ID: 1073433178

View in Genome Browser
Species Human (GRCh38)
Location 10:103500058-103500080
Sequence ACCCCCGGGAATGCAGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073433171_1073433178 30 Left 1073433171 10:103500005-103500027 CCTTCCTTGGTTGTCATGACGCT 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1073433178 10:103500058-103500080 ACCCCCGGGAATGCAGCAGACGG No data
1073433172_1073433178 26 Left 1073433172 10:103500009-103500031 CCTTGGTTGTCATGACGCTTGCA 0: 1
1: 0
2: 1
3: 7
4: 68
Right 1073433178 10:103500058-103500080 ACCCCCGGGAATGCAGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073433178 Original CRISPR ACCCCCGGGAATGCAGCAGA CGG Intronic
No off target data available for this crispr