 16:59370232-59370254 CTGAAACAGGAGGAGGTTGCCGG - Intergenic
1138777092 16:59736006-59736028 CCTATTCAGGAGGATGAGGCAGG + Intronic
1139247545 16:65460802-65460824 CTGAATCAGAAGGAGGTGCCAGG - Intergenic
1139308555 16:66008697-66008719 GTGCTTCAGGAGGCCGAGGCGGG - Intergenic
1139643920 16:68313535-68313557 CTGAGGCAGGAGGAGAAGGAGGG - Intronic
1139693367 16:68655749-68655771 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1139867664 16:70075916-70075938 GGGATTCAGGAGGCTGAGGCGGG + Intergenic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140285170 16:73596130-73596152 CTAACTCAGGAGGCCGAGGCAGG - Intergenic
1140860246 16:79011898-79011920 GTGACTCAGGAGGCTGAGGCGGG - Intronic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141101014 16:81197555-81197577 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141389485 16:83652638-83652660 CTCACTCAGGAGCTGGAGGCTGG + Intronic
1141498130 16:84424387-84424409 GAGATTCAGGAGGCTGAGGCAGG - Intronic
1141655620 16:85414744-85414766 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1141956869 16:87378045-87378067 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1141966742 16:87450680-87450702 CTCACTCAGGAGGCTGAGGCAGG - Intronic
1142023267 16:87797487-87797509 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1142035030 16:87857388-87857410 CTGAGGCAGGAGGCTGAGGCAGG - Intronic
1142074627 16:88110266-88110288 CTGATTCAGGAGGCTGGGGCGGG + Intronic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142212410 16:88814703-88814725 CTCACTCAGGAGGCTGAGGCAGG - Intronic
1142332175 16:89462176-89462198 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1203141786 16_KI270728v1_random:1771705-1771727 ATGATGGAGGAGGAGGAGGAGGG - Intergenic
1142533456 17:598068-598090 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1142626209 17:1193800-1193822 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1142725769 17:1812658-1812680 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1142749592 17:1979159-1979181 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1142750068 17:1982187-1982209 GCTATTCAGGAGGATGAGGCAGG + Intronic
1142806956 17:2376348-2376370 GTGATTCAGGAGCAGGAGAGAGG - Intronic
1142878163 17:2864810-2864832 GTAATTCAGGAGGGGGAGGGAGG - Intronic
1143011017 17:3866215-3866237 CTGGTACATGAGGAGGGGGCCGG + Intronic
1143034802 17:3988576-3988598 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1143066724 17:4255356-4255378 CTGCTTCAGGAGGCTGAGGCAGG - Intronic
1143287506 17:5801256-5801278 CTAACTCAGGAGGCTGAGGCAGG - Intronic
1143359225 17:6354419-6354441 GTTATTCAGGAGGTTGAGGCAGG - Intergenic
1143674721 17:8423570-8423592 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1143689503 17:8549795-8549817 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1143696766 17:8626453-8626475 GTTCTTCAGGAGGATGAGGCAGG + Intronic
1143922868 17:10344707-10344729 ACTATTCAGGAGGTGGAGGCAGG + Intronic
1144003888 17:11082060-11082082 CTGGTTCATGAGGAGGAGGGTGG - Intergenic
1144063805 17:11606558-11606580 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144090234 17:11849787-11849809 CTCATTCAGGTGGGGGAGACAGG - Intronic
1144090420 17:11851220-11851242 CTGAGGCAGGAGGCTGAGGCAGG - Intronic
1144154937 17:12491298-12491320 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1144386658 17:14754468-14754490 CTGATTCAGGAGGTGTGAGCTGG + Intergenic
1144423671 17:15120986-15121008 CTGATTCAGGAGGTCTGGGCGGG - Intergenic
1144433692 17:15220048-15220070 CTAACTCAGGAGGCTGAGGCAGG + Intergenic
1144699079 17:17325047-17325069 CTGATTCAGAAGGTGTAGGGTGG - Intronic
1144819341 17:18060662-18060684 GTTACTCAGGAGGCGGAGGCAGG - Intronic
1144823582 17:18092353-18092375 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1145920408 17:28605154-28605176 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1146134739 17:30309324-30309346 CTGAGTCAGGATGAGGGGCCAGG + Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146414672 17:32620790-32620812 CTGATGTAGGGGGAGGAGCCAGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146602314 17:34228516-34228538 CTGCTTCAGGAGGGGGAAGGTGG - Intergenic
1146660665 17:34663315-34663337 ATGGGGCAGGAGGAGGAGGCTGG + Intergenic
1146718607 17:35107015-35107037 CTGAAGCAGCTGGAGGAGGCGGG + Exonic
1147048457 17:37772385-37772407 CTAACTCAGGAGGCTGAGGCAGG + Intergenic
1147056706 17:37840344-37840366 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1147138936 17:38450972-38450994 CTGATGCAGGGGGAGGAAGCTGG + Intronic
1147549601 17:41430409-41430431 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1147662751 17:42125737-42125759 GTCATTCAGGCGGAGGAGGCGGG + Exonic
1147773767 17:42886050-42886072 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
1148064524 17:44859168-44859190 GTGTTTCAGGTGGAGGAGTCTGG - Exonic
1148141735 17:45333864-45333886 AGGAATCAGGAGCAGGAGGCGGG + Intergenic
1148459387 17:47829945-47829967 CTGATTCAGTAGGTCTAGGCAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148764757 17:50030939-50030961 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1149424108 17:56538472-56538494 GTTACTCAGGAGGATGAGGCAGG + Intergenic
1149487773 17:57056699-57056721 GTTACTCAGGAGGATGAGGCAGG + Intergenic
1149535551 17:57430913-57430935 CAAATTCAGGAAGAAGAGGCGGG - Intronic
1149567140 17:57648525-57648547 CTGCCTCAGGAGGAGGAGTCTGG + Intronic
1150261643 17:63797238-63797260 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1150380854 17:64718293-64718315 ATGATTCATGAGGAGGAGAGTGG - Intergenic
1150441591 17:65195932-65195954 CTGATTCAGTAGGAGTGGGTGGG - Intronic
1150545557 17:66154065-66154087 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1150606887 17:66699696-66699718 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1150775646 17:68079819-68079841 ATGATTCATGAGGAGGAGAGTGG + Intergenic
1151183755 17:72348910-72348932 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1151311339 17:73294237-73294259 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1151894234 17:76969372-76969394 CCGACTTAGGAGGAGAAGGCAGG - Intergenic
1151944398 17:77311575-77311597 CTGATTCACCAGGTGGAGCCAGG - Intronic
1152072883 17:78142763-78142785 CTGATTCAGGAGGCTGAGGTGGG - Exonic
1152102559 17:78311064-78311086 CTCACTCAGGAGGCTGAGGCAGG - Intergenic
1152128989 17:78465037-78465059 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1152132368 17:78485058-78485080 CTGGCTCAGGAGGCGCAGGCGGG - Intronic
1152199336 17:78935983-78936005 GTGATCCAGGTGGAGGAGGCAGG + Intergenic
1152778710 17:82217094-82217116 CTGCTCCAGGAGGAGGGGGGTGG + Intergenic
1153226380 18:2903159-2903181 CTGATCCAAGAAGAGGAGGGAGG + Intronic
1153633910 18:7097956-7097978 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1153652795 18:7256180-7256202 CTGAGGCAAGAGGATGAGGCAGG - Intergenic
1153914829 18:9735946-9735968 CCTACTCAGGAGGATGAGGCAGG - Intronic
1153924678 18:9825545-9825567 TTGATTCAATAGGAAGAGGCAGG + Intronic
1153974342 18:10254157-10254179 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1153979464 18:10296866-10296888 ATTATTCAGGAGGCTGAGGCAGG + Intergenic
1154243801 18:12677324-12677346 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1154486499 18:14875759-14875781 ATCATACAGGAGAAGGAGGCAGG + Intergenic
1155040307 18:22059752-22059774 CTAACTCAGGAGGCCGAGGCAGG + Intergenic
1155137881 18:23014520-23014542 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155217921 18:23659629-23659651 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1155293033 18:24360077-24360099 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1155504018 18:26515615-26515637 CTCACTCAGGAGGCTGAGGCAGG - Intronic
1155529617 18:26753672-26753694 CTAAATCAGGTGGAGTAGGCTGG + Intergenic
1156073017 18:33236814-33236836 CTGATTCAGGAACAGGAGATGGG - Intronic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156184534 18:34646825-34646847 GTGACTCAGGAGGCTGAGGCAGG - Intronic
1156203690 18:34862550-34862572 CTGCTTTAGGAGGCTGAGGCAGG + Intronic
1156957476 18:42986149-42986171 GTGACTCAGGAGGCCGAGGCAGG - Intronic
1156994875 18:43452983-43453005 CCCATTCAGGAGGCTGAGGCAGG - Intergenic
1157092209 18:44649853-44649875 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
1157157336 18:45280789-45280811 ATGATTCAAGAGGAAAAGGCAGG - Intronic
1157625763 18:49049945-49049967 CTGTTTCAGTAAGAGAAGGCAGG + Intronic
1157765466 18:50293498-50293520 CTTACTCAGGAGGTTGAGGCAGG + Intergenic
1157881646 18:51326722-51326744 ATTACTCAGGAGGCGGAGGCAGG - Intergenic
1158163741 18:54515767-54515789 GTTACTCAGGAGGATGAGGCAGG - Intergenic
1158224765 18:55189602-55189624 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1158328505 18:56336275-56336297 GAGACTCAGGAGGATGAGGCAGG - Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1159062737 18:63533087-63533109 GCTATTCAGGAGGATGAGGCAGG - Intergenic
1159063659 18:63543706-63543728 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1159340602 18:67127565-67127587 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1159363036 18:67429903-67429925 GCTATTCAGGAGGATGAGGCAGG - Intergenic
1159736939 18:72112100-72112122 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1160021799 18:75187035-75187057 AGGAGTCAGGAGGAGGAGGCAGG - Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160334699 18:78028399-78028421 GTGATTTAGGAGGCTGAGGCAGG - Intergenic
1160574577 18:79845254-79845276 GGGGTTCAGGAGGAGGTGGCTGG + Intergenic
1160666393 19:331555-331577 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1160840933 19:1146783-1146805 CTGATGCCGAAGGGGGAGGCTGG + Intronic
1161111621 19:2474123-2474145 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1161265581 19:3362114-3362136 CTGGTGCAGGAGGAGCAGGGAGG + Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161868661 19:6853617-6853639 GTGATTCAGGAGGCTGAGGCAGG + Intronic
1161884049 19:6979678-6979700 CAGATACAGGAAGAGGAGGGGGG + Intergenic
1162468194 19:10855638-10855660 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1162504168 19:11072958-11072980 GCTATTCAGGAGGATGAGGCAGG + Intergenic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162656969 19:12138705-12138727 TTGATACAGGAGGCTGAGGCAGG + Intronic
1163002495 19:14376710-14376732 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1163029892 19:14537204-14537226 GGGGCTCAGGAGGAGGAGGCGGG + Intronic
1163263160 19:16203525-16203547 CTGATGGAGAAGGAGGAGGAGGG + Exonic
1163625564 19:18387416-18387438 GTTATTCAGGAGGCTGAGGCGGG + Intronic
1163670350 19:18624103-18624125 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1163892458 19:20029088-20029110 GTGACTCAGGAGGCTGAGGCAGG - Intronic
1164187843 19:22887148-22887170 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164279995 19:23760774-23760796 ATTATTCAGGAGGCTGAGGCAGG - Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164394347 19:27850673-27850695 ATGGTGTAGGAGGAGGAGGCGGG - Intergenic
1164430681 19:28185853-28185875 CAGCCTCATGAGGAGGAGGCTGG + Intergenic
1164908411 19:31986001-31986023 GTGATTCAGGAGGCCAAGGCAGG + Intergenic
1165374671 19:35433359-35433381 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
1165762716 19:38331216-38331238 GTTACTCAGGAGGATGAGGCAGG + Intergenic
1165875448 19:39003360-39003382 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1165927860 19:39338179-39338201 GTTACTCAGGAGGATGAGGCAGG + Intronic
1166187945 19:41154055-41154077 GCTATTCAGGAGGCGGAGGCGGG + Intergenic
1166384655 19:42373957-42373979 GTGCTTCAGGAGGCTGAGGCAGG - Intronic
1166520764 19:43478801-43478823 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1167038648 19:47009226-47009248 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1167048015 19:47062603-47062625 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1167053722 19:47095664-47095686 TGGGTTCAGGAGGGGGAGGCTGG + Intronic
1167067156 19:47195164-47195186 CTTAGTCAGGAGGCTGAGGCAGG - Intronic
1167076282 19:47251584-47251606 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1167386983 19:49169381-49169403 CTGAGGCAGGAGGCTGAGGCAGG - Intronic
1167416807 19:49378024-49378046 GTGAGTCAGGAGGCTGAGGCAGG - Intergenic
1167428808 19:49442903-49442925 CAGATTCCGGGGGCGGAGGCAGG - Intergenic
1167436988 19:49484972-49484994 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1167570107 19:50281609-50281631 CGGCGCCAGGAGGAGGAGGCAGG + Exonic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167756890 19:51418314-51418336 CAGACTCAGGAGGCTGAGGCAGG - Intergenic
1167987364 19:53330070-53330092 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1168034416 19:53707971-53707993 CTAATTCAGGAGGCTGAGGTGGG - Intergenic
1168035966 19:53719726-53719748 CTAATTCAGGAGGCTGAGGTGGG - Intergenic
1168047039 19:53801562-53801584 GCGATTCAGGAGGCTGAGGCAGG - Intronic
1168097352 19:54123299-54123321 ATGCTTCAGGCGGTGGAGGCAGG + Intronic
1168277741 19:55286521-55286543 GGGATTCAGGAGGAGGTGGAGGG + Intronic
1168361121 19:55741487-55741509 CTAACTCAGGAGGCTGAGGCAGG + Intergenic
1168465011 19:56595084-56595106 AGGATTGAGGGGGAGGAGGCAGG - Intergenic
1168617066 19:57846877-57846899 CTCACTCAGGAGGCTGAGGCAGG + Intronic
1168712398 19:58509272-58509294 GTTACTCAGGAGGATGAGGCAGG + Intronic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925222518 2:2153518-2153540 CTGATGCGGGAAGAGGAGGAAGG + Intronic
925524117 2:4780866-4780888 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
925751711 2:7095460-7095482 CTGCTGCAGGGAGAGGAGGCTGG + Intergenic
925880326 2:8346748-8346770 CTGCTTCAGATGGAGGAGGAAGG - Intergenic
926215697 2:10903756-10903778 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926538968 2:14151067-14151089 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
926668227 2:15548529-15548551 CTACTTCAGGAGGCTGAGGCAGG + Intronic
927522135 2:23705378-23705400 CTAACTCAGGAGGCTGAGGCAGG + Intronic
927886792 2:26723767-26723789 TGGATTCAGGGAGAGGAGGCTGG + Intronic
928003387 2:27541294-27541316 CTGATGCAGGAGAATCAGGCAGG + Intronic
928140283 2:28722900-28722922 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
928374259 2:30762339-30762361 CTCATGGAAGAGGAGGAGGCTGG - Intronic
928501563 2:31901795-31901817 GTTACTCAGGAGGCGGAGGCAGG + Intronic
928525345 2:32134388-32134410 CTTACTCAGGAGGCTGAGGCAGG + Intronic
928560217 2:32475051-32475073 GTTACTCAGGAGGATGAGGCAGG + Intronic
928974292 2:37067658-37067680 CTGACTCAGGAGGGTGAGGCAGG + Intronic
929102650 2:38331322-38331344 GTTACTCAGGAGGCGGAGGCAGG + Intronic
929200842 2:39234023-39234045 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
929350054 2:40939763-40939785 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
929860497 2:45672913-45672935 CTGCTCCAGGAGGCTGAGGCAGG + Intronic
929974380 2:46617315-46617337 CTTCTGCGGGAGGAGGAGGCTGG + Intronic
930774756 2:55160908-55160930 CTGATGCTGGATGAGGAGGAAGG - Intergenic
931402988 2:61949019-61949041 GTTACTCAGGAGGTGGAGGCAGG + Intronic
931576251 2:63721836-63721858 CTGAGTCAGGAGAATCAGGCAGG - Intronic
931592837 2:63904325-63904347 CTTACTCAGGAGGCTGAGGCAGG + Intronic
931991785 2:67797475-67797497 CTGATGCAGCAGGAGGGGGTGGG + Intergenic
931999669 2:67873151-67873173 CTGATTCAGGAGGTCTAGGGTGG - Intergenic
932022565 2:68102324-68102346 GTGACTCAGGAGGCTGAGGCAGG + Intronic
932205574 2:69878398-69878420 CTGAGGCGGGAGGATGAGGCAGG + Intronic
932215441 2:69963146-69963168 CTGAATCAGGTGGAAGGGGCTGG - Intergenic
932278266 2:70467937-70467959 CTGCTTCAGGTGGCAGAGGCAGG - Intronic
932348163 2:71009313-71009335 ATGACTCGGGAGGTGGAGGCAGG - Intergenic
932380221 2:71275893-71275915 CTGAGGCAGGAGGCTGAGGCGGG - Intergenic
932797448 2:74709051-74709073 CTAACTCAGGAGGATGAGGTGGG + Intergenic
932804415 2:74770675-74770697 CTGATTCAGCAGGTGCAGCCAGG - Intergenic
932930331 2:76028931-76028953 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
933019499 2:77173711-77173733 CTTACTCAGGAGGCTGAGGCAGG - Intronic
933161106 2:79026140-79026162 CTGACACAGGAGAATGAGGCAGG - Exonic
933230150 2:79797547-79797569 CTTACTCAGGAGGCTGAGGCAGG + Intronic
933699346 2:85243606-85243628 CTGGGCCAGGAGGAGAAGGCTGG + Intronic
934187700 2:89761556-89761578 GTAATTCAGGAGGCTGAGGCAGG + Intergenic
934476235 2:94595321-94595343 GTTATTCAGGAGGCTGAGGCAGG + Intronic
934714547 2:96536269-96536291 CTGCTTTGGGAGGCGGAGGCGGG - Intergenic
934995342 2:98952718-98952740 CTGAGTCATGTGGAGGAGGCTGG - Intergenic
935046218 2:99485880-99485902 ATGAGGCAGGAGGATGAGGCAGG + Intronic
935163757 2:100551659-100551681 AGGATTCAGGGGCAGGAGGCAGG - Intergenic
935613033 2:105045974-105045996 GTCATTCAGGAGGCTGAGGCAGG - Intronic
935847897 2:107187085-107187107 CTGAAGGAGGAGGAGGAAGCTGG + Intergenic
936272406 2:111059123-111059145 GTTATTCAGGAGGTTGAGGCTGG + Intronic
936580446 2:113695623-113695645 CTGAGGCAGGAGGCTGAGGCGGG + Intergenic
936598762 2:113874987-113875009 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
936999108 2:118446973-118446995 CTGAGGCAGGAGGCTGAGGCAGG - Intergenic
937258008 2:120568359-120568381 CTGACACAGCAGGAGGAGCCAGG - Intergenic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
937885994 2:126900280-126900302 CTTACTCAGGAGGCTGAGGCAGG + Intronic
937945210 2:127328161-127328183 GTTATTCAGGAGGCTGAGGCAGG + Intronic
938010302 2:127823459-127823481 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
938600184 2:132829720-132829742 CTGAATCAGGAGGTGTAGGGTGG + Intronic
938757807 2:134396913-134396935 CTTGTAAAGGAGGAGGAGGCAGG + Intronic
938890855 2:135704090-135704112 GTTATTCAGGAGGCTGAGGCAGG - Intronic
939734981 2:145833084-145833106 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
939743338 2:145937371-145937393 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
939804813 2:146761681-146761703 CTCATTCAGGAGGTTGAGGCAGG + Intergenic
939816670 2:146905105-146905127 CTCAGTCAGGAGGCTGAGGCAGG - Intergenic
940161826 2:150721641-150721663 GCGACTCAGGAGGCGGAGGCAGG + Intergenic
940218050 2:151321192-151321214 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940545975 2:155085861-155085883 CAGACTCAGAAGGAGGAGGGTGG + Intergenic
940635434 2:156292969-156292991 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
940855559 2:158726215-158726237 CAGATTCAGGCGGAGAAGACTGG - Intergenic
941169762 2:162121922-162121944 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
941260669 2:163292742-163292764 CTGAGTCAGGAGGGACAGGCTGG + Intergenic
941821887 2:169851724-169851746 GTGACTCAGGAGGCTGAGGCAGG + Intronic
942094396 2:172523776-172523798 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
942171897 2:173297643-173297665 CTGGTGCAGGAGTAGGGGGCCGG + Intergenic
942300514 2:174556865-174556887 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
942571830 2:177322902-177322924 CTGCTTCAGCAGGAGGAAGGAGG + Intronic
943158870 2:184220407-184220429 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
943452743 2:188065534-188065556 CTTACTCGGGAGGATGAGGCAGG + Intergenic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
944103497 2:196054598-196054620 CTGATTTAGTAGGTGGAGGTGGG - Intronic
944519208 2:200546239-200546261 GTTATTCAGGAGGCTGAGGCAGG + Intronic
944731056 2:202517922-202517944 CTTACTCAGGAGGCTGAGGCAGG - Intronic
944765695 2:202862190-202862212 GTGATTCAGGAGGGTGAAGCAGG + Intronic
944769445 2:202898863-202898885 CCTATTCAGGAGGCTGAGGCAGG + Intronic
945084714 2:206119519-206119541 CTCACTCAGGAGGCTGAGGCAGG - Intronic
945297415 2:208184194-208184216 TTGATTCAGGAGGTGAAGGGGGG - Intronic
946250664 2:218409585-218409607 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
946348973 2:219135495-219135517 GTAATTCAGGAGGCTGAGGCAGG + Intronic
946441056 2:219696391-219696413 TTGATCTAGGAAGAGGAGGCAGG - Intergenic
946639550 2:221768799-221768821 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
947378880 2:229525722-229525744 GTTATTCAGGAGGCTGAGGCAGG - Intronic
947584274 2:231343023-231343045 GTGACTCAGGAGGCTGAGGCAGG - Intronic
947771080 2:232670522-232670544 TTGAATCTGGAGGAGGAGGGTGG + Intronic
947853637 2:233308211-233308233 GTGACTCAGGAGGCTGAGGCTGG + Intronic
948053449 2:234994945-234994967 CTGATTCAGGAGTAGGGTGAGGG + Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1169095030 20:2889993-2890015 CTTACTCAGGAGGCTGAGGCGGG - Intronic
1169121769 20:3100937-3100959 CTGAAGCGGGAGGAGGAGGTTGG - Intergenic
1169380756 20:5105172-5105194 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1169443929 20:5655958-5655980 CTCATTCAGGAGGCTGAGGCAGG + Intergenic
1169633987 20:7666701-7666723 CTTAGTCAGGAGGCTGAGGCAGG - Intergenic
1169691426 20:8336562-8336584 CTGATTCAGGAGGTCTGGGCTGG + Intronic
1169784619 20:9346217-9346239 CTGATTCAGTAGGGTGGGGCAGG - Intronic
1170033488 20:11966638-11966660 CTGATTCAGGAGGTGGGAGACGG - Intergenic
1170211243 20:13848076-13848098 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1170238494 20:14134691-14134713 GTTACTCAGGAGGCGGAGGCAGG + Intronic
1170548599 20:17456127-17456149 CTAATTCAGGAGGCTGAGGCAGG + Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171032321 20:21688416-21688438 GTGCTTCAGGAGGTTGAGGCAGG + Intergenic
1171371670 20:24666207-24666229 CTGATCTAGGATGGGGAGGCAGG + Exonic
1172173134 20:32955426-32955448 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1172367237 20:34359378-34359400 GTTACTCAGGAGGATGAGGCAGG + Intergenic
1172453961 20:35051417-35051439 GTGATTCAGGAGGCTGAGGTGGG - Intronic
1172561732 20:35894964-35894986 CTTACTCAGGAGGCCGAGGCAGG - Intronic
1172728732 20:37068945-37068967 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1173162320 20:40662210-40662232 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1174037638 20:47678044-47678066 CTGAGTCAGGGCGGGGAGGCTGG - Intronic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174307829 20:49627087-49627109 CTCACTCAGGAGGCTGAGGCAGG - Intergenic
1174371448 20:50091511-50091533 CTGACTCAGGAGGCTGAGGCAGG - Intronic
1174490937 20:50894784-50894806 CTACTTCAGGAGGGTGAGGCAGG + Intronic
1174543857 20:51310300-51310322 CTCATTAGGGAGGAGGAGTCAGG + Intergenic
1174657234 20:52181751-52181773 CAGATTCAGGAGGTGGAGCCCGG + Intronic
1174808720 20:53627692-53627714 CTAACTCAGGAGGCTGAGGCAGG + Intergenic
1174963614 20:55185629-55185651 CTAACTCAGGAGGCTGAGGCAGG + Intergenic
1175012786 20:55756613-55756635 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1175054549 20:56186129-56186151 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1175099092 20:56565413-56565435 CTGGTCCAGGTGGTGGAGGCTGG + Intergenic
1175416011 20:58801440-58801462 CCGACTCAGGAGGCTGAGGCAGG + Intergenic
1175490219 20:59375349-59375371 GCTATTCAGGAGGATGAGGCAGG - Intergenic
1175530057 20:59668417-59668439 CTGTTGCAGGAGGAAGAGCCTGG - Intronic
1175852009 20:62098682-62098704 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1175871156 20:62210148-62210170 CGGATCCTGGAGCAGGAGGCAGG - Intergenic
1175942949 20:62546293-62546315 CGGGTGCAGGAGGAGGAGGATGG + Intergenic
1176110502 20:63408589-63408611 CTGGTCCAGGAGGAGAGGGCAGG - Intronic
1176153156 20:63603628-63603650 CTGAGGCAGGAGGCTGAGGCAGG + Intronic
1176176497 20:63728831-63728853 CTGACTCAGGAGTAGGAGCCAGG + Intronic
1176179894 20:63744849-63744871 CTGAGTGTGGAGGGGGAGGCGGG + Exonic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176365854 21:6032381-6032403 CTAAGTCACGAGCAGGAGGCAGG + Intergenic
1176794799 21:13363617-13363639 ATCATACAGGAGAAGGAGGCAGG - Intergenic
1176975699 21:15318847-15318869 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
1177156932 21:17510336-17510358 AGGATTTAGGAGGAGGAGGGAGG - Intergenic
1177156946 21:17510377-17510399 AGGATTTAGGAGGAGGAGGGGGG - Intergenic
1177635060 21:23776380-23776402 CAGATTTAGGAGGCTGAGGCAGG - Intergenic
1177811126 21:25925822-25925844 ATTATTCAGGAGGCTGAGGCAGG + Intronic
1177980717 21:27911535-27911557 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1178150948 21:29793110-29793132 CATATTCAGGAGGAGGATGGAGG + Intronic
1178344173 21:31810956-31810978 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1178543449 21:33474661-33474683 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1178594430 21:33940147-33940169 CTACTTCAGGAGGCCGAGGCAGG + Intergenic
1179168156 21:38951555-38951577 CTGATTCAGCAGGCTGAGGGTGG + Intergenic
1179174862 21:39000958-39000980 CTGATTCAGGAGGGCTGGGCAGG + Intergenic
1179393454 21:41015127-41015149 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1179466497 21:41578944-41578966 CTTTTTCAGGAAGAGGAGGCTGG - Intergenic
1179512702 21:41884471-41884493 CTGATGCTCCAGGAGGAGGCTGG - Intergenic
1179757662 21:43506164-43506186 CTAAGTCACGAGCAGGAGGCAGG - Intergenic
1179946861 21:44684420-44684442 ACTATTCAGGAGGATGAGGCAGG + Intronic
1180792506 22:18583697-18583719 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1181157353 22:20931921-20931943 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1181229231 22:21411618-21411640 CTGATTAGGGTGGAGGAGGAGGG + Intergenic
1181249420 22:21523245-21523267 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1181450962 22:23020394-23020416 ATGCATCAGGAGTAGGAGGCAGG + Intergenic
1181539347 22:23565142-23565164 GCTATTCAGGAGGTGGAGGCAGG + Intergenic
1181975873 22:26729319-26729341 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1182203861 22:28602989-28603011 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1182353291 22:29710752-29710774 GAGATTCAGGAGGAGGAAGCGGG + Intergenic
1182375583 22:29845295-29845317 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1182527422 22:30929647-30929669 CTGAGGCAGGAGGCTGAGGCAGG + Intronic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1182892000 22:33826951-33826973 CCTTTTCAGGTGGAGGAGGCTGG - Intronic
1182945888 22:34321349-34321371 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1183269298 22:36850589-36850611 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1183619149 22:38962478-38962500 CTGATTCTGGAAGAGCAGGGGGG - Exonic
1183624349 22:38992414-38992436 CTGATTCTGGAAGAGCAGGGGGG - Exonic
1183640099 22:39087390-39087412 CTGATTCTGGAAGAGCAGGGAGG - Exonic
1183680516 22:39326098-39326120 CTAACTCAGGAGGCTGAGGCAGG + Intergenic
1183832776 22:40427511-40427533 CTGCCTCAGGAGGGGCAGGCAGG + Intronic
1183916087 22:41120565-41120587 GTGGTTCAGGAGGTGCAGGCAGG + Intronic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184343134 22:43897115-43897137 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1184367448 22:44061317-44061339 CCTATTCAGGAGGCTGAGGCTGG + Intronic
1184368316 22:44066959-44066981 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1184409178 22:44316830-44316852 CTGCTTCAGAAGGAAGTGGCAGG - Intergenic
1184428341 22:44426238-44426260 CTCACTCAGGAGGCTGAGGCAGG - Intergenic
1184524937 22:45016700-45016722 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1184754291 22:46507627-46507649 GCGAGGCAGGAGGAGGAGGCGGG - Intronic
1185116243 22:48939849-48939871 CAGACTCAGGGGGAGGCGGCCGG + Intergenic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949528885 3:4934034-4934056 GTGATTCAGGAGGCTGAGGCAGG + Intergenic
950117424 3:10460345-10460367 CTGATTAGGGAGGTGGAGGTGGG + Intronic
950666256 3:14497071-14497093 GCTATTCAGGAGGATGAGGCAGG - Intronic
950906531 3:16544089-16544111 CTGCTTCCCCAGGAGGAGGCTGG - Intergenic
951031084 3:17882372-17882394 GTTATTCAGGAGGCTGAGGCAGG - Intronic
951044525 3:18023195-18023217 CTGATTCAGTAGGTGTGGGCTGG - Intronic
951379359 3:21964599-21964621 GTTACTCAGGAGGCGGAGGCAGG - Intronic
951540739 3:23779735-23779757 GTTACTCAGGAGGATGAGGCAGG - Intergenic
951580568 3:24158538-24158560 GTGACTCAGGAGGCTGAGGCAGG - Intronic
951692664 3:25412905-25412927 CCTATTCAGGAGGCTGAGGCAGG + Intronic
951948427 3:28169485-28169507 CTGATTCAGTAGGTGGCTGCTGG + Intergenic
952078082 3:29723085-29723107 GCCATTCAGGAGGATGAGGCAGG - Intronic
952282176 3:31934518-31934540 CAGCTTCAGGAGGCTGAGGCAGG - Intronic
952300430 3:32100017-32100039 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
952341649 3:32452236-32452258 CTGATCCAGGATGAGGTGGTTGG + Intronic
952509773 3:34041365-34041387 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
952599898 3:35067462-35067484 CTCACTCAGGAGTATGAGGCAGG - Intergenic
952743936 3:36760692-36760714 CTGATTCAGGAGGTCTAGGGTGG - Intergenic
952935219 3:38392407-38392429 GTTATTCAGGAGGCTGAGGCAGG - Intronic
953360765 3:42294345-42294367 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
953484045 3:43277819-43277841 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
953538428 3:43793525-43793547 CCCATGCAGGAGCAGGAGGCTGG + Intergenic
953588149 3:44223745-44223767 CTGATTCAGGAGGTCTAGGGTGG + Intergenic
953768590 3:45762129-45762151 CTGATTCAGCAGGATGGGGTGGG + Intronic
954027106 3:47791571-47791593 GTGATTCAGGAGGAAGAATCAGG - Intergenic
954172650 3:48817213-48817235 CCGATTCGGGAGGCTGAGGCAGG + Intronic
954187713 3:48931674-48931696 CTAACTCAGGAGGCTGAGGCAGG - Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954838550 3:53492641-53492663 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
954899958 3:54010445-54010467 CTACTTCAGGAGGCAGAGGCAGG - Intergenic
955008616 3:54992951-54992973 CTGAAGCAGGAGGAAGAGGGAGG + Intronic
955303092 3:57802387-57802409 GTTATTCAGGAGGCTGAGGCAGG - Intronic
955496860 3:59542517-59542539 CTGAGGCATGAGGAGGAGCCAGG + Intergenic
955674710 3:61435617-61435639 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
956075735 3:65503273-65503295 CTGATTCCTGAGGAGGAGGCTGG - Intronic
956077412 3:65520126-65520148 CTGTTTCAGGAAGAGTAGGTGGG - Intronic
956101109 3:65769375-65769397 CCTATTCAGGAGGCTGAGGCAGG + Intronic
956464605 3:69506645-69506667 CAGACTCAGGAGGCTGAGGCAGG - Intronic
956595349 3:70960951-70960973 CTTACTCAGGAGGCTGAGGCAGG - Intronic
956625091 3:71259031-71259053 GTGACTCAGGAGGCGGAGGCAGG + Intronic
956817406 3:72920930-72920952 CTACTTCAGGAGGCTGAGGCAGG - Intronic
957109082 3:75929804-75929826 GTTATTCAGGAGGCTGAGGCAGG - Intronic
957117127 3:76040876-76040898 GTTATTCAGGAGGCTGAGGCAGG + Intronic
957126060 3:76162416-76162438 GTGACTCAGGAGGAGGCGGGAGG - Intronic
957169449 3:76719445-76719467 GCTATTCAGGAGGATGAGGCAGG - Intronic
957320659 3:78625960-78625982 CTGAATGAAGAGGAAGAGGCTGG + Intronic
957691422 3:83575864-83575886 CTGGTTTTGAAGGAGGAGGCAGG - Intergenic
957753767 3:84459587-84459609 GTGATTCAGGAGGCTGACGCAGG + Intergenic
957772185 3:84708045-84708067 CTGTTTAAGGAGGAAGAGGCGGG - Intergenic
957839972 3:85655264-85655286 TGGATTCAGGAGGCTGAGGCAGG - Intronic
958476641 3:94592290-94592312 CCTACTCAGGAGGCGGAGGCAGG + Intergenic
958628503 3:96657467-96657489 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
958794817 3:98695537-98695559 GTTACTCAGGAGGACGAGGCAGG + Intergenic
959191721 3:103121049-103121071 CAGATTCAGAAGCAGGAGGATGG + Intergenic
959894949 3:111594943-111594965 CTGTTTCAGCAGGAGGAGCTGGG + Exonic
960405925 3:117259597-117259619 CTACTTCAGGAGGCGGAAGCAGG - Intergenic
960697916 3:120413888-120413910 CTGAGTCAGGAGAATCAGGCAGG - Intronic
960851619 3:122060534-122060556 GTGACTCAGGAGGCGGAGGTGGG + Intronic
960900464 3:122549478-122549500 CTGATTGAGGAGGAGAAGACAGG + Intronic
960977632 3:123190937-123190959 GCTATTCAGGAGGATGAGGCAGG - Intronic
961067307 3:123886507-123886529 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
961175776 3:124834056-124834078 CAGATTCCGGGGGAGGAAGCAGG + Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961509431 3:127391951-127391973 CTGATGCAGGAGGAGCTGGAGGG + Intergenic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
961796556 3:129413039-129413061 CTGCTTTACGAGGAGGAAGCTGG - Intronic
961829685 3:129617088-129617110 CTTATCCAGGGGGAGAAGGCAGG - Intergenic
961865599 3:129951395-129951417 CTGATTCAGGAGGCCTAGGTTGG + Intergenic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962411336 3:135143949-135143971 CTGTGCCTGGAGGAGGAGGCAGG - Intronic
962577573 3:136769024-136769046 CTGAGGCAGGAGGCTGAGGCAGG + Intergenic
962886573 3:139633290-139633312 GTTACTCAGGAGGAAGAGGCAGG - Intronic
963253228 3:143120577-143120599 GTTACTTAGGAGGAGGAGGCTGG + Intronic
963859291 3:150291170-150291192 GCGATTCAGGAGGCTGAGGCAGG - Intergenic
964459836 3:156912292-156912314 GAGACTCAGAAGGAGGAGGCTGG - Intronic
964484453 3:157173611-157173633 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
965040782 3:163503715-163503737 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
965096344 3:164232143-164232165 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
965591410 3:170363595-170363617 GTGACTCAGGAGGCTGAGGCAGG - Intronic
965737749 3:171839538-171839560 GCTATTCAGGAGGATGAGGCAGG + Intergenic
966476824 3:180358375-180358397 CTGAGTCAAGATGAGGAGGCAGG - Intergenic
966974761 3:185074082-185074104 GCTATTCAGGAGGATGAGGCAGG - Intergenic
967030084 3:185597763-185597785 CCTATTCAGGAGGCTGAGGCAGG - Intronic
967054018 3:185812232-185812254 TTGCTTCAGGAGGTGGAAGCAGG - Intronic
967149736 3:186637584-186637606 CTGAGTGAGGAGGGAGAGGCAGG - Intronic
967324886 3:188229168-188229190 CTGAGACAGGAGGTGGAGGGTGG + Intronic
967349031 3:188491267-188491289 GTGATAAAGGAGGAGGAGGCTGG + Intronic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967410200 3:189159456-189159478 ATGATTCTGGAGGAGCAGGTTGG + Intronic
967738200 3:192976146-192976168 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
967875253 3:194264514-194264536 CCTACTCAGGAGGCGGAGGCAGG + Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968082387 3:195855381-195855403 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968320017 3:197758147-197758169 CTGAGGCAGGAGGCCGAGGCAGG - Intronic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968806117 4:2773790-2773812 ATGACTCAGGAGGCTGAGGCAGG - Intergenic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
969375920 4:6763092-6763114 CTCATCCAGGAGAAGGAGCCAGG - Intergenic
969432501 4:7163938-7163960 CAGACTCAGGAGGCTGAGGCAGG + Intergenic
970078167 4:12249040-12249062 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
970571165 4:17384275-17384297 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
970807998 4:20058228-20058250 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
971015458 4:22484673-22484695 GTGATTCAGCATGAGAAGGCTGG + Intronic
971079345 4:23191914-23191936 CTCACTCAGGAGGCTGAGGCAGG - Intergenic
971715168 4:30166544-30166566 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
972232796 4:37094944-37094966 CTGAATCATGATGAGGTGGCAGG + Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
972723483 4:41724266-41724288 CTGTATCAGGAGGCTGAGGCAGG + Intergenic
973890322 4:55361690-55361712 CTTACTCAGGAGGCTGAGGCAGG + Intronic
974061052 4:57036291-57036313 CTCAGGCAGGAGGAGGAGGTGGG + Intronic
974579419 4:63776765-63776787 CCTATTCAGGAGGGTGAGGCAGG - Intergenic
974676419 4:65095251-65095273 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
974922130 4:68254863-68254885 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
975634092 4:76428764-76428786 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
975924777 4:79435977-79435999 CTTATTCGGGAGGCTGAGGCAGG + Intergenic
975982163 4:80173390-80173412 CAGGTTCAGGAGGAAGAGACAGG + Intergenic
976210629 4:82665121-82665143 CCGACTCAGGAGGCTGAGGCAGG + Intronic
976291713 4:83425166-83425188 GTGACTCAGGAGGCTGAGGCAGG + Intronic
976419413 4:84822598-84822620 CTGAGGCAGGAGGCTGAGGCAGG + Intronic
976505371 4:85839959-85839981 GTGACTCAGGAGGCTGAGGCAGG - Intronic
976649716 4:87421936-87421958 CTGATTTGGGAGGCCGAGGCGGG - Intergenic
977204969 4:94157381-94157403 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
977886418 4:102257260-102257282 GTTATTCAGGAGGCTGAGGCAGG - Intronic
978243894 4:106549209-106549231 CACTTTGAGGAGGAGGAGGCAGG - Intergenic
978281462 4:107020870-107020892 CTGTTTCTGAAAGAGGAGGCAGG - Intronic
980755332 4:137151114-137151136 CTGACTCAGGAGGGTGAGGCAGG - Intergenic
981130807 4:141156390-141156412 CCTACTCAGGAGGATGAGGCAGG - Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981671016 4:147286964-147286986 ATAATTCAGGAGGAGAAGACAGG + Intergenic
981785235 4:148470182-148470204 CTCACTCAGAATGAGGAGGCAGG + Intergenic
981830505 4:148994521-148994543 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
981863386 4:149383839-149383861 CTAATTCAGGAGGCTGAGGCAGG + Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982267429 4:153551467-153551489 CCTATTCAGGAGGCTGAGGCAGG - Intronic
982566620 4:156995163-156995185 CGGCTTCAGGTGGAAGAGGCAGG + Intergenic
983295267 4:165859018-165859040 CTGCCTCAGGAGGCTGAGGCAGG + Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983946760 4:173594945-173594967 CAGCTACAGGAGGATGAGGCAGG - Intergenic
984023222 4:174511756-174511778 GTTATTCAGGAGGCTGAGGCAGG - Intronic
985088472 4:186339713-186339735 CTAATTCAGGAGGCTGAGGCAGG + Intergenic
985322466 4:188730140-188730162 CCGCTAAAGGAGGAGGAGGCTGG + Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985865183 5:2508990-2509012 CTGATTCATGGGATGGAGGCTGG + Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986205151 5:5617186-5617208 CTGTCTCTGGAGGTGGAGGCAGG - Intergenic
986378496 5:7159413-7159435 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
986572824 5:9182672-9182694 CTGAGTAAGGAAGAGTAGGCTGG - Intronic
986927681 5:12777815-12777837 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
987098696 5:14573523-14573545 GTGATTCTGGAGGCTGAGGCAGG + Intergenic
987268154 5:16277748-16277770 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
987316772 5:16731453-16731475 CTCACTCAGGAGGCTGAGGCAGG - Intronic
987358384 5:17084689-17084711 CTTATGCAGGGGGAGGAGCCTGG - Intronic
987734998 5:21829181-21829203 ATGACTCAGGAGGCTGAGGCAGG + Intronic
988342940 5:29998726-29998748 GTTATTCAGGAGGTTGAGGCAGG - Intergenic
988526413 5:31991072-31991094 ATGATTCAGGAGGTGTGGGCAGG + Intronic
988547521 5:32172747-32172769 CTGCCTCAGGAGGCTGAGGCAGG + Intronic
988549194 5:32185091-32185113 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
989010232 5:36863045-36863067 GCTATTCAGGAGGTGGAGGCAGG + Intergenic
989056123 5:37367893-37367915 GTTATTCAGGAGGCTGAGGCAGG - Intronic
989360574 5:40596986-40597008 CTTATTCAGGAGGTTGAGGTGGG + Intergenic
989422667 5:41257777-41257799 CTAATTCAGCATGAGGGGGCTGG - Intronic
989514717 5:42328623-42328645 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
990498452 5:56372030-56372052 CTGAGGCAGGAGGATCAGGCAGG - Intergenic
990898545 5:60725921-60725943 CTTACTCAGGAGGCCGAGGCAGG + Intergenic
991581872 5:68164105-68164127 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
991636506 5:68711289-68711311 CAGATTCTGGGGGAGGAGGAGGG - Intergenic
991671417 5:69052166-69052188 CTTATTCGGGAGGCTGAGGCAGG - Intergenic
991911032 5:71561287-71561309 GTGACTCAGGAGGCTGAGGCAGG + Intronic
992303816 5:75413495-75413517 GTCATTCAGGAGGCTGAGGCAGG + Intronic
992507160 5:77398431-77398453 CTTACTCAGGAGGCTGAGGCAGG - Intronic
992638570 5:78748893-78748915 GTGCTTCAGGAGGCTGAGGCGGG - Intronic
992931809 5:81655036-81655058 CTGATTTGGGAGGCTGAGGCAGG + Intronic
993414702 5:87612110-87612132 CGTATTCAGGAGGCTGAGGCAGG + Intergenic
993756270 5:91734137-91734159 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
994360004 5:98839757-98839779 CTTATGCAGGGGGAGGAGCCTGG - Intergenic
995133206 5:108652637-108652659 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
995317859 5:110797034-110797056 CTTGTTCTGGTGGAGGAGGCAGG + Intergenic
995340990 5:111059373-111059395 CAGTTGCAGGAGGATGAGGCAGG - Intergenic
995581364 5:113606404-113606426 CTGATTGAGCAGTTGGAGGCGGG - Intergenic
996167087 5:120237542-120237564 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
996231699 5:121071409-121071431 CTGAGGCAGGAGGTGAAGGCAGG + Intergenic
996538267 5:124601526-124601548 GTGATTCAGGAGGCTGAGGCAGG - Intergenic
997416834 5:133735350-133735372 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
997514726 5:134479084-134479106 GTTATTCAGGAGGCAGAGGCAGG - Intergenic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
997991476 5:138547811-138547833 GCGATTCAGGAGGCTGAGGCAGG - Intergenic
998056542 5:139083060-139083082 CTGATTTAGGAGCAAGAAGCAGG + Intronic
998090470 5:139364137-139364159 CTGAATCAGGAGGATGAGGGTGG + Intronic
998135378 5:139671566-139671588 AGGATTCTGGGGGAGGAGGCCGG + Intronic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998273804 5:140732498-140732520 CTCACTCAGGAGGCTGAGGCAGG - Intergenic
998673096 5:144375920-144375942 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
998701270 5:144702783-144702805 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
998833961 5:146186404-146186426 CTGAGGCAGGAGGCTGAGGCAGG + Intergenic
999149795 5:149419297-149419319 GTGCTTCAGGAGGACAAGGCAGG + Intergenic
999348858 5:150847912-150847934 CTAATACAGGAGGCTGAGGCAGG - Exonic
999527065 5:152418487-152418509 CTGATTCAGGAGGTTGAGCTGGG - Intronic
999881536 5:155869885-155869907 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1001115230 5:168933853-168933875 ATGATTTAAGAGGAGGAGCCTGG + Intronic
1001300653 5:170531314-170531336 CTGATTCAGGAGTTTGGGGCTGG + Intronic
1001372585 5:171220558-171220580 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1001464435 5:171950773-171950795 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1002063941 5:176642984-176643006 CTGCTCCAGGAGGGGAAGGCAGG - Intronic
1002257708 5:177971025-177971047 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1002514468 5:179746962-179746984 CTGTTTCAGGGGTAGGCGGCTGG - Intronic
1002597003 5:180330208-180330230 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1002705832 5:181160485-181160507 CTGTTTCAGGAGGCGAAGGAAGG + Intergenic
1002997314 6:2298986-2299008 CTTATGCAGGGGGAGGAGTCTGG - Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003280785 6:4689717-4689739 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1003462011 6:6338025-6338047 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1003466347 6:6383544-6383566 TGCATTCAGGAGGAGGAGGAAGG - Intergenic
1004154341 6:13154274-13154296 CTTACTCAGGAGGGTGAGGCAGG - Intronic
1004327719 6:14691094-14691116 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
1004350874 6:14889287-14889309 CTGAGGCAGGAGGATGGGGCAGG - Intergenic
1004377891 6:15106479-15106501 GGGATTCAGGAGGAGGAGGGAGG + Intergenic
1004389047 6:15194685-15194707 CTCACTCAGGAGGGTGAGGCTGG - Intergenic
1004420084 6:15461431-15461453 GTAATCCAGGAGGAGGAGGGAGG + Intronic
1004460615 6:15832227-15832249 CTGACTCTGGAGGCTGAGGCAGG + Intergenic
1004735104 6:18397995-18398017 CTGACTCGGGAGGTGGAGTCGGG + Intronic
1004891552 6:20105694-20105716 CTGAACCAGGAGGCAGAGGCTGG + Intronic
1004907812 6:20252914-20252936 GTGACTCAGGAGGCTGAGGCGGG + Intergenic
1004943005 6:20580899-20580921 GTTACTCAGGAGGATGAGGCAGG - Intronic
1005050085 6:21676506-21676528 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1005051322 6:21686512-21686534 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1005073824 6:21887947-21887969 CTAAGTCAGGAGGGGGAGACGGG - Intergenic
1005380789 6:25232170-25232192 CTGCCTCAGGAGGCTGAGGCAGG + Intergenic
1005468677 6:26140675-26140697 CAGATTAAGGATGAAGAGGCTGG + Intergenic
1005597268 6:27391314-27391336 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1005833399 6:29689007-29689029 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1005987043 6:30882074-30882096 CTGCCTCTGGAGGAGCAGGCTGG - Intronic
1006290900 6:33135939-33135961 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1006326052 6:33354903-33354925 CTCACTCAGGAGGCTGAGGCAGG - Intergenic
1006554415 6:34853286-34853308 CTCAGTCAGGAGGCTGAGGCAGG - Intronic
1007271516 6:40640974-40640996 CTGCTTGGGGAGGAGGTGGCAGG + Intergenic
1007518775 6:42435017-42435039 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1007530018 6:42533827-42533849 GTTACTCAGGAGGGGGAGGCAGG + Intergenic
1007612786 6:43161116-43161138 CTGATAGAGGAAGAGGTGGCAGG - Intronic
1007870683 6:45034145-45034167 CTGTTGGAGGAGGAGGAGGTAGG - Intronic
1008021332 6:46581297-46581319 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1010154448 6:72776782-72776804 ATCCTTCAGGTGGAGGAGGCAGG + Intronic
1010512999 6:76743761-76743783 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1010624338 6:78118444-78118466 CTGATTCATTAAGAGGAGGCTGG - Intergenic
1010781465 6:79949912-79949934 CTGAGGCAGGAGGATGAGGCAGG - Intergenic
1011057648 6:83223263-83223285 CTGACTCAAGAGGCTGAGGCAGG - Intronic
1011593362 6:88992654-88992676 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1011617182 6:89207867-89207889 CTGGTACAGTAGGAGGAAGCAGG + Intronic
1012011228 6:93788603-93788625 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1012994483 6:105959949-105959971 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1013199087 6:107874785-107874807 CTAACTCAGGAGGCTGAGGCAGG - Intronic
1013481342 6:110555418-110555440 CTGGGACAGAAGGAGGAGGCGGG + Intergenic
1013483886 6:110576971-110576993 GTCACTCAGGAGGCGGAGGCAGG - Intergenic
1013576913 6:111492655-111492677 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1013681465 6:112529066-112529088 CTGAGGCAGGAGGATCAGGCAGG + Intergenic
1014252704 6:119130967-119130989 CTACTTCAGGAGGATGAGGCAGG - Intronic
1014620199 6:123658200-123658222 GTCATTCAGGAGGCTGAGGCTGG + Intergenic
1014626684 6:123734917-123734939 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1014695691 6:124618364-124618386 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1015189399 6:130456701-130456723 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1015229187 6:130894264-130894286 CTGACTCAGGAGGCAGAGGTGGG - Intronic
1015588015 6:134795940-134795962 GTATGTCAGGAGGAGGAGGCTGG - Intergenic
1015632063 6:135241684-135241706 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1015775376 6:136808982-136809004 CTAACTCAGGAGGCTGAGGCAGG - Intergenic
1016093374 6:140006413-140006435 ATGATACAGGACAAGGAGGCAGG - Intergenic
1016235814 6:141864999-141865021 GTGAATCAGGAGGCTGAGGCAGG + Intergenic
1016652813 6:146482818-146482840 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1016858216 6:148693523-148693545 CTGAGTCAGGAGACTGAGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017127323 6:151078328-151078350 CTCACTCAGGAGGATGAGGTAGG + Intronic
1017149795 6:151268752-151268774 CTAACTCAGGAGGCTGAGGCAGG - Intronic
1017167962 6:151427262-151427284 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1017213832 6:151885741-151885763 GCTACTCAGGAGGAGGAGGCAGG + Intronic
1017291186 6:152740156-152740178 CTCACTCAGGAGGCTGAGGCAGG - Intergenic
1017373458 6:153739184-153739206 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1017426860 6:154331018-154331040 ATAATTCAGGAGGCCGAGGCGGG + Intronic
1017457383 6:154614032-154614054 CTGATTCTGGTTGAGGAAGCTGG - Intergenic
1017559233 6:155608873-155608895 CTGGTTGAGGAGGATGAAGCAGG - Intergenic
1017786056 6:157758057-157758079 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1017820774 6:158047663-158047685 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1017859869 6:158385954-158385976 GTTATTCAGGAGGCGGATGCAGG - Intronic
1017902305 6:158728939-158728961 CTGAGGCAGGAGGCTGAGGCAGG + Intronic
1017927406 6:158922283-158922305 CCGAGCCAGGAGGAGGAAGCCGG - Intergenic
1018056487 6:160056611-160056633 CTGATTCAGAAAGAAGGGGCAGG - Intronic
1018067764 6:160135603-160135625 CTGTTTCACAAGGACGAGGCAGG - Intronic
1018244258 6:161806600-161806622 CTGATTCTGGAGGAGCGAGCAGG + Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018416883 6:163609297-163609319 CTATTTCAGGAAGGGGAGGCTGG + Intergenic
1018770269 6:166964522-166964544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1018901463 6:168053872-168053894 CCCAAGCAGGAGGAGGAGGCCGG - Intergenic
1018903146 6:168061110-168061132 CTGATGCAGGAGGAAGAGCCCGG + Intronic
1019019063 6:168902543-168902565 GTGATGCAGGGTGAGGAGGCGGG + Intergenic
1019056233 6:169225464-169225486 GTGCTGCAGGACGAGGAGGCCGG - Intronic
1019388149 7:770328-770350 CTGATTGAGAAAGAGGAAGCGGG + Intronic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1019685914 7:2382108-2382130 GTGTTTCAGGAGGCTGAGGCAGG + Intergenic
1020200175 7:6073440-6073462 GCTATTCAGGAGGATGAGGCAGG + Intergenic
1020206926 7:6125067-6125089 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1020221391 7:6241008-6241030 GTGACTCAGGAGGCTGAGGCTGG + Intronic
1021070923 7:16239025-16239047 GTTACTCAGGAGGTGGAGGCAGG + Intronic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1021658475 7:22895155-22895177 GTGCTTCAGGAGGCTGAGGCAGG - Intergenic
1021944943 7:25717180-25717202 CTGAGGCAGGAGGCTGAGGCAGG + Intergenic
1022085677 7:27065182-27065204 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1022259935 7:28694653-28694675 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1022445425 7:30466546-30466568 ATGACTCAGGAGGCCGAGGCAGG + Intronic
1022482484 7:30753011-30753033 CTGAGCCTGGAGGAGCAGGCCGG + Intronic
1022498732 7:30869295-30869317 CTGATAGAGGAGGAGAAGGATGG + Intronic
1022553691 7:31269969-31269991 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1022683132 7:32568816-32568838 CTGATTCTGAATGAGGAGCCTGG + Intronic
1023183051 7:37504965-37504987 CTGAATCAGGAGGTTGAAGCTGG + Intergenic
1023270253 7:38455167-38455189 CTGAGGCAGGAGGAGGTGGGAGG - Intronic
1023626675 7:42121720-42121742 CTGATGGAGGGGGAGGAGGTGGG - Intronic
1024283978 7:47741364-47741386 TTGATTCTGGAGGAGGTGGGAGG - Intronic
1024338944 7:48237712-48237734 CCAATTCAGGAGGCAGAGGCAGG - Intronic
1024937548 7:54726688-54726710 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1025998895 7:66545785-66545807 ATGTTTCAGGAGAAAGAGGCAGG - Intergenic
1026329817 7:69342121-69342143 CCCATTCAGGAGGCTGAGGCAGG - Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1026520691 7:71115483-71115505 GTGCTTCAGGAGGCTGAGGCAGG + Intergenic
1026565669 7:71487919-71487941 GTGATTCAGGAGGCTGGGGCAGG + Intronic
1026685077 7:72503032-72503054 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1026977867 7:74509419-74509441 CCTACTCAGGAGGATGAGGCAGG + Intronic
1026991953 7:74591131-74591153 ATGTTTCAGGAGAAAGAGGCAGG - Intronic
1027628287 7:80571246-80571268 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1027810284 7:82887956-82887978 CTTATTCGGGAGGCTGAGGCAGG + Intronic
1028257643 7:88620209-88620231 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1028542014 7:91952929-91952951 CTCAGTCAGGAGGCTGAGGCAGG - Intronic
1028624645 7:92864024-92864046 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1028897481 7:96058744-96058766 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
1029108630 7:98198599-98198621 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1029192500 7:98781685-98781707 CTGGTTCAGCAGGAAGAGGCTGG + Intergenic
1029223259 7:99006964-99006986 CTGAGTCAGCTGGAGGCGGCAGG - Intronic
1029304484 7:99608649-99608671 GTGATTCAAGAGGCTGAGGCAGG - Intergenic
1029342086 7:99953447-99953469 GTGATTCAGGAGGCTGAGGTGGG + Intergenic
1029490846 7:100869057-100869079 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1029579069 7:101423151-101423173 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1029944487 7:104517616-104517638 ATTATTCAGGAGGCTGAGGCAGG - Intronic
1030121707 7:106116468-106116490 CTAATTCAGGAGAAGGAGTCAGG - Intergenic
1030356173 7:108544767-108544789 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1030725556 7:112922052-112922074 CTGATGCAGGAGAATCAGGCAGG - Intronic
1031879273 7:127177604-127177626 CTTGTTCAGGTGGAGGTGGCAGG - Intronic
1031981637 7:128130777-128130799 CTGCTGCAGGACAAGGAGGCAGG + Intergenic
1032056348 7:128687691-128687713 CTGTCTCTGGAGGAGGAGACAGG + Intergenic
1032081379 7:128860138-128860160 CTGATCCAGGAGGGGTAGGGAGG - Intergenic
1032397233 7:131599356-131599378 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1032399613 7:131614725-131614747 GTTATTCAGGAGGCTGAGGCGGG + Intergenic
1032562224 7:132904147-132904169 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1032609542 7:133397239-133397261 CTGCTTCAGGAGGCTGAAGCAGG - Intronic
1032730465 7:134637311-134637333 ATTATTCAGGAGGCTGAGGCAGG - Intergenic
1033093286 7:138406532-138406554 CTTCTTCAGGAGGCTGAGGCAGG - Intergenic
1033365639 7:140671202-140671224 ATTATTCAGGAGGCTGAGGCAGG - Intronic
1033537661 7:142327256-142327278 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1034134064 7:148749303-148749325 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1034691684 7:153019127-153019149 GTGACTCAGGAGGCTGAGGCTGG - Intergenic
1034810778 7:154129962-154129984 GTTACTCAGGAGGCGGAGGCTGG + Intronic
1035633541 8:1126891-1126913 CTGCCTCAGGAGGAGCTGGCTGG - Intergenic
1035740167 8:1921621-1921643 CTTATTCGGGAGGCTGAGGCAGG + Intronic
1036163643 8:6410976-6410998 GTGATTCGGGAGGCTGAGGCAGG + Intronic
1036209368 8:6829761-6829783 GTGCTTTAGGAGGTGGAGGCAGG - Intronic
1036215446 8:6876363-6876385 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1036692789 8:10955282-10955304 CTTATTCAGGAGGCTGAGGTGGG - Intronic
1036918722 8:12831474-12831496 ATAATTCAGGAGGCCGAGGCCGG + Intergenic
1036988258 8:13561423-13561445 CTGCTTTAGGAGGATGAAGCAGG - Intergenic
1037105113 8:15097060-15097082 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1037138455 8:15491663-15491685 CTGATTTACAAGGAAGAGGCTGG + Intronic
1037356930 8:18030570-18030592 CCTACTCAGGAGGATGAGGCAGG + Intergenic
1037407505 8:18558707-18558729 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1037828231 8:22172722-22172744 CTCACTCAGGAGGCTGAGGCAGG - Intronic
1037996476 8:23356161-23356183 CTGATACATGATGGGGAGGCCGG + Intronic
1038133066 8:24755458-24755480 CAGATTCATGAGTAGGAGACTGG + Intergenic
1038307474 8:26417612-26417634 CTGGTACAGGAGGCTGAGGCAGG + Intronic
1038397839 8:27260156-27260178 GTGACTCAGGAGGCTGAGGCGGG - Intergenic
1038505680 8:28082792-28082814 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1038567056 8:28628421-28628443 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1038728290 8:30101554-30101576 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1038736384 8:30173616-30173638 GTGATTCAAGAGGCTGAGGCAGG + Intronic
1038744293 8:30243267-30243289 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1038913096 8:31989133-31989155 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1038964083 8:32551843-32551865 CTGAATCAGTATGAAGAGGCTGG - Intronic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039370315 8:36977788-36977810 CTGATTCGGGAGGAGTTGGGAGG - Intergenic
1039831106 8:41215732-41215754 GTATTTCAGGAGGTGGAGGCAGG - Intergenic
1039857462 8:41428412-41428434 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1039873089 8:41563569-41563591 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1040424474 8:47271897-47271919 CTGAGGCAGGAGGCTGAGGCAGG - Intronic
1040483281 8:47846302-47846324 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1040858276 8:51972747-51972769 CCTATTCAGGAGGCCGAGGCAGG + Intergenic
1041665288 8:60438488-60438510 GTGATTCAGGAGGCTGAGGCAGG + Intergenic
1041739741 8:61145563-61145585 CTGATGCAGCAGGAGGGGGAAGG - Intronic
1042333865 8:67610126-67610148 GTGCTTCAGGAGGCTGAGGCAGG + Intronic
1042376855 8:68061675-68061697 CTAATTCAGGAGGAGGATCAGGG + Intronic
1042536285 8:69861896-69861918 ATGACTCAGGAGGCTGAGGCAGG - Intergenic
1042909148 8:73806598-73806620 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1043285775 8:78528576-78528598 GTGATTCAGGAGGCTGAGGCAGG + Intronic
1043548741 8:81344545-81344567 GTGATTCAGGAGGCTGAGGCAGG + Intergenic
1043908765 8:85836472-85836494 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1044975855 8:97664870-97664892 GTGGTTCAGGAGGCTGAGGCAGG - Intronic
1045201707 8:99990158-99990180 CTTATTCAGGAGGCGAAGGCAGG + Intronic
1045218610 8:100175095-100175117 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1045286385 8:100795528-100795550 GCTATTCAGGAGGATGAGGCAGG - Intergenic
1045488734 8:102654488-102654510 CAGATGCGGGAGGAGGAGCCAGG + Intronic
1045626343 8:104056290-104056312 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1045777562 8:105823750-105823772 CTGATTCAGTAGGAGTGGGGAGG + Intergenic
1046091380 8:109506360-109506382 CTGATTCAGGAGTACAAGACTGG + Intronic
1046246330 8:111567266-111567288 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1046554922 8:115762436-115762458 CTGCTACAGGAGTAAGAGGCAGG - Intronic
1046720039 8:117608843-117608865 CTGAGTCAGGAGGGGTTGGCAGG + Intergenic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047377722 8:124318484-124318506 CTTACTCAGGAGGCAGAGGCAGG - Intronic
1047952377 8:129945678-129945700 CTCACTCAGGAGGCTGAGGCAGG - Intronic
1048204253 8:132402904-132402926 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1048388067 8:133932116-133932138 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048599798 8:135907526-135907548 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1048752663 8:137697637-137697659 TTGATTGAGGAGCAGGAGGTCGG - Intergenic
1049067631 8:140329965-140329987 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1049218487 8:141418257-141418279 GTGATTTTGGGGGAGGAGGCTGG - Intronic
1049286435 8:141777954-141777976 TGGAACCAGGAGGAGGAGGCTGG + Intergenic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049653682 8:143788532-143788554 CTGCTTCCTGAGTAGGAGGCTGG - Intergenic
1049734408 8:144196981-144197003 CTTACTCAGGAGGCTGAGGCAGG + Intronic
1049779233 8:144420577-144420599 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1049993312 9:1010504-1010526 GTGATTCAAGAAAAGGAGGCTGG + Intergenic
1050053881 9:1631781-1631803 CTGTTTTAGGAGGAGGAGTTGGG - Intergenic
1050076338 9:1869428-1869450 CTCACTCAGGAGGCTGAGGCAGG + Intergenic
1050122188 9:2318973-2318995 CTAACTCAGGAGGCTGAGGCAGG - Intergenic
1050601339 9:7255222-7255244 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1051205187 9:14681329-14681351 GTGACTCAGGAGGCTGAGGCAGG - Intronic
1051276706 9:15405933-15405955 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1051494273 9:17701368-17701390 CTGCTTCAGGAGGAGTAGTGAGG + Intronic
1051518824 9:17961358-17961380 GTTACTCAGGAGGCGGAGGCAGG - Intergenic
1051644608 9:19255154-19255176 GTGGCTCAGGAGGTGGAGGCTGG + Intronic
1051665192 9:19462272-19462294 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
1051776523 9:20640140-20640162 CTACTTCAGGAGGCTGAGGCGGG - Intergenic
1052267788 9:26594322-26594344 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1052321649 9:27173816-27173838 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1052738217 9:32367259-32367281 GTGCTTCAGGAGGCTGAGGCAGG + Intergenic
1052824690 9:33166635-33166657 CTGATCCAGAAGAGGGAGGCTGG + Intronic
1052853800 9:33394607-33394629 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1053115227 9:35494350-35494372 CTGAGGCAGGAGGCTGAGGCAGG + Intronic
1053381151 9:37650726-37650748 CTGAGGCAGGCGGCGGAGGCAGG + Intronic
1053467854 9:38324132-38324154 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1053681826 9:40490758-40490780 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1053887427 9:42654574-42654596 ATCATACAGGAGAAGGAGGCAGG + Intergenic
1053931818 9:43119087-43119109 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1054226449 9:62462025-62462047 ATCATACAGGAGAAGGAGGCAGG + Intergenic
1054281888 9:63134174-63134196 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1054294919 9:63326261-63326283 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1054392939 9:64630760-64630782 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1054427589 9:65135970-65135992 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1054502789 9:65885569-65885591 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1054864893 9:69989964-69989986 CTGATTCTGTAGGAGGAAGCAGG - Intergenic
1054865857 9:70000267-70000289 CTGATTCAGGAGGAGAAGCCAGG + Intergenic
1056167278 9:83951447-83951469 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1056257672 9:84816665-84816687 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1056516178 9:87352621-87352643 CAGATTCAGGGGGAGAAGGAGGG + Intergenic
1056564835 9:87761908-87761930 GTGTTTCAGGAGGAGGAGGTAGG + Intergenic
1056644852 9:88402101-88402123 CTTACTCAGGAGGCTGAGGCGGG - Intronic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057356569 9:94336832-94336854 CTTATTCAGGAGGCTGAGGGAGG - Intergenic
1057492078 9:95528200-95528222 TGAATTCAGGTGGAGGAGGCGGG - Intergenic
1057534872 9:95891099-95891121 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1057579589 9:96274347-96274369 CTGGCTCAGGAGGCTGAGGCAGG + Intronic
1057600209 9:96450695-96450717 CGGTTTCAGGAGGAGGGGCCCGG + Intronic
1057620045 9:96626735-96626757 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1057803739 9:98206098-98206120 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
1057931352 9:99196228-99196250 ATGATGGAGGAGGAGGATGCTGG + Intergenic
1058121612 9:101145491-101145513 GCTACTCAGGAGGAGGAGGCAGG - Intronic
1058192313 9:101933807-101933829 GCAATTCAGGAGGACGAGGCGGG + Intergenic
1058474137 9:105313868-105313890 CTAACTCAGGAGGCTGAGGCAGG - Intronic
1058483840 9:105423351-105423373 CTGGTCCAGGAGGCTGAGGCAGG + Intronic
1058494153 9:105536745-105536767 CTAACTCAGGAGGCTGAGGCAGG - Intronic
1059015427 9:110510491-110510513 CCCATTCAGGAGGAGGAAGTTGG + Intronic
1059228919 9:112699209-112699231 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1059379472 9:113912025-113912047 CTGATTCAGCAGGTGTGGGCGGG + Intronic
1059442629 9:114317795-114317817 GTTATTCAGGAGGCTGAGGCCGG + Intergenic
1059486320 9:114629736-114629758 CTGACTCAGAAAGAGGGGGCAGG + Intronic
1059488938 9:114651056-114651078 GTGCTTCAGGAGGCAGAGGCAGG - Intergenic
1059831617 9:118102267-118102289 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1060023143 9:120149529-120149551 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1060089657 9:120731742-120731764 CTGAATGAGAACGAGGAGGCAGG + Intergenic
1060100406 9:120835615-120835637 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1060165738 9:121413047-121413069 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1060237226 9:121873418-121873440 CTAACTCAGGAGGCTGAGGCAGG - Intronic
1060492506 9:124095305-124095327 GCTATTCAGGAGGATGAGGCAGG - Intergenic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1060621570 9:125072133-125072155 GTGACTCAGGAGGCTGAGGCAGG - Intronic
1060837132 9:126764641-126764663 ATGCTTTGGGAGGAGGAGGCAGG - Intergenic
1060923176 9:127436946-127436968 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1060949906 9:127594906-127594928 CTGATTCTGTAGGGGGAGGCGGG + Intergenic
1061091679 9:128430048-128430070 GTTATTCAGGAGGCTGAGGCAGG - Intronic
1061148024 9:128811569-128811591 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1061162301 9:128902391-128902413 CTGCCTCAGAAGGAGGAGTCTGG + Intronic
1061195464 9:129104714-129104736 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1061274742 9:129563342-129563364 CTTACTCAGGAGGTTGAGGCAGG - Intergenic
1061409507 9:130411486-130411508 GTCATTCAGGAGGCTGAGGCAGG + Intronic
1061558690 9:131388653-131388675 GCTATTCAGGAGGATGAGGCAGG - Intergenic
1061752446 9:132789483-132789505 GCTACTCAGGAGGAGGAGGCAGG + Intronic
1062183441 9:135203325-135203347 CTAATTTGGGAGGAGGAGGTGGG - Intergenic
1062361116 9:136188625-136188647 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1062620483 9:137418234-137418256 CTAACTCAGGAGGCTGAGGCAGG + Intronic
1185614928 X:1415050-1415072 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1185728042 X:2438554-2438576 CTGCCTCAGGAGGGTGAGGCAGG + Intronic
1185832621 X:3316555-3316577 CTACTTCAGGAGGCTGAGGCTGG + Intronic
1186064742 X:5750629-5750651 GTTATTCAGGAGGCCGAGGCAGG + Intergenic
1186576048 X:10766795-10766817 CTGAGTCAGGAGGCTGAGGCGGG + Intronic
1187009759 X:15267299-15267321 CTGCCTCAGGAGGGAGAGGCAGG - Intronic
1187178666 X:16921087-16921109 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1187274103 X:17803664-17803686 CTGAGGCAGGAGGAGAAGGGGGG + Intronic
1187315982 X:18195766-18195788 CTGAGTCAGGAGGCTGAGGGAGG + Intronic
1187583317 X:20632537-20632559 CTGATTCATCAGGAAGAGGTTGG - Intergenic
1187742954 X:22375937-22375959 CTTACTCAGGAGGCTGAGGCAGG - Intergenic
1188532322 X:31155875-31155897 GCTACTCAGGAGGAGGAGGCTGG + Intronic
1188777250 X:34235248-34235270 CTCACTCAGGAGGCTGAGGCAGG + Intergenic
1189252801 X:39614148-39614170 CTGATTCAGTAGGTCTAGGCGGG - Intergenic
1189284567 X:39842055-39842077 CTGCTTCAGCAAGAGAAGGCTGG + Intergenic
1189360949 X:40350860-40350882 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1189392468 X:40587765-40587787 CTGAGGCAGGAGGCTGAGGCAGG + Intronic
1189392707 X:40590147-40590169 CTGAGGCAGGAGGCTGAGGCAGG - Intronic
1189445377 X:41076232-41076254 CTGAGGCAGGAGGCTGAGGCAGG - Intergenic
1190288893 X:48978780-48978802 GCGATTCAGGAGGCTGAGGCAGG + Intronic
1190294671 X:49018516-49018538 GCTATTCAGGAGGATGAGGCAGG - Intergenic
1190689465 X:52901383-52901405 CTGCTTCGGGAGGCTGAGGCGGG - Intronic
1190696518 X:52954409-52954431 CTGCTTCGGGAGGCTGAGGCGGG + Intronic
1190875107 X:54454536-54454558 CTTATTCAGGAGGCTGAGGCAGG + Intronic
1190877260 X:54468787-54468809 CTGATCCAGGAGATGGAGCCTGG + Exonic
1190974231 X:55384215-55384237 GTTACTCAGGAGGTGGAGGCAGG + Intergenic
1192210010 X:69121865-69121887 CCCATGCCGGAGGAGGAGGCTGG + Intergenic
1193123519 X:77847720-77847742 CTTACTCAGGAGACGGAGGCAGG - Intronic
1193146588 X:78082935-78082957 CTTACTCAGGAGGCTGAGGCAGG - Intronic
1193402380 X:81060687-81060709 CTGCTTTGGGAGGATGAGGCAGG + Intergenic
1194679059 X:96829603-96829625 CTTATTCAGGAGGCTGAGACAGG - Intronic
1194716489 X:97292138-97292160 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1194844382 X:98786304-98786326 CAGATTCAAGAGGAGGAAACAGG - Intergenic
1196035448 X:111138854-111138876 GTTATTCAGGAGGCTGAGGCAGG + Intronic
1196338667 X:114569716-114569738 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1196650671 X:118165330-118165352 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1196900033 X:120373895-120373917 GTGGAGCAGGAGGAGGAGGCGGG - Intronic
1197226064 X:123957558-123957580 CTTACTCAGGAGGCTGAGGCAGG + Intergenic
1197779079 X:130141711-130141733 GTGAATCAGGAGGAGTAGCCAGG - Intronic
1198065933 X:133096781-133096803 GTTACTCAGGAGGATGAGGCAGG + Intronic
1198371947 X:135997835-135997857 ATGTTTCAGGAGGCTGAGGCAGG - Intronic
1198372178 X:136000871-136000893 GTGACTCAGGAGGCTGAGGCAGG + Intronic
1198954098 X:142108306-142108328 CTGATTCAGAAGGGGTAGGGTGG - Intergenic
1199443443 X:147895247-147895269 CCAATTCAGGAGGTTGAGGCAGG + Intergenic
1199554914 X:149096262-149096284 GTTATTCAGGAGGCTGAGGCAGG + Intergenic
1199586284 X:149420235-149420257 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1199644510 X:149893284-149893306 CAGATTCAGGAGGCTGAGGCAGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1199671571 X:150152287-150152309 CCCACTCAGGAAGAGGAGGCAGG - Intergenic
1200108869 X:153728921-153728943 CCGAGCCAGGAGGAGGGGGCTGG + Intronic
1200952734 Y:8917065-8917087 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1200970187 Y:9144275-9144297 GTTATTCAGGAGGCTGAGGCAGG - Intergenic
1201311103 Y:12598690-12598712 CTGGTTCAGGAAGGGGAGGGTGG + Intergenic
1201388581 Y:13471374-13471396 GTAATTCAGAAAGAGGAGGCAGG - Intronic
1201612839 Y:15862142-15862164 GAGATTCAGGAGGATGAAGCAGG + Intergenic
1201769365 Y:17603958-17603980 GTGACTCAGGAGGCTGAGGCAGG + Intergenic
1201832189 Y:18302027-18302049 GTGACTCAGGAGGCTGAGGCAGG - Intergenic
1201916949 Y:19192257-19192279 GTTATTCAGGAGGGTGAGGCAGG - Intergenic
1202110343 Y:21410719-21410741 CTGTTACAGGAGGCTGAGGCAGG - Intergenic
1202600165 Y:26586021-26586043 CTTACTCAGGAGGCTGAGGCAGG + Intergenic