ID: 1073432159

View in Genome Browser
Species Human (GRCh38)
Location 10:103493884-103493906
Sequence CCCGCTCCACGCAGACCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073432151_1073432159 -5 Left 1073432151 10:103493866-103493888 CCCCGCGCTCCGCCGAGCCCCGC 0: 1
1: 1
2: 7
3: 64
4: 448
Right 1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1073432152_1073432159 -6 Left 1073432152 10:103493867-103493889 CCCGCGCTCCGCCGAGCCCCGCT 0: 1
1: 0
2: 2
3: 26
4: 243
Right 1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1073432150_1073432159 3 Left 1073432150 10:103493858-103493880 CCAGAACGCCCCGCGCTCCGCCG 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1073432148_1073432159 21 Left 1073432148 10:103493840-103493862 CCAGCTGCGTCGGAGCGCCCAGA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1073432153_1073432159 -7 Left 1073432153 10:103493868-103493890 CCGCGCTCCGCCGAGCCCCGCTC 0: 1
1: 0
2: 3
3: 70
4: 588
Right 1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1073432149_1073432159 4 Left 1073432149 10:103493857-103493879 CCCAGAACGCCCCGCGCTCCGCC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073432159 Original CRISPR CCCGCTCCACGCAGACCCGC GGG Intergenic
900105872 1:980798-980820 CCTCCTCCTCGCAGCCCCGCCGG + Exonic
900428372 1:2590760-2590782 CCCCCTCCACAGACACCCGCGGG - Exonic
902489365 1:16769824-16769846 CCCACACCACGCAGAACAGCAGG - Intronic
903501257 1:23801095-23801117 TCCGCCCCACTCTGACCCGCAGG + Intergenic
903597084 1:24503036-24503058 CCGGCTCCCCGCAGCCCCGTCGG + Exonic
904615335 1:31746462-31746484 CCCTCTCCACGCCCACCCCCAGG + Intronic
904701819 1:32362325-32362347 CCCGGTCCACACAGACGCGGCGG + Exonic
905289529 1:36911947-36911969 CCCTCTTCACGCACACCCACTGG + Intronic
906459129 1:46023862-46023884 CACGCTCCACGAAGGCCTGCTGG - Exonic
917479946 1:175403371-175403393 CCCCGTCCACGCAGAGCCCCCGG + Exonic
920367752 1:205457008-205457030 CCCGCACCTCGCAGCCCGGCGGG + Intergenic
922795545 1:228337806-228337828 CCCCCTCCACGCAGAACAGCGGG - Intronic
923531073 1:234812701-234812723 CCCACACCACGCAGAACAGCAGG + Intergenic
1066191746 10:33062240-33062262 CCCCCTCCACCCCCACCCGCTGG - Intergenic
1066502082 10:36003992-36004014 TCCGCTCCATGCAGAGCCCCAGG + Intergenic
1067773351 10:49143472-49143494 CCCACACCAGGCAGACCTGCTGG + Intergenic
1068783355 10:60944432-60944454 TCGGCTCTACGCAGACCCGACGG + Intronic
1069962629 10:72087686-72087708 CCGGCCCCACCCAGACCTGCCGG + Intronic
1072783380 10:98264980-98265002 CCCACTCCACCCAGCCCTGCTGG - Intronic
1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG + Intergenic
1076880407 10:133236898-133236920 CGCGCCCCACGCCGACGCGCAGG + Intergenic
1076994496 11:291485-291507 CGGGCTCCACGCAGCCCCACAGG - Intronic
1077051504 11:568827-568849 GCCGCCCCACGCACACCCGCGGG - Intergenic
1077384704 11:2263415-2263437 CCCCCTCCAGGCAGACCCAAGGG + Intergenic
1078180285 11:9004700-9004722 CCCGCCCCACGCCCACCCGCGGG - Intergenic
1083885703 11:65572575-65572597 CCCGCACCCCGCGGCCCCGCCGG - Exonic
1084759477 11:71260176-71260198 CTCCCTCCAAGCAGACCTGCTGG - Intergenic
1085346009 11:75768638-75768660 CCCGCGCCAAGCAGAGCCTCAGG + Intronic
1089254392 11:117186643-117186665 CCCGCCCCACCCAGGCCCCCTGG - Intronic
1089273337 11:117316073-117316095 CCCGCCCCTCCCAGCCCCGCCGG - Exonic
1092063602 12:5571131-5571153 ACACCTCCAAGCAGACCCGCTGG + Intronic
1092282476 12:7108530-7108552 CCCGCTCCTCCCACACCCACAGG - Intronic
1096110508 12:49026488-49026510 CCCGCTCAATGTAGACCCGCCGG + Exonic
1098284489 12:68893849-68893871 CCAGATCCACGCAGAACCCCTGG - Intronic
1102046614 12:109833479-109833501 CCAGCTCCCCGCCCACCCGCCGG + Intergenic
1102310646 12:111842204-111842226 CCCGCGCCGGGCAGCCCCGCCGG - Intronic
1107502346 13:40993383-40993405 CCCGCTCCCCCCAGACCCATCGG - Intronic
1109705944 13:66092776-66092798 CAAGCTCCACGCAGGCCCACTGG - Intergenic
1113566600 13:111323140-111323162 CCCCTTCCACGCAGCCCTGCTGG + Intronic
1113614445 13:111670819-111670841 CCCCCTCCACACAGACCCCAGGG - Intronic
1113619913 13:111755733-111755755 CCCCCTCCACACAGACCCCAGGG - Intergenic
1113710144 13:112457752-112457774 CCAACTCCACCCAGACCTGCTGG + Intergenic
1113767986 13:112892819-112892841 CGGGCCCCACTCAGACCCGCAGG - Intergenic
1114604979 14:23989006-23989028 CCAGCTCCAGGATGACCCGCCGG + Exonic
1122274852 14:100586304-100586326 CCCGCCCCACCCATACCCCCAGG + Intronic
1202921848 14_KI270723v1_random:34767-34789 TCCGCTCAAAGCAGACTCGCAGG - Intergenic
1124151258 15:27180519-27180541 CCTGCTCCACGTATACCCTCAGG + Intronic
1125717083 15:41825511-41825533 TCCACTCCAAGCAGCCCCGCAGG - Exonic
1128308214 15:66613855-66613877 CCTCCTCCACTCAGACCCCCAGG - Intronic
1132671256 16:1103043-1103065 CCTGCTCCGGGCAGCCCCGCGGG + Intergenic
1141638836 16:85329584-85329606 CCCGCACCCCGCAGCCCCCCAGG - Intergenic
1142130621 16:88430167-88430189 CCCGCTCCCAGCAGCCACGCCGG + Exonic
1142282951 16:89159036-89159058 CCTGCTCCCCCCAGACCCCCTGG + Intergenic
1142986109 17:3696138-3696160 CCCGCGCCCCGCAGCCCTGCCGG - Exonic
1143135524 17:4710495-4710517 CCCTCTCCTAGCAGACACGCGGG - Intronic
1144828949 17:18121270-18121292 CCAGCCCCACGCCGAGCCGCTGG + Exonic
1146723916 17:35142238-35142260 CCCCATCCACGCACACCCACCGG + Exonic
1147453725 17:40521587-40521609 CCTGCTCCACTCTGACCCCCAGG + Intergenic
1151669795 17:75565719-75565741 CCAACTCCCCGCAGTCCCGCAGG + Intronic
1151803329 17:76390571-76390593 CCGGTTCCCTGCAGACCCGCAGG - Exonic
1151954485 17:77373600-77373622 CCCGCGCCAGGCCCACCCGCAGG - Intronic
1152225383 17:79090384-79090406 CCCGCACCCCTCAGCCCCGCCGG + Intronic
1152572815 17:81127986-81128008 CCCGCCCCACGCCGGCCCCCAGG + Intronic
1152797436 17:82315163-82315185 CCAGCTCCAAGCAGACACACAGG - Exonic
1152888925 17:82868933-82868955 CCCGCTCCACGCACACGCCAGGG - Intronic
1152888934 17:82868980-82869002 CCCGCTCCACGCACACGCCAGGG - Intronic
1154360296 18:13655279-13655301 GCCACTCCACGCAGGCCCGGGGG + Intergenic
1158964683 18:62612101-62612123 CCCACTCCACGGAGGGCCGCAGG - Intergenic
1160592147 18:79951017-79951039 CCCGCTCCCCGCAGGCCCCGAGG - Exonic
1160720452 19:594818-594840 ACCCCTCCACGCAGACCAGAGGG - Intronic
1160807001 19:996317-996339 CCAGCTCCCAGCCGACCCGCCGG - Intronic
1161077262 19:2291822-2291844 CCCGCTCCCCGCCCGCCCGCAGG - Exonic
1163579610 19:18130584-18130606 CACGCTCCACAAAGACCTGCTGG - Exonic
1163592660 19:18203159-18203181 CCCGCTCCCCGCAAACCTCCAGG + Intronic
1165140969 19:33699653-33699675 CCGGCATCAGGCAGACCCGCGGG - Intronic
1165474035 19:36019240-36019262 CCAGCTCCACGCCCACCCACTGG + Exonic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1167217076 19:48171780-48171802 CCTCCTCCACGCAGGCCCCCAGG + Exonic
1167466004 19:49651436-49651458 TCCCCACCACGAAGACCCGCCGG - Exonic
1168271078 19:55250105-55250127 CCCCATCCACCCAGACCCGCAGG - Intronic
1168348139 19:55660689-55660711 CCCCCTCCAAGCACACACGCAGG - Intronic
1168351837 19:55680471-55680493 CCCGCTCCACCCTGAACCACTGG + Intronic
926463870 2:13166070-13166092 GCCGCTGCACGCAGACCTGAGGG + Intergenic
927156629 2:20224716-20224738 CCCCCTCCACGTGCACCCGCCGG + Intronic
927944072 2:27124087-27124109 CCCCCTACACCCAAACCCGCTGG - Intronic
929788822 2:45009647-45009669 CCCGCTCCGCGCAGAACTGAGGG + Intergenic
937369129 2:121285447-121285469 CCCGCTCCACACGGCCCCTCTGG + Intergenic
938380173 2:130832066-130832088 CCCGCCCCACCCTCACCCGCAGG - Intergenic
948060653 2:235041441-235041463 CGGACTCCACGCAGAGCCGCCGG + Exonic
1168877993 20:1184683-1184705 CCAGATCCACCAAGACCCGCAGG + Intronic
1172110317 20:32540817-32540839 CCAGCTCCACGCAGAACACCTGG + Intronic
1174395225 20:50243130-50243152 CCCGGCCCCCGCAGACCCCCTGG + Intergenic
1176286171 21:5020657-5020679 CCCCCTCTCCGCAGTCCCGCGGG + Intergenic
1178409465 21:32351593-32351615 CAGGCTCCACCCAGACCTGCCGG + Intronic
1179193193 21:39140767-39140789 CCTGCTCCACACAGTCACGCAGG - Intergenic
1179387780 21:40958580-40958602 GCCGCTGCACGCAGACACGAGGG - Intergenic
1179608178 21:42531875-42531897 CCCGCACCCCGCAGACCTGTTGG - Intronic
1179871010 21:44242818-44242840 CCCCCTCTCCGCAGTCCCGCGGG - Intergenic
1181809580 22:25395292-25395314 TCCCCTCCACTCAGACCCCCAGG - Intronic
1183290948 22:37001836-37001858 CCTGCTCCTCGGAGACCAGCTGG + Exonic
1184004768 22:41699907-41699929 CGGGCTCCACGGAGGCCCGCAGG - Intronic
1185147406 22:49146862-49146884 CCCTCTCCACCCAGACAGGCTGG - Intergenic
955924748 3:63994091-63994113 CCCACTCCCCGCAGAGACGCTGG + Intronic
961444747 3:126974141-126974163 CCCTCTCCATGGAGACCCCCTGG + Intergenic
963320868 3:143807802-143807824 CCCACTCCACCCAGCCCCTCTGG - Intronic
968051552 3:195658234-195658256 CCCGCTCCGCTCGGACCCGCTGG - Intergenic
968104265 3:195990099-195990121 CCCGCTCCGCTCGGACCCGCTGG + Intergenic
968114899 3:196081971-196081993 GCCGCTCCAGCCAGCCCCGCAGG + Intronic
968302566 3:197627689-197627711 CCCGCTCCGCTCGGACCCGCTGG + Intergenic
968478908 4:825502-825524 GCCGGGCCCCGCAGACCCGCAGG + Intronic
969630555 4:8333358-8333380 CCTGCTCCAAGCAGAACCTCAGG + Intergenic
979962403 4:127036590-127036612 CCCACTCCAGGCAGAACCTCAGG + Intergenic
980472189 4:133265571-133265593 GCCGCTGCACGCAGACTTGCGGG + Intergenic
981474988 4:145179745-145179767 GCCTCCCCACCCAGACCCGCCGG + Intronic
985497620 5:218487-218509 CCCGCTCCGCTCGGACCCGCTGG - Intronic
985782552 5:1878715-1878737 CCCGCTGGAAGCAGAGCCGCCGG - Exonic
991216887 5:64165961-64165983 CCCGCCCGACTCCGACCCGCCGG - Intronic
991485413 5:67130300-67130322 CCCGCTCCACAAAGGCCTGCTGG - Exonic
999715842 5:154359281-154359303 CCCTCTCCACTCAGACCAGCTGG + Intronic
1004722171 6:18277318-18277340 CCCGCTCCCCTCCGCCCCGCGGG - Intergenic
1018826954 6:167415607-167415629 CCGGCTATACGCAGGCCCGCTGG - Intergenic
1019668064 7:2262485-2262507 CCCGCTCCACACACAACCTCAGG - Intronic
1021510650 7:21428539-21428561 CGCGATCCACGCACACCGGCAGG - Intronic
1022099597 7:27161257-27161279 CGGGCTCCACGCAGACTCCCCGG - Intergenic
1022970937 7:35516594-35516616 CCAGCTCCAGGCAGTCCAGCAGG + Intergenic
1023354566 7:39354024-39354046 CCCGCTCCAGGCGGCCCGGCAGG + Intronic
1035205680 7:157292693-157292715 CCAGCTCCACGCGGACACACGGG - Intergenic
1037776478 8:21838947-21838969 CCCCCTCCCCACAGACCCCCGGG - Intergenic
1038546065 8:28426624-28426646 CCCTCCCCACCCAGACCCACGGG + Intronic
1044922209 8:97178703-97178725 GCCGCTCCACGCAGACATGAGGG - Intergenic
1045063662 8:98427604-98427626 CCCGCTCGCCGCAGACAGGCGGG - Intronic
1048583954 8:135755651-135755673 CGAGCTCCACCCAGACCCACTGG + Intergenic
1049252370 8:141596208-141596230 CCTGCTCCACCCAGGCACGCTGG + Intergenic
1060192064 9:121599614-121599636 CCCGCTCCACTCGGCCCAGCTGG + Intronic
1060553269 9:124495622-124495644 CCCGCCCCTCGCAGGCCCACAGG + Intronic
1061728402 9:132594514-132594536 CCCGTTCCAGGCTGACGCGCAGG + Exonic
1062542744 9:137048785-137048807 CCTGATCCCCGCCGACCCGCCGG - Exonic
1062717964 9:138020654-138020676 CCCGCCCCCCGCAGCCCCACTGG - Intronic
1190333157 X:49248036-49248058 CCCTGTCCATGCAGACCCGTGGG - Intronic