ID: 1073423339

View in Genome Browser
Species Human (GRCh38)
Location 10:103441504-103441526
Sequence CTCAGCTTCTTAAAGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073423330_1073423339 28 Left 1073423330 10:103441453-103441475 CCATGTTGGCCGGGCTGGTCTCG 0: 486
1: 43723
2: 152791
3: 220499
4: 148428
Right 1073423339 10:103441504-103441526 CTCAGCTTCTTAAAGTGTTGGGG No data
1073423333_1073423339 1 Left 1073423333 10:103441480-103441502 CCTGACTTCAAATGATCGGCCCG 0: 1
1: 41
2: 1091
3: 11942
4: 56383
Right 1073423339 10:103441504-103441526 CTCAGCTTCTTAAAGTGTTGGGG No data
1073423331_1073423339 19 Left 1073423331 10:103441462-103441484 CCGGGCTGGTCTCGAACTCCTGA 0: 51840
1: 157012
2: 220107
3: 177064
4: 94849
Right 1073423339 10:103441504-103441526 CTCAGCTTCTTAAAGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073423339 Original CRISPR CTCAGCTTCTTAAAGTGTTG GGG Intronic
No off target data available for this crispr