ID: 1073421509

View in Genome Browser
Species Human (GRCh38)
Location 10:103427401-103427423
Sequence ACATTAGCAGCACTGTCTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073421502_1073421509 9 Left 1073421502 10:103427369-103427391 CCGGAGCTGAGTGTTCGGCCAAG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1073421509 10:103427401-103427423 ACATTAGCAGCACTGTCTTACGG 0: 1
1: 0
2: 0
3: 12
4: 138
1073421496_1073421509 30 Left 1073421496 10:103427348-103427370 CCCAGATTCGTTCGAACCATCCC 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1073421509 10:103427401-103427423 ACATTAGCAGCACTGTCTTACGG 0: 1
1: 0
2: 0
3: 12
4: 138
1073421501_1073421509 10 Left 1073421501 10:103427368-103427390 CCCGGAGCTGAGTGTTCGGCCAA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1073421509 10:103427401-103427423 ACATTAGCAGCACTGTCTTACGG 0: 1
1: 0
2: 0
3: 12
4: 138
1073421497_1073421509 29 Left 1073421497 10:103427349-103427371 CCAGATTCGTTCGAACCATCCCG 0: 1
1: 0
2: 0
3: 0
4: 5
Right 1073421509 10:103427401-103427423 ACATTAGCAGCACTGTCTTACGG 0: 1
1: 0
2: 0
3: 12
4: 138
1073421499_1073421509 14 Left 1073421499 10:103427364-103427386 CCATCCCGGAGCTGAGTGTTCGG 0: 1
1: 0
2: 0
3: 13
4: 72
Right 1073421509 10:103427401-103427423 ACATTAGCAGCACTGTCTTACGG 0: 1
1: 0
2: 0
3: 12
4: 138
1073421508_1073421509 -9 Left 1073421508 10:103427387-103427409 CCAAGGTGAGGGGGACATTAGCA 0: 1
1: 0
2: 0
3: 13
4: 94
Right 1073421509 10:103427401-103427423 ACATTAGCAGCACTGTCTTACGG 0: 1
1: 0
2: 0
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073421509 Original CRISPR ACATTAGCAGCACTGTCTTA CGG Intronic