ID: 1073434514

View in Genome Browser
Species Human (GRCh38)
Location 10:103508111-103508133
Sequence CCACTTTCCCAGCTGTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073434514_1073434523 19 Left 1073434514 10:103508111-103508133 CCAGGCAACAGCTGGGAAAGTGG No data
Right 1073434523 10:103508153-103508175 TTTGTCTCCGCCCCTGGGCTTGG No data
1073434514_1073434521 14 Left 1073434514 10:103508111-103508133 CCAGGCAACAGCTGGGAAAGTGG No data
Right 1073434521 10:103508148-103508170 GCCTGTTTGTCTCCGCCCCTGGG No data
1073434514_1073434524 20 Left 1073434514 10:103508111-103508133 CCAGGCAACAGCTGGGAAAGTGG No data
Right 1073434524 10:103508154-103508176 TTGTCTCCGCCCCTGGGCTTGGG No data
1073434514_1073434525 21 Left 1073434514 10:103508111-103508133 CCAGGCAACAGCTGGGAAAGTGG No data
Right 1073434525 10:103508155-103508177 TGTCTCCGCCCCTGGGCTTGGGG No data
1073434514_1073434520 13 Left 1073434514 10:103508111-103508133 CCAGGCAACAGCTGGGAAAGTGG No data
Right 1073434520 10:103508147-103508169 CGCCTGTTTGTCTCCGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073434514 Original CRISPR CCACTTTCCCAGCTGTTGCC TGG (reversed) Intronic
No off target data available for this crispr