ID: 1073432562

View in Genome Browser
Species Human (GRCh38)
Location 10:103495559-103495581
Sequence CGCCGAGGTCTGGCTGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073432562_1073432568 15 Left 1073432562 10:103495559-103495581 CCAAAGCCAGCCAGACCTCGGCG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1073432568 10:103495597-103495619 TAGACCCCTATCTTTTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073432562 Original CRISPR CGCCGAGGTCTGGCTGGCTT TGG (reversed) Intronic
900948934 1:5846649-5846671 AGCCAAGGTCTGCCTGGCCTTGG - Intergenic
902555204 1:17242803-17242825 AGCAGAGGCCTGGCTGGCTCTGG + Intronic
915361454 1:155288416-155288438 CCCCGGGGTGTGGCTGGCTCAGG - Exonic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
920352000 1:205343718-205343740 GGCCGGGGTCTGGCTGGGTCCGG - Exonic
920932261 1:210400182-210400204 CCCAGGGGTCTGGGTGGCTTTGG + Intronic
923332441 1:232937811-232937833 CCCCGAGGCAGGGCTGGCTTTGG + Intergenic
1063301287 10:4851126-4851148 CGACCAGCTCTGGCTGGGTTTGG + Intergenic
1067449856 10:46375658-46375680 CCCCGGGCTCTGCCTGGCTTTGG - Exonic
1067587394 10:47484105-47484127 CCCCGGGCTCTGCCTGGCTTTGG + Exonic
1067634449 10:47991872-47991894 CCCCGGGCTCTGCCTGGCTTTGG + Intergenic
1070172126 10:73940823-73940845 CCCCGAGCTCTGGCTGGAGTAGG + Intergenic
1072630899 10:97145819-97145841 TGCCGCAGTCTGTCTGGCTTTGG - Intronic
1073432562 10:103495559-103495581 CGCCGAGGTCTGGCTGGCTTTGG - Intronic
1077395797 11:2320575-2320597 GGCCAAGGGCTGACTGGCTTTGG - Intergenic
1079021998 11:16916848-16916870 CCCTGAGGTCAGGCTGGATTAGG + Intronic
1080458322 11:32434477-32434499 CTCCTAGCTCTGCCTGGCTTTGG + Intronic
1083074150 11:60019637-60019659 GTTCGTGGTCTGGCTGGCTTCGG + Intergenic
1083203039 11:61131826-61131848 CGCCGGGGCCTGCCTGGCCTGGG - Exonic
1084230423 11:67748496-67748518 CCCCGAGGTGTGGCCGGCCTTGG + Intergenic
1087826682 11:102772536-102772558 AGCCCAGGTGTGGCAGGCTTTGG - Intronic
1088393536 11:109342343-109342365 AGCTGAGGACTGGCTGGTTTAGG + Intergenic
1090701332 11:129298591-129298613 CCCAGAGGTCTAGCTGGCTAAGG + Intergenic
1091020778 11:132097635-132097657 CTCCTAGGTCAGGCTGGCCTGGG + Intronic
1091098265 11:132844407-132844429 TGCAGAGGCCTTGCTGGCTTGGG + Intronic
1092767887 12:11869717-11869739 TGCCGGGGGCTGGATGGCTTCGG - Exonic
1093863038 12:24191221-24191243 CTATGAGGTCTGCCTGGCTTTGG - Intergenic
1094338976 12:29389560-29389582 CGTCGAGGCCCGGCAGGCTTGGG - Intergenic
1096429551 12:51531783-51531805 AGCCGAGGTATGGGTTGCTTTGG - Intergenic
1098557946 12:71840013-71840035 CGCCGAGGCCTAGCTGGCCTTGG - Intronic
1101246113 12:102885639-102885661 CGCCAAGGGGTGGCTGGCTCAGG + Intronic
1106226849 13:27792648-27792670 CGCAGAGGGCGGGCTGGCTGCGG + Exonic
1106422536 13:29595644-29595666 CGCCGAGGGCTGGCGGGTTCCGG + Exonic
1107467768 13:40665682-40665704 CGCCGAGCTCTCGATGGCCTTGG + Exonic
1112437878 13:99404585-99404607 CACCGAGGTCTGGCTGCCTCCGG - Intergenic
1122787157 14:104169052-104169074 GGCCCAGGCCTGGCTGGCTGGGG + Intronic
1125483733 15:40098174-40098196 CACTGAGAGCTGGCTGGCTTCGG - Intronic
1127911409 15:63419157-63419179 GGCCTTGGTCTGGATGGCTTAGG - Intergenic
1131158273 15:90088343-90088365 CGACGAGGTGAGGCTGGCTTGGG - Exonic
1132662177 16:1066394-1066416 GGTCGGGGTCTGCCTGGCTTGGG + Intergenic
1137328089 16:47461420-47461442 CGCTCAGGTTTGGCTGGCTGGGG + Exonic
1139664647 16:68447563-68447585 CGCCGAGGGTTGGGTGGCCTGGG - Intronic
1140097023 16:71883996-71884018 CGCCCCGGCCCGGCTGGCTTGGG - Exonic
1144930944 17:18858291-18858313 CAGCGAGGGCTGGCTGGCTCCGG + Intronic
1145198401 17:20916969-20916991 AGCCCTGGTCTGGCTGGCTGTGG + Intergenic
1145874547 17:28307103-28307125 CGTCGAGGCCCGGCAGGCTTGGG - Intergenic
1148230080 17:45927302-45927324 CGCTGAGGTGTGGTTGACTTAGG + Intronic
1150214617 17:63459763-63459785 AGCTGTGGACTGGCTGGCTTTGG - Intergenic
1150791750 17:68205215-68205237 GGAGGAGGTCTGGCCGGCTTTGG + Intergenic
1150932076 17:69595961-69595983 CCCTGATGTCTGGCTGGCTCTGG - Intergenic
1152584161 17:81181725-81181747 CGGCGTGGTCTGGGTGGCCTGGG - Intergenic
1153653458 18:7261654-7261676 TGATGAGGTCTGGCTGGCCTGGG - Intergenic
1161313031 19:3605094-3605116 GGCCGGAGTCTGGCTGGCTGGGG - Intronic
1162552368 19:11364786-11364808 TGTCTGGGTCTGGCTGGCTTGGG - Exonic
1166677421 19:44748488-44748510 CGCCGAGGCCTGGCTGCCCCAGG + Intronic
933741779 2:85539425-85539447 CGCCAAGGTCCGGCTGGCTGCGG + Intronic
936049861 2:109214496-109214518 CGCCAGGGCCTGGCTGGCTTGGG - Intronic
937287777 2:120763923-120763945 CGCAAAGCCCTGGCTGGCTTGGG - Intronic
940053218 2:149485894-149485916 CCCTGAGGTCTGGCGGGATTAGG - Intergenic
941264786 2:163348159-163348181 GGCCCAGGTCTGGCTGGCTCAGG + Intergenic
946332692 2:219019234-219019256 CTCCCAGGGATGGCTGGCTTGGG + Intronic
946373897 2:219296919-219296941 CTGCGAGGTCTGGAGGGCTTGGG - Intronic
948205581 2:236161189-236161211 CGCTGAGGCCTGGCTGGCACAGG - Intergenic
1170451432 20:16488101-16488123 CTCCAATGTCCGGCTGGCTTTGG - Intronic
1175226564 20:57447968-57447990 AACCGAGGTCTGGTTGGATTAGG + Intergenic
1175625789 20:60487291-60487313 CGCTGATGTCTGTCTGGCTCTGG + Intergenic
1176011714 20:62900384-62900406 AGCAGAAGGCTGGCTGGCTTGGG + Intronic
1180169680 21:46051236-46051258 CGCCCGGGGCTGGCTGGCCTGGG + Intergenic
1183370588 22:37429500-37429522 CCTCCAGGTCTGGCTGGATTTGG + Intergenic
1185140162 22:49095577-49095599 CGCTGAGGTCGGCCTGGCTGGGG + Intergenic
949105604 3:197473-197495 CTCCGAGGTCTAGCTGGTCTGGG + Intronic
950615868 3:14157776-14157798 AGCCCAGGTCTGTGTGGCTTTGG - Intronic
950667384 3:14505722-14505744 AGCGGAGGCCTGGCTGGCTGAGG - Exonic
953711175 3:45272576-45272598 CGCAGGTGTCTGCCTGGCTTAGG + Intergenic
953757192 3:45656886-45656908 CCTCCAGGGCTGGCTGGCTTGGG + Intronic
954455790 3:50599186-50599208 CACCCAGGTCAGGCTGGCTGTGG - Intergenic
957046986 3:75383516-75383538 CCCCGTGGTGTGGCCGGCTTTGG + Intergenic
960597884 3:119423126-119423148 GGCCGAGGTCAGGCTGCCATTGG - Intergenic
961654457 3:128433480-128433502 TACAGAGGTCTGGCTGGCCTAGG - Intergenic
965223549 3:165958695-165958717 CTTCAAGGTATGGCTGGCTTGGG + Intergenic
966631524 3:182081192-182081214 TACAGACGTCTGGCTGGCTTTGG - Intergenic
966646836 3:182255388-182255410 CGCCTGGGTCTTGCTGGCTGAGG - Intergenic
972621221 4:40749995-40750017 GCCCGGGGTCTGGCTGGCTCAGG - Exonic
986848292 5:11780813-11780835 CCCCCAGGGCTGGCTGGCCTTGG - Intronic
987091289 5:14509861-14509883 CCCAGGTGTCTGGCTGGCTTGGG - Exonic
988855816 5:35227335-35227357 AGCCCAGGTCTGTCTGACTTTGG - Intronic
990381893 5:55227234-55227256 CCCCAACCTCTGGCTGGCTTCGG - Exonic
998760827 5:145429940-145429962 GGCTGAGGGCTGGCTGGTTTAGG - Intergenic
1000209126 5:159095242-159095264 CGGGGAGGCCTGGCTTGCTTGGG + Intronic
1001196715 5:169679512-169679534 CTCCTAGGTCTGGCTATCTTGGG - Intronic
1002297900 5:178241541-178241563 CGCTGTGGTCTGGCTGCCTGGGG - Intronic
1007257839 6:40541147-40541169 CGCTGATGGCTGGCTGGCCTGGG - Intronic
1012257462 6:97050421-97050443 CATGGAGGTATGGCTGGCTTTGG + Intronic
1016554902 6:145325593-145325615 CCCCCAAGTCTGGGTGGCTTAGG + Intergenic
1016883377 6:148933741-148933763 TGCCGAGTTCTGGGAGGCTTTGG + Intronic
1023396721 7:39758395-39758417 TGCAAAGGTGTGGCTGGCTTCGG + Intergenic
1032414667 7:131726860-131726882 CCCCCAGGCCTGCCTGGCTTTGG - Intergenic
1039997008 8:42542193-42542215 CGCCCAGGCCTGTGTGGCTTTGG + Intronic
1048303351 8:133267088-133267110 GGCCTGGGGCTGGCTGGCTTCGG - Intronic
1053282886 9:36832462-36832484 CTCCGAGGTCTGACTGGATATGG + Intergenic
1056537501 9:87542781-87542803 CCCAGAGATCTGTCTGGCTTTGG + Intronic
1060583964 9:124774439-124774461 AGCCGTGATCTGGCTGGCCTTGG - Intergenic
1062118522 9:134821875-134821897 TGCCGAGGGCTGGCAGCCTTGGG + Intronic
1062245754 9:135565281-135565303 CTCCGAGGTCTGGCAGAGTTTGG - Intronic
1062426105 9:136506999-136507021 GGCCGGGGTGTGGCGGGCTTGGG - Intronic