ID: 1073421034

View in Genome Browser
Species Human (GRCh38)
Location 10:103423826-103423848
Sequence GCTGACTTCTGTTCTGGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 262}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073421025_1073421034 16 Left 1073421025 10:103423787-103423809 CCCCCGGTTTAGACCTCTTGTCC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 262
1073421024_1073421034 24 Left 1073421024 10:103423779-103423801 CCAGGACACCCCCGGTTTAGACC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 262
1073421031_1073421034 3 Left 1073421031 10:103423800-103423822 CCTCTTGTCCTGGTGTGGTTCAT 0: 1
1: 0
2: 0
3: 15
4: 132
Right 1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 262
1073421026_1073421034 15 Left 1073421026 10:103423788-103423810 CCCCGGTTTAGACCTCTTGTCCT 0: 1
1: 0
2: 1
3: 8
4: 82
Right 1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 262
1073421028_1073421034 13 Left 1073421028 10:103423790-103423812 CCGGTTTAGACCTCTTGTCCTGG 0: 1
1: 0
2: 5
3: 29
4: 177
Right 1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 262
1073421032_1073421034 -5 Left 1073421032 10:103423808-103423830 CCTGGTGTGGTTCATAGTGCTGA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 262
1073421027_1073421034 14 Left 1073421027 10:103423789-103423811 CCCGGTTTAGACCTCTTGTCCTG 0: 1
1: 0
2: 1
3: 32
4: 217
Right 1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073421034 Original CRISPR GCTGACTTCTGTTCTGGTTC CGG Intronic
903847131 1:26285267-26285289 GCTGCCTGCTGCTCTGTTTCGGG + Intronic
906762701 1:48390881-48390903 GCTGATTTCTGGTATGGTTCAGG - Intronic
906982255 1:50644057-50644079 ACTGACTTCTTTTCTGGTTATGG + Intronic
907812677 1:57887403-57887425 GGTGACTTCTGTTATCATTCGGG - Intronic
908412928 1:63884814-63884836 CCTGACTTGTGTTTTGGTTATGG + Intronic
908420665 1:63955670-63955692 GCTAAGTTCTCTTCTGGTCCTGG - Intronic
909131394 1:71741753-71741775 GCTGGCTTCTGCTCAGCTTCTGG + Intronic
909530708 1:76679006-76679028 GCTCACTTCTGTTCTACTTCTGG - Intergenic
909690596 1:78403196-78403218 GCTGACATCTGCTCAGCTTCTGG + Intronic
910546139 1:88421173-88421195 GCTGGCATCTGTTCAGCTTCTGG - Intergenic
911162841 1:94698856-94698878 GCAGACATTAGTTCTGGTTCTGG - Intergenic
912532132 1:110332911-110332933 GCTGACATCTGCTCAGCTTCTGG + Intergenic
912670641 1:111620540-111620562 GCTCACTTCTGTCAGGGTTCAGG + Intronic
913216447 1:116624774-116624796 GCTGTCTTATGTGGTGGTTCAGG - Intronic
915739621 1:158108881-158108903 GCTAGCTTCTGCTCTGCTTCTGG + Intergenic
917607569 1:176649289-176649311 GCTGAATTCTTTTTTGTTTCTGG + Intronic
919108132 1:193180616-193180638 CCTGTCTTCTGTTCTGGAACTGG - Exonic
919502835 1:198359403-198359425 GCAGATTTATGTTCTGGTTCTGG - Intergenic
920984434 1:210872559-210872581 GCTGACATCTGCTCAGCTTCTGG + Intronic
921419907 1:214934372-214934394 GCTGATTTTGGTCCTGGTTCAGG + Intergenic
1063545452 10:6976555-6976577 GCTGGCATCTGCTCAGGTTCTGG - Intergenic
1064555998 10:16547688-16547710 GCTGGCATCTGTTCAGCTTCTGG - Intergenic
1065425340 10:25597343-25597365 GCTGTGTTTTGTTCTGGTCCAGG + Intronic
1065628019 10:27651056-27651078 GCTGACATCTGCTCAGCTTCTGG - Intergenic
1065692146 10:28345469-28345491 GCTGGCATCTGCTCTGCTTCTGG - Intergenic
1067701341 10:48575188-48575210 GCTGACCTCTGCTCAGCTTCTGG - Intronic
1068506453 10:57905991-57906013 TCTGGCTTATGTTCTGGCTCTGG - Intergenic
1069971942 10:72178967-72178989 TCTGCCTTCAGTCCTGGTTCAGG - Intronic
1073221733 10:101880255-101880277 GCTGCCTTGTGTGATGGTTCGGG + Intronic
1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG + Intronic
1074381147 10:112981785-112981807 TCTGACTTCTGTTTTGGTCATGG + Intronic
1074881877 10:117666033-117666055 GCTGCCATCTGCTCTGCTTCTGG + Intergenic
1075894957 10:125987022-125987044 CCTGACTTCAGATCTGGATCAGG - Intronic
1076124541 10:127963349-127963371 CCTGACTGCTGCTCTGGGTCAGG + Intronic
1077381355 11:2240527-2240549 GCTGACATCTGCTCAGCTTCTGG + Intergenic
1078610146 11:12812783-12812805 GCTCAGTGCTCTTCTGGTTCAGG + Intronic
1079100701 11:17540125-17540147 CCTGACTTCTTTTCTTTTTCTGG + Intronic
1079236488 11:18694419-18694441 GCTAATTTCTTTTCTGTTTCAGG - Intronic
1079554162 11:21739176-21739198 GCTGGCATCTGTTTTGTTTCTGG + Intergenic
1081018674 11:37915371-37915393 TCTGGCCTTTGTTCTGGTTCTGG + Intergenic
1081424801 11:42914327-42914349 GCTGACATCTGCTCAGCTTCTGG + Intergenic
1081602834 11:44507105-44507127 GCTGGTTTCTGTTGTGGTCCTGG + Intergenic
1081734089 11:45391428-45391450 GCTGACTTCTGGACTGGATGGGG - Intergenic
1082752276 11:57032041-57032063 GCTGACTTGTGTTTATGTTCTGG - Intergenic
1085808665 11:79660276-79660298 GCTGACTTCTGTTCAAATTCTGG + Intergenic
1085821205 11:79795531-79795553 TCTCACTTCAGCTCTGGTTCTGG - Intergenic
1089106973 11:116018580-116018602 GCTGGCTTCTGCTCAGCTTCTGG + Intergenic
1089893463 11:121904249-121904271 GCTGATTTCTGTTCTTTTTGTGG + Intergenic
1090271495 11:125389292-125389314 GCTGACCTGGGTTCTGGTCCTGG - Intronic
1090739017 11:129640211-129640233 CCTGGCTTCTGTTCTAGGTCAGG - Intergenic
1090834089 11:130441288-130441310 GCTGGCATCTGCTCTGCTTCTGG + Intergenic
1091586534 12:1820142-1820164 GCTGACTTCTGTTCCGATGGAGG - Intronic
1092000903 12:5031425-5031447 GCTGTCTTCAGGTCTGATTCTGG - Intergenic
1093801207 12:23375543-23375565 GGTGTCTTCTATTTTGGTTCAGG - Intergenic
1096136752 12:49209147-49209169 GCTGACTTTTGCTCGGCTTCTGG + Intronic
1098112019 12:67133061-67133083 GGTGCCTTCTTTCCTGGTTCTGG + Intergenic
1100117534 12:91325888-91325910 ACTGAATTCTGTTCTGTTTCTGG - Intergenic
1103187503 12:118972494-118972516 GCTGATTCCTGGTCTGGGTCAGG + Intergenic
1103828514 12:123760824-123760846 GCTGAATGCTGCTCTGTTTCTGG + Exonic
1103886563 12:124206855-124206877 GCTGACTTCTGTGCATTTTCTGG + Intronic
1104722141 12:131050504-131050526 GCTGACCTCTGCTCAGCTTCTGG + Intronic
1105814072 13:24017317-24017339 GCTTACGTAGGTTCTGGTTCGGG - Intronic
1106432221 13:29692182-29692204 CCTGACTTCTGTTCTGAGTTTGG - Intergenic
1107133618 13:36920664-36920686 GCTGACAACTCTTCTGGTTTCGG - Intronic
1107354841 13:39556086-39556108 GCTGACATCTGCTCAGCTTCTGG - Intronic
1107670552 13:42742492-42742514 GTGGACTTCTCTTCTCGTTCAGG + Intergenic
1108774678 13:53751296-53751318 GTAGACTTCAGTTCTGGTCCTGG + Intergenic
1108982758 13:56539356-56539378 GCTGACATCTGTTTGGCTTCTGG - Intergenic
1109342844 13:61084005-61084027 GCTGGCATCTGTTCAGCTTCTGG + Intergenic
1109647920 13:65284573-65284595 GATGACTTCTGTTCTCATTGAGG - Intergenic
1110400384 13:75083144-75083166 CCTGATTTCTCTTCTGGTCCTGG + Intergenic
1110412764 13:75221904-75221926 GCTGACATCTGCTCAGCTTCTGG + Intergenic
1110625797 13:77654264-77654286 GCTGACATCTGCTCAGCTTCTGG + Intergenic
1110890010 13:80687840-80687862 GCTGGCATCTGTTCAGCTTCTGG + Intergenic
1110989774 13:82025577-82025599 GCTGACATCTATTCAGCTTCTGG + Intergenic
1111814516 13:93133784-93133806 GCTGACATCTGCTCAGCTTCTGG - Intergenic
1112223934 13:97518983-97519005 GCTGACATCTGCTTGGGTTCTGG + Intergenic
1112666689 13:101583341-101583363 GATGACTTCTGTTCAGGTAAGGG + Exonic
1113556010 13:111235156-111235178 GTTACCTTCTGTTATGGTTCAGG + Intronic
1114726101 14:24939295-24939317 CCTGACTTCTATTCTAGTTTGGG + Intronic
1115642606 14:35344270-35344292 GCTGCCCTCTGTTCTGGTTCTGG + Intergenic
1115889789 14:38013389-38013411 GCTGACATCTGCTCAGTTTCTGG - Intronic
1116358424 14:43961395-43961417 GCTGACCTCTGTTCCAGCTCTGG + Intergenic
1119681677 14:76597013-76597035 TCTGACATCTGCTCAGGTTCTGG + Intergenic
1122188724 14:100022843-100022865 GCTGTTTTGTGTGCTGGTTCAGG + Intronic
1124031684 15:26017956-26017978 GCTGACTTGGCTTCTGGGTCCGG - Intergenic
1124476808 15:30041752-30041774 GATGACTTCCCTTCTGGTGCAGG - Intergenic
1126007825 15:44275054-44275076 GCTGCCTTCTGTTCTGGCCTTGG + Intergenic
1126344196 15:47675766-47675788 ACTGGCTTCTGTGGTGGTTCTGG + Intronic
1127906058 15:63377028-63377050 GGTGACTTTTGTTCTCTTTCTGG - Intronic
1128285892 15:66436775-66436797 GCTCCCTTATGATCTGGTTCCGG - Exonic
1129747756 15:78036834-78036856 GCTGCTTTCTGTTGTGGTCCAGG + Intronic
1133525065 16:6597090-6597112 GCTGTGTTCTGTTCTTTTTCTGG + Intronic
1134126606 16:11620454-11620476 GCTGGCATCTGTTCAGCTTCTGG - Intronic
1134396979 16:13874119-13874141 ACTTACTTCTGTTCTCCTTCCGG - Intergenic
1135472614 16:22744945-22744967 CCTGACTTCTGTTCTTGCTGGGG + Intergenic
1139059011 16:63225464-63225486 GGTGGCTTTTATTCTGGTTCAGG + Intergenic
1203012088 16_KI270728v1_random:303995-304017 GCTTCCTTCTGTTTTTGTTCTGG - Intergenic
1203030423 16_KI270728v1_random:577154-577176 GCTTCCTTCTGTTTTTGTTCTGG - Intergenic
1203041298 16_KI270728v1_random:757277-757299 GCTTCCTTCTGTTTTTGTTCTGG + Intergenic
1143888044 17:10080552-10080574 GCTGTCTTGGGGTCTGGTTCAGG + Intronic
1145277465 17:21441518-21441540 GCTGGCATCTGCTCTGCTTCTGG - Intergenic
1145713737 17:26999351-26999373 GCTGGCATCTGCTCTGCTTCTGG - Intergenic
1146991985 17:37282320-37282342 GCTGGCATCTGCTCTGCTTCTGG - Intronic
1147543374 17:41379626-41379648 ACTGACTCCTGGTCTCGTTCAGG + Exonic
1148569070 17:48652629-48652651 GTTTACTTCTGTTCTGGTCAGGG + Intergenic
1150123154 17:62619798-62619820 CCTGGCTCCTGTTCTGGTCCAGG + Intergenic
1150531249 17:65984511-65984533 TCGGTCTTCTGTTCAGGTTCAGG - Intronic
1152440938 17:80309325-80309347 GCTGGGTTCTGTTCTGGGTGTGG + Intronic
1154298649 18:13173690-13173712 GCCTGCTTCGGTTCTGGTTCTGG - Intergenic
1155391230 18:25339073-25339095 GCTCACTTCTGTGCAAGTTCTGG - Intronic
1155694520 18:28669640-28669662 TCTGATTTCTGCACTGGTTCAGG + Intergenic
1157576864 18:48749437-48749459 CCTGGCTTCTGTTCTGATTTTGG - Intronic
1158827046 18:61233934-61233956 TCTGTTTTCTGTTCTGGTGCTGG + Intergenic
1159611893 18:70534905-70534927 TCTGACTTATTTTCTGGCTCTGG + Intergenic
1160213911 18:76909522-76909544 GCTGCTTTATATTCTGGTTCAGG - Intronic
1162596742 19:11635331-11635353 GCTGGCATCTGCTCAGGTTCTGG + Intergenic
1163223460 19:15938081-15938103 GATGCCAGCTGTTCTGGTTCTGG + Intergenic
1167000116 19:46740885-46740907 GCTAACTTCTCTTCAGCTTCAGG - Intronic
925900837 2:8508497-8508519 GCTGACATCTGGTCAGCTTCTGG - Intergenic
926282929 2:11465273-11465295 GCTGATTTCTTCTCTTGTTCAGG - Intronic
926284909 2:11481549-11481571 CCTGACTCCAGTTCTGCTTCTGG + Intergenic
927062025 2:19432205-19432227 GATTAATTCTCTTCTGGTTCTGG - Intergenic
927880230 2:26685149-26685171 GCTGGCTTGAATTCTGGTTCAGG - Intergenic
928396488 2:30946552-30946574 GCTGGCATCTGTTCAGCTTCGGG - Intronic
929388033 2:41434558-41434580 TTTGATTTCTGATCTGGTTCAGG - Intergenic
930254565 2:49075790-49075812 GCTGACTTTTGTTTTTGTTTGGG + Intronic
930469300 2:51792803-51792825 GCTGGCATCTGCTCTGCTTCTGG + Intergenic
931369851 2:61651957-61651979 GCTGACATCTGCTCAGCTTCTGG + Intergenic
934934663 2:98456094-98456116 GCACACTTATCTTCTGGTTCAGG + Intronic
935429870 2:102964261-102964283 GCTGCCTTCTGTTCTGTTCAGGG + Intergenic
938591283 2:132738712-132738734 GCTGACATCTGCTCAGCTTCTGG + Intronic
938688755 2:133766778-133766800 GCTGATTTCAGGTCTGGGTCAGG - Intergenic
940116359 2:150212808-150212830 GCTGACTTTCCTTCTGGGTCAGG + Intergenic
940992059 2:160107517-160107539 TTTGATTTCTGTTCTGCTTCAGG - Intronic
942167382 2:173255058-173255080 GCTACCTTCTTTTATGGTTCAGG + Intronic
944828599 2:203509954-203509976 GCTGGCATCTGCTCTGCTTCTGG - Intronic
1170804144 20:19615422-19615444 GCTGGCATCTGTTCTGTTTCTGG + Intronic
1171170729 20:23013056-23013078 GCTGACTTTTGCTCTGGACCAGG - Intergenic
1171721858 20:28571046-28571068 GCTGACATCTGCTCGGCTTCTGG - Intergenic
1171786033 20:29465378-29465400 GCTGACATCTGCTCAGCTTCTGG - Intergenic
1171862190 20:30411530-30411552 GCTGACATCTGCTCGGCTTCTGG + Intergenic
1173489778 20:43470369-43470391 GCTGACTTCTGGGCCGTTTCTGG + Intergenic
1178333149 21:31718854-31718876 GTTGACTTTTCTTCTAGTTCCGG + Intronic
1178786307 21:35656813-35656835 TCTGACATCTGTTCAGCTTCCGG - Intronic
1178891839 21:36526430-36526452 TCTGAGTTCTGGTCTGGTCCTGG - Intronic
1179333374 21:40427155-40427177 GCTGACTGCTGCTCTGGTCATGG + Intronic
1179577242 21:42315611-42315633 GCGGATTCCAGTTCTGGTTCCGG + Exonic
1180295415 22:10929735-10929757 GCTGACATCTGCTCAGCTTCTGG - Intergenic
1180413258 22:12636314-12636336 GCTGACATCTGCTCAGCTTCTGG + Intergenic
1181506638 22:23362829-23362851 GCTGGCATCTGTTCAGCTTCTGG - Intergenic
1182428048 22:30285246-30285268 GCTGACCTCCGTTCTGCCTCTGG - Exonic
1184707509 22:46224616-46224638 GCTGACTTCATTTCTGTTTGGGG + Intronic
1184956129 22:47887512-47887534 GCTGGCTTCTGTGCTGGTCAGGG + Intergenic
1185226641 22:49657234-49657256 GCTGACACCTGTCCTGGTCCAGG + Exonic
949089675 3:12131-12153 GCTGACATTAGTTCTGGTCCCGG - Intergenic
950454621 3:13085296-13085318 GCTGACTTCAGCTCTGGTCGGGG + Intergenic
951252432 3:20409637-20409659 GGTGGCTTCTGTTCTGCTTAAGG + Intergenic
951609393 3:24474574-24474596 AATGGCTACTGTTCTGGTTCAGG + Intronic
953889666 3:46742745-46742767 GCTGACTTTTGCCCTGATTCTGG - Intronic
954801886 3:53191985-53192007 TCTGTCTTCTGTTCTGGGTGAGG + Intronic
956489391 3:69754554-69754576 GCTGACATCTTTTCAGCTTCTGG - Intronic
957927997 3:86839988-86840010 AGTGATTTTTGTTCTGGTTCCGG + Intergenic
958965492 3:100553577-100553599 GCTGAGTTCTGTTTTGGTTTAGG - Intronic
960014397 3:112870701-112870723 GCTGACATCTGCTCAGCTTCTGG + Intergenic
961530765 3:127538737-127538759 GCTGACTCCTGTGCAGGTGCAGG + Intergenic
962969399 3:140384990-140385012 GCCCACTTCTTTTCTGGCTCTGG - Intronic
963334827 3:143962929-143962951 GCTGACATCTGCTCAGCTTCTGG + Intergenic
963461565 3:145620222-145620244 CCTGACTTCTGTCATGTTTCCGG - Intergenic
964369726 3:155987266-155987288 GGAGACTTGTGGTCTGGTTCTGG + Intergenic
964576753 3:158179005-158179027 GCTGAATTCTTTTATGGTTTGGG + Intronic
966364301 3:179166264-179166286 TCTGGCTTCTTTTCTGGTTTTGG + Intronic
966663394 3:182441813-182441835 CCTGACTTCTGTTTTGTCTCAGG + Intergenic
968781185 4:2582936-2582958 GCTGCCTCCTTTTCTGGTTAAGG + Intronic
968981061 4:3849735-3849757 GCTGGCATCTGCTCAGGTTCTGG + Intergenic
969168761 4:5341725-5341747 GCTGGCATCTGTTCGGCTTCTGG + Intronic
969289233 4:6228029-6228051 GCTGACTTCTCTGCTCATTCAGG - Intergenic
969986605 4:11217747-11217769 GCTGACATCTGCTCAGCTTCTGG - Intergenic
971269830 4:25131895-25131917 CCTCACTTCTGTTTTGCTTCTGG - Intronic
972098103 4:35374748-35374770 GCTGAATTCATTTCTGGTTGAGG + Intergenic
972212119 4:36851183-36851205 GCTTTCTTCTCCTCTGGTTCTGG + Intergenic
972273327 4:37533895-37533917 GCAGAATTTTGTTCTGGTTTTGG + Intronic
975883365 4:78937895-78937917 GCTGAGTTCTGCTGTGGATCTGG - Intronic
978540038 4:109806503-109806525 GCTGGCATCTGCTCCGGTTCTGG - Intergenic
980539106 4:134170504-134170526 GCTGGCATCTGCTCAGGTTCTGG + Intergenic
981440558 4:144777391-144777413 GCTGGCATCTGTTCAGCTTCTGG + Intergenic
981517489 4:145625460-145625482 GCTGACTTCTGCTCTGGCATAGG + Intronic
982485031 4:155956172-155956194 GCTGACGTCTTTTATGTTTCTGG - Intergenic
983417381 4:167475962-167475984 GCTTGTTTCTGTTGTGGTTCTGG - Intergenic
985480153 5:104998-105020 GGTGAGGGCTGTTCTGGTTCTGG + Intergenic
985480164 5:105058-105080 GGTGAGGGCTGTTCTGGTTCTGG + Intergenic
985901129 5:2794448-2794470 TCTGACCTCTTTTCTGTTTCAGG + Intergenic
987470266 5:18319384-18319406 GCTGACTCTTCTTCAGGTTCTGG - Intergenic
988111831 5:26831955-26831977 GCTAACATCTGTTCAGCTTCTGG - Intergenic
988739255 5:34053783-34053805 GCAGACTTATGCTTTGGTTCTGG - Intronic
991311257 5:65245259-65245281 GCTGACTTATGGTTGGGTTCAGG + Intronic
991404720 5:66290648-66290670 GCTGGCATCTGTTTGGGTTCTGG + Intergenic
992435093 5:76748468-76748490 ACTGACATCTGTTCTGCTGCTGG - Intergenic
993638513 5:90374259-90374281 GCTGGCATCTGATCTGCTTCTGG + Intergenic
994124423 5:96153438-96153460 GCTGTCCTCTCTTCTGGTGCAGG + Intergenic
994758041 5:103818629-103818651 TCTGACTTCTGTTCCTGTTATGG + Intergenic
996117951 5:119639429-119639451 GCTGAATTCTGATTTTGTTCAGG + Intergenic
996449341 5:123601495-123601517 GCTTCCTTCTGGTCTGGTTCTGG + Intronic
998110100 5:139494810-139494832 GCTGACTTCTGCTCTGGCATTGG - Intergenic
998228945 5:140346917-140346939 GCTGAGTTCTGTTCCGGGCCTGG + Intergenic
998874002 5:146581203-146581225 GCTGACATCTGCTCAGCTTCTGG + Intronic
998911644 5:146966625-146966647 GCTGCCTTCCGTTCTAGTTAGGG - Intronic
999107659 5:149087771-149087793 GCTGGCATCTGCTCAGGTTCTGG - Intergenic
999153950 5:149444633-149444655 GCTGGCATCTGTTCAGCTTCTGG - Intergenic
1000477480 5:161729246-161729268 GCTGGCGTCTGCTCTGCTTCTGG + Intergenic
1002794173 6:457436-457458 GCTGACATCTGCTCAGATTCTGG + Intergenic
1004114554 6:12753653-12753675 GCTGAGATCTGTTTTGGTTCTGG + Intronic
1004305315 6:14496675-14496697 ACTAACCTCTGTGCTGGTTCTGG + Intergenic
1004579395 6:16934050-16934072 GCAGAATTCTGTTCAGGTTCTGG + Intergenic
1010426566 6:75734623-75734645 GCTGGCCTCTGTTCAGTTTCTGG + Intergenic
1011684717 6:89815083-89815105 GCTGAATCCTCTTCTGGCTCAGG - Intronic
1011998369 6:93621981-93622003 GCTGACCTCTGTGCTGTTTCTGG + Intergenic
1012085546 6:94821597-94821619 GCTGATTTCTGTGGTGATTCTGG + Intergenic
1013092587 6:106913646-106913668 TCTGATTTCTGTTCTGTCTCAGG - Intergenic
1013178103 6:107694424-107694446 GCTGACATCTGCTCAGCTTCTGG + Intergenic
1013961014 6:115900144-115900166 GCTGACATCTGTTCAGCTTCTGG - Intergenic
1015821568 6:137266805-137266827 GCTGGCATCTGCTCTGCTTCTGG + Intergenic
1017179846 6:151540943-151540965 AGTGACTTCTGTTCTCATTCAGG + Intronic
1023242084 7:38159597-38159619 GTTGACATCTGTTCAGCTTCTGG + Intergenic
1025529047 7:61853749-61853771 GCTTCCTTCTGTTTTTGTTCTGG + Intergenic
1025712908 7:63928032-63928054 GCTGAACTGTGTTCTGGCTCTGG + Intergenic
1025912819 7:65841364-65841386 GCTGACTTGAGTTCAAGTTCTGG - Intergenic
1029425980 7:100494187-100494209 GCTGACCTCTGGCTTGGTTCAGG - Exonic
1030598463 7:111566791-111566813 TCTGACTTCAGATCTGGGTCAGG + Intergenic
1031257319 7:119470574-119470596 GCTGAGAACTGTTCTGGTTTTGG + Intergenic
1033596504 7:142863302-142863324 GGTGTCTTCAGTTCTGGCTCTGG + Exonic
1033708825 7:143916915-143916937 TCTGACTACTCTTCTGGCTCTGG + Intergenic
1035082952 7:156233028-156233050 GGTGGCTCCTGTCCTGGTTCTGG - Intergenic
1036571966 8:9987755-9987777 GCTAACTTCTGTTCTCTTTTAGG + Intergenic
1037257681 8:16973535-16973557 GCTGACTTCTTTTCTGAATTGGG + Intergenic
1038286127 8:26207683-26207705 GCTGAGTTCTGCTTTGGTTTGGG + Intergenic
1038398192 8:27262434-27262456 GCTGATTTCTTTTCTGATTTTGG - Intergenic
1038720171 8:30028037-30028059 GCTCCCTTATGATCTGGTTCCGG - Intergenic
1040850638 8:51898469-51898491 AGTGACTTCTGTTTTGGTTTTGG - Intronic
1044624130 8:94219596-94219618 GCTGACGTCTGTTCTGTGCCAGG + Intergenic
1044636686 8:94332257-94332279 GCTGGCATCTGCTCTGCTTCTGG + Intergenic
1044896635 8:96899500-96899522 GCTGACATCTGCTCGGCTTCTGG + Intronic
1045585859 8:103536546-103536568 GCTGACGTCTGCTCGGTTTCTGG + Intronic
1046620116 8:116520269-116520291 CCTAACTTCAGTTCTAGTTCAGG + Intergenic
1048743562 8:137588787-137588809 GCTGAGTTCGCTTCTGGTTGGGG - Intergenic
1049056799 8:140243237-140243259 TCTGACTTGTGTTCCGGATCAGG - Intronic
1051189100 9:14492473-14492495 GCTGGCATCTGCTCTGCTTCTGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1052392724 9:27899919-27899941 GGTAACTTCTGTACTGATTCTGG - Intergenic
1055562002 9:77530395-77530417 GCTGACATCTGCTCGGCTTCTGG - Intronic
1056394114 9:86165967-86165989 GCTGGCATCTGTTCAGCTTCTGG - Intergenic
1056789924 9:89618629-89618651 GCGGACTTCTGTTCTGATGATGG - Intergenic
1057111573 9:92477132-92477154 GCTGACTACTGTTCTGTAGCAGG + Intronic
1057290175 9:93801401-93801423 GCTGACATCTCTTCTGAGTCAGG + Intergenic
1058002842 9:99883936-99883958 CCTGACTTTGGTTCTGCTTCTGG - Intergenic
1060058864 9:120440758-120440780 ACTGACTTCTGGTCTGGGTTAGG - Intronic
1060281859 9:122220408-122220430 GCTGACTCCTGTCCTGGGTGAGG - Intronic
1061759906 9:132843382-132843404 GCTGGCATCTGCTCTGCTTCTGG - Intronic
1202802293 9_KI270720v1_random:10836-10858 GCTGACATCTGCTCAGCTTCTGG - Intergenic
1203446847 Un_GL000219v1:64606-64628 GCTGACATCTGCTCAGCTTCTGG - Intergenic
1188211750 X:27433876-27433898 GCTGGCATCTGTTCAGCTTCTGG - Intergenic
1188429015 X:30084126-30084148 GCTGACATCTGCTCAGCTTCTGG + Intergenic
1188903113 X:35759563-35759585 GCTGGCATCTGTTCAGTTTCTGG - Intergenic
1189312870 X:40032463-40032485 GCTGATTTCTTTTCAGGTCCGGG - Intergenic
1189868066 X:45352101-45352123 GCTGGCTTGTGTTCAGGTGCTGG + Intergenic
1190835295 X:54095099-54095121 GCTGAGTGCTGTTTTGGTTTTGG - Intronic
1190955758 X:55191760-55191782 GCTGACAGCTGTTCTGTTTAAGG + Intronic
1192965369 X:76171659-76171681 TCTGACTTCTGCCCTTGTTCAGG + Intergenic
1193421166 X:81283943-81283965 GCTGAATTCTTTTATCGTTCTGG - Intronic
1193617478 X:83708139-83708161 GCTGACAGCTGTTCTGTTTAAGG + Intergenic
1193934252 X:87596153-87596175 GCTGGCATCTGGTCTGCTTCTGG - Intronic
1194019587 X:88670283-88670305 ACTGACATCTGCTCAGGTTCTGG + Intergenic
1196278917 X:113799826-113799848 GCTGACATCTGCTCAGCTTCTGG - Intergenic
1198111355 X:133505246-133505268 GCTGACATCTGTTCAGCTTCTGG + Intergenic
1198450895 X:136766830-136766852 GTTGACTCCTGCTCTGGTTCTGG + Intronic
1200293028 X:154889376-154889398 GCTGGCTTCTTGTCAGGTTCAGG + Intronic
1200339875 X:155385108-155385130 GCTGGCTTCTTGTCAGGTTCAGG + Intergenic
1200346595 X:155455580-155455602 GCTGGCTTCTTGTCAGGTTCAGG - Intergenic
1200391201 X:155948766-155948788 TCAGACTTGGGTTCTGGTTCAGG + Intergenic