ID: 1073430037

View in Genome Browser
Species Human (GRCh38)
Location 10:103479964-103479986
Sequence ATGACAGCCCAGATGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073430030_1073430037 27 Left 1073430030 10:103479914-103479936 CCCACATCACTAGGTCTCTCCTT No data
Right 1073430037 10:103479964-103479986 ATGACAGCCCAGATGTTTGAGGG No data
1073430034_1073430037 -7 Left 1073430034 10:103479948-103479970 CCAGTCTCTCCGAAGGATGACAG No data
Right 1073430037 10:103479964-103479986 ATGACAGCCCAGATGTTTGAGGG No data
1073430032_1073430037 8 Left 1073430032 10:103479933-103479955 CCTTGTGTCTCAGTTCCAGTCTC No data
Right 1073430037 10:103479964-103479986 ATGACAGCCCAGATGTTTGAGGG No data
1073430031_1073430037 26 Left 1073430031 10:103479915-103479937 CCACATCACTAGGTCTCTCCTTG No data
Right 1073430037 10:103479964-103479986 ATGACAGCCCAGATGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073430037 Original CRISPR ATGACAGCCCAGATGTTTGA GGG Intergenic
No off target data available for this crispr