ID: 1073422200

View in Genome Browser
Species Human (GRCh38)
Location 10:103433719-103433741
Sequence CAGAATGTGCATCTCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 233}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073422200_1073422206 13 Left 1073422200 10:103433719-103433741 CCCTGGAAGAGATGCACATTCTG 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1073422206 10:103433755-103433777 GGTTCTGAGCTGGAGTCTGAGGG 0: 1
1: 1
2: 2
3: 29
4: 255
1073422200_1073422205 12 Left 1073422200 10:103433719-103433741 CCCTGGAAGAGATGCACATTCTG 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1073422205 10:103433754-103433776 AGGTTCTGAGCTGGAGTCTGAGG 0: 1
1: 0
2: 5
3: 59
4: 378
1073422200_1073422207 20 Left 1073422200 10:103433719-103433741 CCCTGGAAGAGATGCACATTCTG 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1073422207 10:103433762-103433784 AGCTGGAGTCTGAGGGAAGCTGG 0: 1
1: 0
2: 6
3: 76
4: 646
1073422200_1073422208 30 Left 1073422200 10:103433719-103433741 CCCTGGAAGAGATGCACATTCTG 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1073422208 10:103433772-103433794 TGAGGGAAGCTGGTGAGAAGTGG 0: 1
1: 0
2: 0
3: 70
4: 640
1073422200_1073422204 3 Left 1073422200 10:103433719-103433741 CCCTGGAAGAGATGCACATTCTG 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1073422204 10:103433745-103433767 GGCTAGCAAAGGTTCTGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 112
1073422200_1073422203 -8 Left 1073422200 10:103433719-103433741 CCCTGGAAGAGATGCACATTCTG 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1073422203 10:103433734-103433756 ACATTCTGCTAGGCTAGCAAAGG 0: 1
1: 0
2: 1
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073422200 Original CRISPR CAGAATGTGCATCTCTTCCA GGG (reversed) Intronic
900848868 1:5126180-5126202 TAGGATGTGCACGTCTTCCAGGG + Intergenic
901471038 1:9456646-9456668 CAGACTGAGCTTCTCATCCAAGG + Intergenic
902341492 1:15786238-15786260 CAGAATGTGCTTCCCTCCCTGGG + Intronic
902852824 1:19174572-19174594 CAGAATGGGAATCTGTTCCAAGG - Intronic
907741026 1:57165925-57165947 CAGAATGTCTAACTCTTCCTCGG - Intronic
908508239 1:64827391-64827413 CAGAATGGGCATAACTTCAACGG - Intronic
909543303 1:76815222-76815244 TACAGTGTGCATCTCTGCCATGG + Intergenic
909667872 1:78155631-78155653 CAGTATATGCATCTTTTTCATGG - Intergenic
911273597 1:95833396-95833418 CTAATTGTGCACCTCTTCCATGG - Intergenic
912062015 1:105685942-105685964 CAGACTGTGCAGCTCTTTTAAGG + Intergenic
913122543 1:115754995-115755017 AAGAATTTGCATTTCTGCCAGGG + Intronic
913258180 1:116974114-116974136 CAAAATGTGGTTCTCTTCCCTGG - Intronic
915016209 1:152736626-152736648 CAGGATGTGCCTCACTCCCAGGG + Intergenic
915696640 1:157749304-157749326 CAAAATGTGTATTTCCTCCAGGG - Intronic
916338499 1:163700487-163700509 CTGGCTGTGCATCTCTTCCCAGG + Intergenic
917316759 1:173733850-173733872 CAGAAGGTTAATCACTTCCAAGG - Exonic
917499856 1:175576286-175576308 CTGACTTTGCATCTCTTTCAGGG - Intronic
917687551 1:177432572-177432594 CAGTTTTTGCATCTCTGCCAAGG + Intergenic
922634503 1:227153004-227153026 CAGAATTGACATTTCTTCCAGGG - Intronic
922791481 1:228313643-228313665 CAGAATGTGGATGTCTTCGCGGG + Intronic
923523574 1:234755515-234755537 GAGAAAGTTCATGTCTTCCAAGG - Intergenic
1065208404 10:23379034-23379056 CAAAATATGCATGTCTACCATGG + Intergenic
1065636435 10:27740977-27740999 CATCATTTGCATCTCTTACAAGG - Intronic
1067223407 10:44360223-44360245 CAGAATGTGCCCCACATCCAGGG - Intergenic
1067710506 10:48647816-48647838 CACAATGTGCATCCCTACAAGGG + Intronic
1068545217 10:58336730-58336752 CAGAAAATGCACATCTTCCAAGG + Intronic
1071015949 10:80997378-80997400 GAGCATGTGCATCCCTTCAAAGG - Intergenic
1071559552 10:86634333-86634355 CAGCTTGTGCATCTCTTCATAGG - Intergenic
1073422200 10:103433719-103433741 CAGAATGTGCATCTCTTCCAGGG - Intronic
1074951026 10:118336087-118336109 CAGAATGTGCATGTATTCTTGGG - Intronic
1075087836 10:119425386-119425408 AAGGATGTGCAACTATTCCAAGG - Intronic
1075401848 10:122166636-122166658 CAGAATCTCCATTTCATCCAGGG + Intronic
1076767541 10:132644739-132644761 CAGGATGCGCAGCGCTTCCAAGG - Intronic
1077078287 11:711008-711030 CAGGATGATCATCTCCTCCAGGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078873492 11:15371191-15371213 CAGAATGGACATCTCCTCCAGGG - Intergenic
1080492201 11:32778188-32778210 GAGAATGTGCATTTCTAACAAGG - Intronic
1081711259 11:45217448-45217470 CAGAATTTGCATCTTGTCCTAGG - Intronic
1085172348 11:74460046-74460068 CAGAATGATCATCTTTTCCAGGG - Intronic
1087309494 11:96523415-96523437 CAGAGTGTGGCTCTCTCCCAAGG + Intergenic
1087976044 11:104548155-104548177 CAGAATGTGCCTCTGTTGCTAGG - Intergenic
1091098809 11:132850202-132850224 CAGGATGTGCATCTCATGGAAGG + Intronic
1093441283 12:19199704-19199726 TAGAATGTGCTTTTCCTCCATGG - Intronic
1093447741 12:19279751-19279773 CAGAATATGTAACTCATCCAAGG + Intronic
1094490357 12:30957065-30957087 CAGAAGGTGCTTCCCTCCCACGG - Intronic
1094766751 12:33605035-33605057 CAGAATGTACATTCCTTTCAAGG + Intergenic
1095305346 12:40632077-40632099 CAGAATGTGTGTCTGTTTCAGGG - Intergenic
1095605844 12:44066472-44066494 CTGAATCTGCATATCTCCCAAGG - Intronic
1096485540 12:51978389-51978411 CAGAATATGCAGAGCTTCCAAGG + Intronic
1097220344 12:57446395-57446417 CAGAATGATCATCCATTCCATGG - Intronic
1099560399 12:84166152-84166174 CAGAATTTTCATCTATGCCAAGG + Intergenic
1104657275 12:130582674-130582696 GAGAATGTGCATTTCTTTCAGGG - Intronic
1105480381 13:20770124-20770146 CAGAATTTCCTTCTTTTCCAAGG - Intronic
1106206657 13:27603402-27603424 CAGAATGTGCAATTGTACCAAGG - Intronic
1106376355 13:29191991-29192013 TATACTGTTCATCTCTTCCAAGG - Intronic
1110083767 13:71350631-71350653 CAGAATGTGAAACTTTTACAGGG - Intergenic
1111621202 13:90727911-90727933 CAGAAAGTGAATCTCTTCAAAGG - Intergenic
1113708883 13:112451610-112451632 CACAGTGTGAATCTCCTCCAAGG + Intergenic
1116980778 14:51167799-51167821 TAGAATGTGAATCTCTCCCAGGG + Intergenic
1117443963 14:55785948-55785970 CAGAATGTGCTTGTGTTGCATGG + Intergenic
1117529977 14:56651006-56651028 CAAAATGTGAATCTCTTACTGGG - Intronic
1118106486 14:62665963-62665985 CAGGTTGGCCATCTCTTCCAAGG - Intergenic
1118109712 14:62703762-62703784 TAGAATGTGCATATCATACATGG - Exonic
1118266543 14:64300265-64300287 CAGAAACTGAATCTCTTGCAAGG - Intronic
1120102187 14:80458094-80458116 CATAACGTGCCTTTCTTCCAAGG + Intergenic
1120204540 14:81573703-81573725 TTGACTGTGCTTCTCTTCCATGG + Intergenic
1121833821 14:97074379-97074401 CAGCATGTGGAACTTTTCCAAGG - Intergenic
1123678337 15:22735655-22735677 CAGAATGTATTGCTCTTCCAAGG - Intergenic
1124330527 15:28809924-28809946 CAGAATGTATTGCTCTTCCAAGG - Intergenic
1125321800 15:38496792-38496814 AGGAATGTGCATTTCTTACATGG + Intronic
1125422302 15:39516981-39517003 AAGAATGTTCATCTCCTACATGG + Intergenic
1126471712 15:49019435-49019457 CAGAATTTGGATCGCTTCTATGG + Exonic
1127430614 15:58903725-58903747 AAGAATGTGCATCTCTAACAAGG + Intronic
1128237587 15:66078549-66078571 GAGAAGGTGCATCTCATCCTGGG - Intronic
1128756631 15:70187753-70187775 CAGAATGTTCATACCATCCATGG + Intergenic
1129389245 15:75212431-75212453 CAGCACGTGCCTCTCTCCCAGGG + Intergenic
1129941737 15:79503135-79503157 TACAATGTGCATTTCTCCCATGG - Intergenic
1131767189 15:95691046-95691068 GAGAATGTGCATTTCTAACATGG - Intergenic
1132283544 15:100642176-100642198 CAGAATGTGCATTTTTCCCTGGG + Intronic
1133141074 16:3744600-3744622 CAGAATGGTCATCTCAGCCACGG - Intronic
1133894527 16:9913377-9913399 CAGAATGAGATTCTATTCCAGGG + Intronic
1134136441 16:11679519-11679541 CAGGCTGTGCTGCTCTTCCAGGG + Exonic
1134774196 16:16837813-16837835 CAGAGAGTCCACCTCTTCCAAGG + Intergenic
1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG + Intergenic
1140291682 16:73665177-73665199 CAGAAAGATCATCTCTTCAATGG - Intergenic
1141286417 16:82676720-82676742 CAGAAAGTGCATCTCATGCAAGG - Intronic
1142246025 16:88970436-88970458 CAGGCTGTGCATCTCTGCCAGGG - Intronic
1142264101 16:89055638-89055660 CAGGAGATGCCTCTCTTCCAGGG - Intergenic
1143689412 17:8548669-8548691 CATTATGTGCATTGCTTCCATGG + Exonic
1144259997 17:13509016-13509038 CAAATTGTGGATCTCTGCCAGGG - Intronic
1147331503 17:39701826-39701848 AAGAAGGTTCCTCTCTTCCAGGG + Intronic
1147714034 17:42492065-42492087 CAGAATGAGCACCTCTTCACAGG - Intronic
1148620351 17:49030067-49030089 AAGAATTTGCATGTTTTCCAGGG - Intronic
1151916591 17:77122802-77122824 CAGAAAGAGCATCTCTGCCTTGG - Intronic
1154932545 18:21014983-21015005 TAGAATGTTCATCTTTTCCATGG - Intronic
1157380366 18:47209363-47209385 CAGAATGTGTCTCTCTCCCTTGG + Intergenic
1161100032 19:2416873-2416895 CAGGATGGGCATCTCTTACCTGG + Intronic
1162861602 19:13509757-13509779 CAGTGTTTGCATCTGTTCCACGG - Intronic
1164124291 19:22297201-22297223 CAGAATCTACATCTCTTCTTAGG + Intronic
1164864679 19:31594804-31594826 CATAATCTGCATCTCCTCCTAGG + Intergenic
926367321 2:12145277-12145299 CAGAAGGTACATGGCTTCCACGG - Intergenic
927000612 2:18790903-18790925 GAAAATGTGCATCTCTGCCCTGG + Intergenic
927207420 2:20619041-20619063 CAAGATGTCCATCTCGTCCATGG + Exonic
927502487 2:23591840-23591862 GAGAATGTGCACCGCTCCCAGGG - Intronic
928439835 2:31283233-31283255 CAGAACTTGCCTCTCCTCCAAGG + Intergenic
929050119 2:37829391-37829413 CAGAATGTGGTTGTTTTCCAGGG + Intergenic
929919611 2:46162981-46163003 CAGTATGTGCATCACTGCCATGG - Intronic
930252761 2:49054051-49054073 CAGAATGTACCTCACTTACATGG - Intronic
931219571 2:60277088-60277110 CAGAATCTGTCTCTCTCCCAGGG - Intergenic
931246886 2:60499375-60499397 CAGAATGTGCAACCTTTCCCAGG - Intronic
932035988 2:68247338-68247360 GAGAATGTGCATTTCTAACAAGG + Intronic
933720935 2:85397266-85397288 CAGAACATGCATCTCTAACAAGG - Intronic
937058610 2:118963541-118963563 CAGAATGTACATCCTTTTCAAGG - Intronic
937273475 2:120669937-120669959 CAGACTGTCCATCAGTTCCAGGG + Intergenic
937737216 2:125306747-125306769 CAGAATGTCCATCTGTTTTAAGG - Intergenic
941448409 2:165629435-165629457 CAGTTTGTGCATCTCATTCACGG + Intronic
941789962 2:169541343-169541365 ATGAAAGTGCATCTCTTCCCAGG - Intronic
945149373 2:206772249-206772271 CATAATTTGGATCTCTTCAAGGG + Exonic
945261870 2:207851266-207851288 CAAAATGTTTATCTCTCCCAAGG + Intronic
947076710 2:226352868-226352890 GATAATGTGCAACTTTTCCAAGG + Intergenic
947302201 2:228700497-228700519 CTGAATGTACATCTATTACAAGG + Intergenic
1169797245 20:9476473-9476495 CAGACTGTGCCTCTCTTCTGTGG - Intronic
1169940647 20:10933614-10933636 CAGAAGGAGCATCTCCTCCAGGG + Intergenic
1171421240 20:25019114-25019136 CAGAATGGGACACTCTTCCATGG + Intronic
1172186560 20:33034719-33034741 CACCATGGGCATCTCTGCCATGG - Intronic
1172903964 20:38355324-38355346 CAGACTGTGCTTCTCTCCCCAGG + Exonic
1173846380 20:46191339-46191361 GAGACTCTGGATCTCTTCCAAGG + Intronic
1173913283 20:46686975-46686997 CACAATGTTCAGCTGTTCCAGGG + Exonic
1174082181 20:47978424-47978446 CACAGTGGGCACCTCTTCCAGGG - Intergenic
1174134302 20:48368362-48368384 CACAGTGGGCACCTCTTCCAGGG + Intergenic
1174817548 20:53699707-53699729 AAGAATGTGTATTTCTCCCAGGG + Intergenic
1175052114 20:56165349-56165371 TAGAATGTTCCTCTCCTCCAGGG - Intergenic
1175084001 20:56444034-56444056 CAGGATGAACATTTCTTCCAAGG - Intronic
1177181252 21:17746831-17746853 GAGAGTGTACTTCTCTTCCAAGG - Intergenic
1177838104 21:26208235-26208257 CATAATGAGCAACTCTTTCAAGG - Intergenic
1178523350 21:33304147-33304169 CACAATGAGCATTTCTGCCACGG + Intergenic
949776537 3:7638949-7638971 CAAAATGTGCTTGTCTTCCCAGG + Intronic
950433198 3:12963285-12963307 AAGAATGGGCATTTCCTCCAAGG + Intronic
952732103 3:36649451-36649473 CAGAATCAGATTCTCTTCCAAGG + Intergenic
952778396 3:37069389-37069411 CAGAATGTCCATCCCTTTTAAGG - Intronic
955635025 3:61018806-61018828 GAGAATGTGTATCTATCCCATGG - Intronic
956637476 3:71380764-71380786 CTGAATATGCATCTCTTCTGTGG + Intronic
956932719 3:74063752-74063774 CTGACTGTACCTCTCTTCCAGGG + Intergenic
958665698 3:97135600-97135622 CAGAATCTGCATTTATTCCTGGG - Intronic
959919871 3:111858834-111858856 GGGAATGTGAACCTCTTCCAAGG - Intronic
960262590 3:115584904-115584926 CTGAAAGTGCATCTCCTGCAAGG + Intergenic
960444937 3:117736423-117736445 CAAAACTTGTATCTCTTCCAAGG + Intergenic
960486047 3:118254182-118254204 TAGAAGATGCATCTCTTCCCAGG - Intergenic
962078135 3:132106795-132106817 CAGAATATACTTCTCTTCAAAGG - Intronic
966824893 3:183955231-183955253 CAAAATATGCATTTCTTCCAGGG + Intronic
966842086 3:184098146-184098168 TAGAATGTGCTTCTCTTCCAGGG + Intronic
968373220 4:14281-14303 CAGAATGTTCATCTCCATCACGG + Intergenic
968394006 4:216397-216419 CAGGATCTGCAGCTCTACCAGGG + Intergenic
968411086 4:390703-390725 CAGGATCTGCAGCTCTACCAGGG + Intergenic
968503218 4:960710-960732 CAGCATGTGCACCTGTCCCAGGG + Exonic
969065035 4:4472531-4472553 CGGAACTTTCATCTCTTCCATGG + Intronic
969160702 4:5256131-5256153 CAGTATCTGCATCTCTAACATGG - Intronic
969515132 4:7643217-7643239 CATAATATGCATTTCTTCCAAGG + Intronic
970670789 4:18394571-18394593 GAGAATGAGCATATCTACCAAGG + Intergenic
971646051 4:29204864-29204886 CAGAGTGTGCATCTTTGTCAGGG + Intergenic
972859400 4:43148984-43149006 CAGAATATTCATTTTTTCCAGGG + Intergenic
974870309 4:67635027-67635049 TAGAATGTGGATTTCTTCAATGG - Intronic
974972577 4:68847550-68847572 CAGAAACTCCCTCTCTTCCAGGG - Intergenic
975362265 4:73484976-73484998 CAGAATTAGTATCTTTTCCAAGG - Intronic
977679444 4:99783069-99783091 CAGATTATGCATCTTTTCTATGG + Intergenic
978174580 4:105714185-105714207 TAGAGTGTGCATCTCTTTCCTGG - Intronic
979721889 4:123909976-123909998 CAGAAGCTGCATGACTTCCAAGG - Intergenic
982450411 4:155545412-155545434 TAGAATGTGGATCTCTGCCATGG + Intergenic
982673637 4:158350742-158350764 CTCAAGGTTCATCTCTTCCAGGG - Intronic
982782882 4:159509567-159509589 CAGAAACTCCATCTCTACCAAGG - Intergenic
983471015 4:168154537-168154559 TAAAATGATCATCTCTTCCATGG - Intronic
983718777 4:170819115-170819137 CAGAATGTCCTTCTCTTTTAAGG + Intergenic
983907356 4:173197926-173197948 CAGATTGTGCCCCTCTCCCAGGG + Intronic
983934183 4:173488263-173488285 CAAAATGAGCATCTCTTCAAGGG + Intergenic
984047288 4:174816062-174816084 CAGAATGTGCATTTTATCAAGGG - Intronic
984741112 4:183164129-183164151 CAGAAGGTGAATCTCTTATATGG - Intronic
985127987 4:186714238-186714260 CAGATTGTGAATCTATTTCAAGG + Intronic
985462174 4:190118287-190118309 CAGAATGTTCATCTCCATCACGG - Intergenic
987908212 5:24106399-24106421 CAGAATGTACCTCTCTTCTTGGG + Intronic
988558101 5:32255706-32255728 GAGAATGTGCAGCGCTTTCAGGG - Exonic
988582806 5:32482967-32482989 CAGAATTTCCATCTCTTTTAAGG + Intergenic
989992742 5:50787176-50787198 CAAAATGTTCATCACCTCCACGG + Intronic
999745483 5:154588639-154588661 CAGACTCTGCTTCTCTTCCTCGG + Intergenic
1000248939 5:159474762-159474784 CTGAATGTGTATCGCTTTCATGG - Intergenic
1001694433 5:173659531-173659553 CAGAAGCTGCATCTCTCCCAAGG - Intergenic
1002633998 5:180598241-180598263 CAGCAAGTGCATCTCTGCCATGG - Intergenic
1002900183 6:1404496-1404518 CCGGATGTGAATCTCTGCCAAGG + Intergenic
1003382274 6:5636193-5636215 CAAAATGAGCAACTCTTCTAAGG + Intronic
1003962105 6:11218442-11218464 CAGAATGGGTATCTATTCAAAGG + Intronic
1005452914 6:25991814-25991836 CTGAACGTACTTCTCTTCCAGGG + Intergenic
1006619970 6:35357009-35357031 CACAATGTACAGCTCTTCCCTGG + Intronic
1007148100 6:39657827-39657849 AAGAATGTTCATATCTGCCAAGG - Intronic
1007918942 6:45588398-45588420 CAAAATGTGTGTATCTTCCATGG + Intronic
1008331321 6:50247881-50247903 CAGATAGTCCATCTCTACCAGGG - Intergenic
1009361854 6:62824600-62824622 AAGAATGGGCATATCATCCAAGG - Intergenic
1010767315 6:79790893-79790915 CAGAAGGTGAATCTCAACCATGG + Intergenic
1012447697 6:99323481-99323503 CAGCATGTAAATCTCTTCCTCGG + Exonic
1013435915 6:110106718-110106740 CAAAATGTTCCTCTCTTCCTTGG + Intronic
1015233560 6:130944580-130944602 CAGAATGTTCTTTTCTTCCTTGG - Intronic
1016152924 6:140766459-140766481 CAGAATTTGAATCTCTTCTGAGG + Intergenic
1016495609 6:144658507-144658529 CAGAATATGCATCTCCTAAAGGG - Intronic
1017585613 6:155919340-155919362 CAAAATGTGCATCTACTCTATGG + Intergenic
1017662520 6:156687864-156687886 GCGAATGTGCATCTATTTCAGGG + Intergenic
1017780850 6:157714122-157714144 CAGATAGAACATCTCTTCCAGGG - Intronic
1017846972 6:158267134-158267156 CAGAATGTCCTTCCCTTTCAAGG + Intronic
1018467636 6:164065444-164065466 CAGAATTTCCTTCTCTTTCAAGG - Intergenic
1018599061 6:165519402-165519424 CAAAATGTCTATCTCATCCAGGG + Intronic
1023049595 7:36239627-36239649 CACACTGGGGATCTCTTCCAGGG - Intronic
1023092928 7:36633195-36633217 AAGGATGTGCATCTCTAGCAAGG - Intronic
1024568455 7:50704230-50704252 CAGAAAATGCATGTGTTCCATGG - Intronic
1025164099 7:56695625-56695647 ATGAATGGGCATCTCTTCCCAGG - Intergenic
1027958994 7:84919633-84919655 CAGTGTCTGCAGCTCTTCCAGGG + Intergenic
1028728682 7:94120012-94120034 GAGAATGTGAATCTATCCCAAGG - Intergenic
1030029058 7:105352198-105352220 CTTAATTTGCATCTCTTCAAAGG + Intronic
1030485590 7:110163063-110163085 CAGAATGTTGATATCTTCCCGGG + Intergenic
1031959546 7:127976323-127976345 CAGGCTGTGCCTGTCTTCCAGGG - Intronic
1033754981 7:144390884-144390906 AAGAAGGTGCATCATTTCCAGGG + Intergenic
1033977727 7:147123294-147123316 CAGAATTTTCACCTCTTCTATGG - Intronic
1041271302 8:56111765-56111787 GAGAAAGGGCATCTCTTCCCAGG - Intergenic
1041458559 8:58086134-58086156 CCGAATCTGCAGCTCTTCTAAGG + Intronic
1043989607 8:86736610-86736632 CAGAATGTTTCTCTCTTCCTCGG + Intronic
1044738739 8:95304345-95304367 CAGAGTCTGGTTCTCTTCCATGG + Intergenic
1045327135 8:101126015-101126037 CAGAATCTGCATTTCTGACAAGG + Intergenic
1046270181 8:111885657-111885679 CAAAATGAACATCTCTCCCAGGG + Intergenic
1047527778 8:125648274-125648296 GAGAATTTGCATTTCTTCCTTGG + Intergenic
1048852868 8:138661288-138661310 CAAAATGTCCTTCTCTTCCTTGG - Intronic
1050252179 9:3756632-3756654 GAGAATGTGTTTCTCTCCCATGG + Intergenic
1050429179 9:5544392-5544414 CAGAAGATGTATCTCTTCCCTGG - Intronic
1050670114 9:7986934-7986956 AAGAATATGCACCTCTACCAAGG - Intergenic
1050752262 9:8953586-8953608 CAAACTATGCATCTCTTCAAAGG + Intronic
1051195293 9:14557577-14557599 AAAAATGTGCATCTTTTCCTTGG - Intergenic
1052481224 9:29029009-29029031 TAGAATTTGCATTTCTTCCCAGG - Intergenic
1053649931 9:40157031-40157053 CAAAATGTGCATCTCTAGAAAGG - Intergenic
1053755809 9:41306895-41306917 CAAAATGTGCATCTCTAGAAAGG + Intergenic
1054330438 9:63748784-63748806 CAAAATGTGCATCTCTAGAAAGG - Intergenic
1054534650 9:66219172-66219194 CAAAATGTGCATCTCTAGAAAGG + Intergenic
1055279731 9:74660668-74660690 CAGCTGGTGCAGCTCTTCCATGG - Exonic
1057110669 9:92467674-92467696 CAAAATGTGTATTTCTGCCATGG - Intronic
1057902579 9:98961086-98961108 CAGAATGGCCATTTCTACCAAGG - Intronic
1058416316 9:104792660-104792682 CAAAATGTACATCTATACCAAGG - Intronic
1058533141 9:105926928-105926950 AAGCATGTGCCTGTCTTCCAGGG + Intergenic
1059473541 9:114525490-114525512 CAGAATGTCCTTCTTTTCCCTGG + Intergenic
1059633599 9:116151797-116151819 TAGAAACTGCATGTCTTCCAGGG - Intergenic
1060039248 9:120285536-120285558 AAGAATGTGCCTCTGGTCCAAGG - Intergenic
1060980809 9:127790574-127790596 CAGAATGTGCCGCTCCTCAAAGG - Exonic
1202797818 9_KI270719v1_random:141706-141728 CAAAATGTGCATCTCTAGAAAGG - Intergenic
1186148288 X:6647436-6647458 CAGAATTTGCATGACTTCCAGGG - Intergenic
1186781045 X:12912367-12912389 CAGAAGGTGCAGCTCTTGCTGGG + Intronic
1187023456 X:15408345-15408367 CAGAATATGCATCAGTTCCAGGG + Intronic
1187241823 X:17520961-17520983 CAGAATCTGCATTTCAGCCAGGG + Intronic
1190068205 X:47257753-47257775 CAGAATGTGCAACTTTTAAAAGG - Intergenic
1196757064 X:119167360-119167382 CAGAATGTGCCTCTGATGCATGG - Intergenic
1198953119 X:142095800-142095822 CAGTATGCTCATCTGTTCCAAGG - Intergenic
1200761000 Y:7039107-7039129 CAGAAGATGCTTCTCTTCCAGGG - Intronic
1201764191 Y:17563967-17563989 TAGAGTGCGCTTCTCTTCCACGG - Intergenic
1201837362 Y:18342023-18342045 TAGAGTGCGCTTCTCTTCCACGG + Intergenic