ID: 1073440109

View in Genome Browser
Species Human (GRCh38)
Location 10:103547514-103547536
Sequence CTCCCAGGTCCAGCTTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 234}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073440109_1073440116 22 Left 1073440109 10:103547514-103547536 CCTCTGTAAGCTGGACCTGGGAG 0: 1
1: 0
2: 3
3: 23
4: 234
Right 1073440116 10:103547559-103547581 AGAGGAAGCAGAATCCCCAGAGG No data
1073440109_1073440112 -9 Left 1073440109 10:103547514-103547536 CCTCTGTAAGCTGGACCTGGGAG 0: 1
1: 0
2: 3
3: 23
4: 234
Right 1073440112 10:103547528-103547550 ACCTGGGAGAGGCAGGAAGCAGG No data
1073440109_1073440117 26 Left 1073440109 10:103547514-103547536 CCTCTGTAAGCTGGACCTGGGAG 0: 1
1: 0
2: 3
3: 23
4: 234
Right 1073440117 10:103547563-103547585 GAAGCAGAATCCCCAGAGGAAGG No data
1073440109_1073440119 30 Left 1073440109 10:103547514-103547536 CCTCTGTAAGCTGGACCTGGGAG 0: 1
1: 0
2: 3
3: 23
4: 234
Right 1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG No data
1073440109_1073440118 29 Left 1073440109 10:103547514-103547536 CCTCTGTAAGCTGGACCTGGGAG 0: 1
1: 0
2: 3
3: 23
4: 234
Right 1073440118 10:103547566-103547588 GCAGAATCCCCAGAGGAAGGAGG No data
1073440109_1073440114 4 Left 1073440109 10:103547514-103547536 CCTCTGTAAGCTGGACCTGGGAG 0: 1
1: 0
2: 3
3: 23
4: 234
Right 1073440114 10:103547541-103547563 AGGAAGCAGGCAAGAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073440109 Original CRISPR CTCCCAGGTCCAGCTTACAG AGG (reversed) Intronic
900164294 1:1238573-1238595 CCCCCAGCTCCAGCTCCCAGCGG + Intergenic
901051682 1:6428667-6428689 CTCCCAGGTCCAGCTGTGTGCGG - Intronic
901324118 1:8356828-8356850 CTCCCAGCTCCAGCCAACACAGG + Intronic
901415697 1:9114524-9114546 CTCCCAGGCCCAACTCAGAGGGG - Intronic
902482641 1:16719694-16719716 CTCCCAGGTCCAGCTGCGTGCGG + Intergenic
902624318 1:17667761-17667783 CCCACAGGCCCAGCTCACAGGGG - Intronic
904179700 1:28657504-28657526 AGCTCAGGTCCAACTTACAGTGG - Intergenic
904237421 1:29124107-29124129 CTCCCACCCCCAGCTTACATCGG + Intergenic
904340106 1:29828875-29828897 CACCCAGGTCGAGGTTGCAGGGG + Intergenic
905225548 1:36476512-36476534 CTCTCAGTTCCAGCTTATACCGG + Intronic
905858075 1:41328154-41328176 CTCCCTGCTCCAGCTGTCAGTGG - Intergenic
907474583 1:54697363-54697385 CCCCCAGGTCCAGCTTTAGGAGG + Intronic
907614201 1:55907225-55907247 CTCACATGTGCAGTTTACAGTGG - Intergenic
908461021 1:64348396-64348418 CTCCCAGGTCCAGAATTCAGTGG - Intergenic
909172774 1:72316663-72316685 AGCTCAGGTCCAACTTACAGTGG - Intergenic
910664855 1:89713422-89713444 TTCCAAGGTCCAGTTTACAGTGG + Exonic
911144020 1:94535337-94535359 CTCCTAGGGCCAGCTTACAGGGG + Intronic
912418513 1:109528092-109528114 TTCCCAGGGCCAGCTTTCCGAGG - Intergenic
912443190 1:109714012-109714034 CTGCCAGGTGCAGCTCACTGGGG - Intronic
914445715 1:147749129-147749151 CTCCCAGACCCAGCTGTCAGAGG + Intergenic
914874154 1:151500205-151500227 AGCCAAAGTCCAGCTTACAGTGG - Intergenic
917231629 1:172844004-172844026 CTCCCTAGTCCATCTTCCAGAGG - Intergenic
917310459 1:173672795-173672817 CTCTCAGGTCAAGCTTGCAGGGG - Intergenic
919650984 1:200148412-200148434 CTCCCAGCTGCTGCTTCCAGTGG - Intronic
920068512 1:203286271-203286293 GTCCCAGGTTCACCTTGCAGAGG - Intergenic
923253741 1:232200641-232200663 AGCTCAGGTCCACCTTACAGTGG - Intergenic
923533312 1:234828973-234828995 TTCCCATCTCCAGTTTACAGAGG + Intergenic
923536301 1:234854721-234854743 CTCACAGGTTCAGCTAACTGAGG + Intergenic
1063260669 10:4385834-4385856 CACACTGCTCCAGCTTACAGAGG + Intergenic
1063660835 10:8034415-8034437 CTCCCGGGTCAAGTTCACAGAGG + Intergenic
1065367153 10:24947950-24947972 TTCCCAGGTTCTGCTCACAGAGG + Intronic
1067250526 10:44582485-44582507 CTCACAGGGCCTGCTTACAGGGG + Intergenic
1067663346 10:48252705-48252727 CTCACAGGTCAAGCTTTCTGAGG - Intronic
1068447035 10:57137390-57137412 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1068555551 10:58454763-58454785 CTTTGAGGTCCAGCTTCCAGTGG - Intergenic
1068932833 10:62609370-62609392 GTCCAAGGTCAAGCCTACAGTGG + Intronic
1069192474 10:65507575-65507597 AGCTCAGGTCCAACTTACAGTGG - Intergenic
1070487435 10:76944069-76944091 CTGCCAGATCCTGATTACAGAGG + Intronic
1070704543 10:78628344-78628366 ATCCCACATCCAGCCTACAGAGG - Intergenic
1071378225 10:85032227-85032249 AGCCCAGGTCCAGCTTACAGTGG + Intergenic
1072099606 10:92216655-92216677 CACCCAGGTCCGTCTTAGAGGGG - Intronic
1072143562 10:92612764-92612786 CACCCACATCCAGCTTTCAGAGG + Intronic
1073440109 10:103547514-103547536 CTCCCAGGTCCAGCTTACAGAGG - Intronic
1073853072 10:107643687-107643709 GGCTCAGGTCCAGCTTACATTGG - Intergenic
1074886996 10:117701660-117701682 CTTCCAGGTCCCACTTAGAGAGG - Intergenic
1075337530 10:121618883-121618905 CACCCAGGTCCAGTTTTCATTGG + Intergenic
1075450434 10:122547898-122547920 CTCCAAATTCAAGCTTACAGAGG + Intergenic
1075654086 10:124149905-124149927 CTCCCAGGCCTGGCTGACAGGGG + Intergenic
1077675977 11:4193237-4193259 CTCCCAGGTCCATGATTCAGAGG + Intergenic
1078669909 11:13355471-13355493 CCCACAGGTCCAGATGACAGAGG - Intronic
1080685792 11:34513736-34513758 CTCCCAGCACCAGCGTGCAGTGG + Intronic
1081809569 11:45907306-45907328 CTCCCAGGGCCACCTCACAAAGG + Intergenic
1083306509 11:61764693-61764715 CTCCCAGGGTCACCTTGCAGGGG - Intronic
1083594437 11:63912164-63912186 CCCTCAGGTCCAGATTACATCGG - Exonic
1083637777 11:64129645-64129667 CCCCCAGGTCCAGCACAGAGAGG + Intronic
1083712708 11:64559016-64559038 CTCCCAGTGCCAGGTCACAGAGG - Intronic
1084184918 11:67466497-67466519 CTACCAGGGCCAGTGTACAGCGG + Intronic
1085685794 11:78620964-78620986 AGCTCAGGTCCAACTTACAGCGG + Intergenic
1088191835 11:107235723-107235745 AGCTCAGGTCCAACTTACAGTGG - Intergenic
1088264994 11:107980330-107980352 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1091232348 11:133996900-133996922 CTGCCAGGGCCAGATGACAGAGG - Intergenic
1091689325 12:2584931-2584953 AACGCAGCTCCAGCTTACAGAGG + Intronic
1096451865 12:51749627-51749649 CTCCCACGTGGCGCTTACAGGGG + Intronic
1098733145 12:74064421-74064443 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1099365779 12:81764232-81764254 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1099379539 12:81937742-81937764 AGCTCAGGTCCAACTTACAGTGG - Intergenic
1099650740 12:85424830-85424852 CACCCAGTGCCAGCTTACAACGG - Intergenic
1101263965 12:103064885-103064907 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1103396355 12:120610215-120610237 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1105213530 13:18271712-18271734 CTCCCAGGCACAGCTCAAAGAGG + Intergenic
1105409186 13:20156940-20156962 CTCCCAGCTCCATCTCCCAGTGG + Intronic
1106606263 13:31231934-31231956 CTGCCAAGTTCAGCTTACACAGG - Intronic
1108682607 13:52792419-52792441 CACCCAGGTCCAGCTGGCTGGGG + Intergenic
1108832772 13:54500029-54500051 CTCCAAGCTACAGCATACAGAGG + Intergenic
1110377019 13:74805261-74805283 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1115130537 14:30048036-30048058 AGCTCAGGTCCAACTTACAGTGG + Intronic
1115477144 14:33826248-33826270 CTCTCAGGTAAAGCTTTCAGAGG + Intergenic
1115726925 14:36227373-36227395 CCCCCTTGTCCAGCTTCCAGTGG - Intergenic
1118363737 14:65076844-65076866 CTCCCAGGTCCAGCTGGGAAAGG - Intronic
1118385634 14:65253421-65253443 TTCCCAGGTCCATCTCACGGTGG - Intergenic
1118880928 14:69825233-69825255 AGCTCAGGTCCAACTTACAGTGG - Intergenic
1123941486 15:25218754-25218776 GTCCCAGGTCCAAAATACAGTGG - Intergenic
1125727529 15:41875679-41875701 CACCCAGGTCCAGCCTGCTGCGG - Intronic
1126327803 15:47500622-47500644 AGCCCAGGTCCCTCTTACAGAGG + Intronic
1129891638 15:79075507-79075529 CCCCCAGCCCCAGCTTCCAGAGG - Intronic
1132283197 15:100638543-100638565 ATCCTAGGTCCAGGTTTCAGAGG + Intronic
1132458322 16:36474-36496 CTCCAAGGTCCAGCCTGCAAGGG + Intergenic
1133270071 16:4606886-4606908 CCCCCAGGCCCAGCCCACAGTGG + Intergenic
1140811023 16:78577989-78578011 CACCTAGGTCCAGATTTCAGAGG + Intronic
1141881617 16:86863889-86863911 CACGCAGGTGCAGCCTACAGGGG + Intergenic
1145271962 17:21409571-21409593 CTCCCAGGGGCAGCTTGCTGGGG + Intronic
1145310170 17:21697036-21697058 CTCCCAGGGGCAGCTTGCTGGGG + Intronic
1146850770 17:36219806-36219828 AGCTCAGGTCCAACTTACAGTGG + Intronic
1147249983 17:39147466-39147488 GTCACAGGACCAGCTTTCAGAGG + Intronic
1147340580 17:39751251-39751273 CTCTCAGGGCCAGCTCACAGTGG + Intergenic
1147767443 17:42846186-42846208 CATCCAGGTCCAGCTTGAAGTGG - Exonic
1148957223 17:51363838-51363860 CTCCCTGCTCCAGGTTTCAGAGG - Intergenic
1151196514 17:72435540-72435562 CTCCCAGGTCCAGCACAAAGGGG + Intergenic
1152140328 17:78532724-78532746 CTTCCAGGTCCATCTGAAAGGGG + Exonic
1152410855 17:80122201-80122223 CTACTACGTCCACCTTACAGAGG - Intergenic
1152962288 18:87030-87052 CTCCAAGGTCCAGCCTGCAAGGG + Intergenic
1154252897 18:12758827-12758849 AGCTCAGGTCCAACTTACAGTGG - Intergenic
1154975126 18:21450034-21450056 CTCCCACAACCAGCTGACAGGGG - Intronic
1155420372 18:25649355-25649377 CTCCCATGACCAGCTGACAAAGG - Intergenic
1156303700 18:35857492-35857514 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1157814667 18:50722031-50722053 CTCCCAGGTGCTGCTGACAAAGG - Exonic
1159183740 18:64944109-64944131 TTCCCAGGTCCAGATAATAGTGG + Intergenic
1160147712 18:76378592-76378614 CTCCCAGGGCCAACGTGCAGAGG + Intronic
1160533234 18:79577426-79577448 CCCCCAGGCCCCGCTAACAGTGG - Intergenic
1161211806 19:3070289-3070311 CTCCTAGGCCCAGCTCATAGAGG + Intergenic
1162792978 19:13072524-13072546 CACCCAGCTCCAGCTCCCAGAGG - Intronic
1162798922 19:13100660-13100682 CAGCCAGGTCCAGCTCACAGTGG + Exonic
1162967872 19:14164512-14164534 GTCCCAGGTCCAGCTCGGAGGGG + Intronic
1164844347 19:31419149-31419171 CTCCCCGGGCCATCTGACAGGGG + Intergenic
1164963907 19:32462588-32462610 CTCCCAGGTGTGGCTCACAGTGG - Intronic
1166323233 19:42032709-42032731 CTCCCATGTCCTCCTTATAGTGG + Intronic
1166420378 19:42631872-42631894 ATCCCAGGGCCTGCATACAGTGG - Intronic
1166656801 19:44618264-44618286 CTCCCAGGACCTGCTCACACTGG + Intronic
1166942144 19:46373711-46373733 CTCACAGGGCCACCTTCCAGCGG + Intronic
926825750 2:16903578-16903600 AGCTCAGGTCCAACTTACAGTGG - Intergenic
928231914 2:29505622-29505644 GTCCCAGGCCCTGTTTACAGTGG + Intronic
929792046 2:45030512-45030534 CTTCCAGCTCCAACTTACACTGG - Intergenic
932975624 2:76596787-76596809 AGCTCAGGTCCAACTTACAGTGG + Intergenic
933265887 2:80179945-80179967 AGCTCAGGTCCAACTTACAGTGG - Intronic
933971095 2:87470207-87470229 GTCCCAGGTCCAGCTTGGTGTGG + Intergenic
934300798 2:91775034-91775056 CTCCCAGGCACAGCTCAAAGAGG - Intergenic
935183765 2:100713544-100713566 AGCTCAGGTCCAACTTACAGTGG + Intergenic
936322633 2:111479982-111480004 GTCCCAGGTCCAGCTTGGTGTGG - Intergenic
938577955 2:132621181-132621203 CTTCCAGGTCCAGCTGGGAGAGG - Intronic
939233395 2:139460411-139460433 ATCCTAGGTCCAGTTTGCAGTGG - Intergenic
940903755 2:159149982-159150004 CTCCCAGGTCTTCCGTACAGAGG + Intronic
948468382 2:238162872-238162894 CTCCCAGGCCCTGCTCACAGCGG - Intronic
948889120 2:240898248-240898270 CCCACAGGTCCAGCTTCCCGGGG - Intergenic
1168840558 20:907368-907390 CTCCCAAGTCCAGATGGCAGAGG - Intronic
1169149452 20:3277770-3277792 GTCTCAGGTCCAGCTTTCAGAGG - Intronic
1171174423 20:23040825-23040847 CTCCCACTTCCAGCCCACAGCGG + Intergenic
1173297501 20:41772506-41772528 ATCCCAGGTTCTGCTTCCAGAGG + Intergenic
1174297907 20:49562035-49562057 CTGCCAGGCCCATTTTACAGAGG + Intronic
1174673794 20:52333688-52333710 ACCCCAGGTCCAGGTTACAGAGG - Intergenic
1177600494 21:23304426-23304448 CTCCCAGGTACATATTGCAGAGG - Intergenic
1177933858 21:27318158-27318180 AGCTCAGGTCCAACTTACAGTGG - Intergenic
1178109172 21:29353582-29353604 CACCCACCTCCAGCCTACAGAGG + Intronic
1179098852 21:38338728-38338750 GGCCCAGGTCTAGCTTACAGTGG + Intergenic
1179415327 21:41193750-41193772 AGCTCAGGTCCAACTTACAGTGG - Intronic
1179458362 21:41515341-41515363 AGCCCATGTCCAGCTTACAGTGG - Intronic
1181699155 22:24610170-24610192 CTCCCAGGCACAGCTCAAAGAGG - Intronic
1182088180 22:27575781-27575803 CTCCCCAGTCCAGATTTCAGAGG - Intergenic
1182736450 22:32534644-32534666 CTCCCAAATCCAGCCCACAGGGG - Intronic
1182813815 22:33140159-33140181 CTCCCAGATCCATGTTCCAGAGG - Intergenic
1183222313 22:36523573-36523595 CTCAAAGGACCAGCATACAGGGG + Intronic
1183342626 22:37290153-37290175 CTTCCAGGTCCAGCTCACTAGGG - Intronic
1183877758 22:40798445-40798467 CTTCCTGCTCCAGATTACAGTGG - Intronic
1184734255 22:46388812-46388834 CTCTGAGGTCCTGCTTTCAGAGG - Intronic
949417814 3:3832417-3832439 AGCTCAGGTCCAACTTACAGTGG - Intronic
951122426 3:18944343-18944365 AGCTCAGGTACAGCTTACAGTGG + Intergenic
952838389 3:37624286-37624308 TTCCCAGGTCCAGCTTTCTTCGG + Intronic
954810374 3:53243735-53243757 CTCCCAGGGCCAGCTTCAACTGG + Intronic
955796797 3:62645686-62645708 CTCCAGGGTCCATCTTATAGAGG - Intronic
956509487 3:69979120-69979142 AGCTCAGGTCCAACTTACAGTGG + Intergenic
956698995 3:71942332-71942354 GTCTCAGGGCCAGCTTCCAGAGG - Intergenic
958789003 3:98629830-98629852 AGCTCAGGTCCAACTTACAGTGG - Intergenic
958838397 3:99172666-99172688 CTCTGAGGTCAAGCTTCCAGAGG + Intergenic
959395054 3:105826782-105826804 CTCCCAGGACCAGGAGACAGGGG + Intronic
959851685 3:111095834-111095856 CTCACAGTTCCAGCTGACTGGGG - Intronic
964641270 3:158912608-158912630 TTCCCAGGTCCAGGTAACAGTGG + Intergenic
967610385 3:191499166-191499188 CTCCCAGGTCCTGCTGCCGGTGG - Intergenic
968458318 4:710219-710241 CTCCCCAGTCCAGCCTTCAGAGG - Intronic
969077714 4:4593425-4593447 CTCCCAGGTCCAGCTTGTTAGGG + Intergenic
969562663 4:7959501-7959523 CTCCCAACTCCACCTTCCAGAGG - Intergenic
970233129 4:13931697-13931719 CTCCCAGATCCAGTCTTCAGGGG - Intergenic
971101186 4:23467653-23467675 AGCTCAGGTCCAACTTACAGTGG - Intergenic
971979450 4:33734088-33734110 AGCTCAGGTCCAACTTACAGTGG - Intergenic
973149160 4:46865956-46865978 CTCCCAGGTCCAGATAACAGTGG - Intronic
975747875 4:77492471-77492493 CTGTCAGTTCCAGCTCACAGAGG - Intergenic
977833438 4:101619404-101619426 AGCTCAGGTCCAACTTACAGTGG - Intronic
978562690 4:110050382-110050404 CTCCCTTTTCCAGCTCACAGTGG + Exonic
979971144 4:127136972-127136994 ATCCAAGGTCCAGCTTGCAAAGG + Intergenic
982656072 4:158151402-158151424 ATCCCAGCTCCAGCCTTCAGTGG + Intronic
984061238 4:174991029-174991051 AGCTCAGGTCCAACTTACAGTGG - Intergenic
985152159 4:186958821-186958843 CTTCCTGGTCCAGTTTTCAGTGG + Intergenic
986938481 5:12919968-12919990 AGCTCAGGTCCAACTTACAGTGG - Intergenic
988160979 5:27518105-27518127 AGCTCAGGTCCAACTTACAGTGG - Intergenic
989481976 5:41941185-41941207 TTCCGAGGTCCAGGATACAGAGG + Exonic
989679723 5:44014326-44014348 CTCCGAGGTGGAGCCTACAGAGG - Intergenic
993412733 5:87593041-87593063 ATTTCAGGTCCAACTTACAGTGG - Intergenic
996930173 5:128876869-128876891 CTCCCAGATACAAGTTACAGAGG + Intronic
997718778 5:136061895-136061917 ATCCCAAGTTCATCTTACAGTGG + Intronic
999374748 5:151079120-151079142 CTCCCAGCGGCAGCTTCCAGAGG + Intronic
1002705733 5:181160092-181160114 CCCCCAGGCCCAACTTTCAGGGG + Intergenic
1005081118 6:21957569-21957591 TTATCAGGTCCAGATTACAGTGG + Intergenic
1005988787 6:30890880-30890902 CTCCCTGGCCCAGCCCACAGTGG - Intronic
1007420450 6:41716153-41716175 CTCCCATCTCCATCTCACAGAGG + Intronic
1009380544 6:63023464-63023486 ATCCCAGCTCCAGCTGAGAGTGG + Intergenic
1009806335 6:68605719-68605741 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1010869624 6:81021492-81021514 TTTCCAGGTCCAGATAACAGTGG + Intergenic
1012344424 6:98169094-98169116 AGCTCAGGTCCAGCTTTCAGTGG + Intergenic
1014534364 6:122597851-122597873 AGCTCAGGTCCAGCTTACAGTGG - Intronic
1015566158 6:134573783-134573805 CTCCTAGGCCCATCTTCCAGGGG + Intergenic
1017227980 6:152042312-152042334 AGCTCAGGTCCAACTTACAGTGG - Intronic
1017657410 6:156643193-156643215 CTCCAAGGGCCATCTTACCGTGG - Intergenic
1017693904 6:156994935-156994957 CACCCAGCCCCAGCTGACAGGGG - Intronic
1019052573 6:169194474-169194496 CTCCCGGGTTCAGCTTCCTGGGG + Intergenic
1019709806 7:2513047-2513069 CTCCCAGCCCCAGCCCACAGTGG + Intronic
1020710173 7:11596385-11596407 AGCTCAGGTCCAACTTACAGTGG + Intronic
1022956841 7:35389039-35389061 CTCCCAGCTCCACCTTTCTGTGG - Intergenic
1023823101 7:43990971-43990993 TTCCCAGGTCCACATGACAGAGG + Intergenic
1023823149 7:43991216-43991238 CTCCCAGGGCCAGGCTACAGGGG - Intergenic
1023862714 7:44225698-44225720 CCCCCAGGCCCAGCCTGCAGAGG + Intronic
1027200445 7:76060834-76060856 CTCCCAGGACCAGTTTTCAGGGG - Intronic
1029751365 7:102544409-102544431 TTCCCAGGTCCACATGACAGAGG + Intronic
1029751413 7:102544654-102544676 CTCCCAGGGCCAGGCTACAGGGG - Intronic
1029769317 7:102643503-102643525 TTCCCAGGTCCACATGACAGAGG + Intronic
1029769365 7:102643747-102643769 CTCCCAGGGCCAGGCTACAGGGG - Intronic
1029961076 7:104689812-104689834 AGCTCAGGTCCAACTTACAGTGG + Intronic
1030277290 7:107734883-107734905 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1032695194 7:134329880-134329902 CTCCCAGGACAAACTCACAGTGG - Intergenic
1034754745 7:153605889-153605911 CCCTCAGGTCTGGCTTACAGAGG + Intergenic
1034816401 7:154175557-154175579 GTCCCAGGTCCAGCATAGAGTGG - Intronic
1034878679 7:154747501-154747523 CTGCTAGTTCCATCTTACAGAGG - Intronic
1035031278 7:155862736-155862758 CTCCCAGGTGCAGCCACCAGAGG - Intergenic
1038532644 8:28331055-28331077 CTCCCACCTCCAGATAACAGAGG + Intronic
1039583559 8:38686328-38686350 CTCCCAGGTCCATCTGGGAGCGG - Intergenic
1041176625 8:55203553-55203575 CTTCCAGGTCCTTCTTACTGGGG + Intronic
1041613174 8:59875326-59875348 CACCCAGTTCCAGCTTCCCGGGG + Intergenic
1042047818 8:64673556-64673578 CTCCCACATCCAACTTACAATGG - Intronic
1044487315 8:92768356-92768378 AGCTCAGGTCCAACTTACAGTGG - Intergenic
1044633588 8:94301013-94301035 AGCTCAGGTCCAACTTACAGTGG - Intergenic
1045876126 8:106982966-106982988 CTACCAGGTCTAGCTTATGGTGG + Intergenic
1046700326 8:117393199-117393221 GGCCCAGGTCCAGCTCACAATGG + Intergenic
1048160627 8:132017872-132017894 CTGTCAGGTACAGCTTAAAGTGG - Intergenic
1048664206 8:136642820-136642842 CTCCAATGTCCAGCTCATAGTGG - Intergenic
1048886435 8:138913672-138913694 CTCCCAGCTGCTGCTTCCAGTGG - Exonic
1049857285 8:144870600-144870622 AGCTCAGGTCCAACTTACAGCGG + Intergenic
1050786507 9:9410422-9410444 TTCCTATGTCCAGCTTACATTGG + Intronic
1057404995 9:94761482-94761504 CTCCCAAACCCAGCTAACAGAGG - Intronic
1058544339 9:106043982-106044004 CACTCAGGTCCAACTTACAGTGG - Intergenic
1058562054 9:106240529-106240551 TTCCTATGTCCAGCTTCCAGGGG - Intergenic
1060225141 9:121785912-121785934 CTCCCAGAGCCAGATTTCAGTGG - Intergenic
1061238598 9:129356454-129356476 CCTCCAGGTCCAGCTTCCAGAGG + Intergenic
1061819835 9:133220957-133220979 CTGCCATTTCCAGCTTCCAGAGG - Intergenic
1061842145 9:133365010-133365032 CTCCCAGGGCCAGGTTCCTGAGG + Exonic
1062211211 9:135365312-135365334 TGACCAGCTCCAGCTTACAGGGG + Intergenic
1062240820 9:135536991-135537013 CTGCCATTTCCAGCTTCCAGAGG + Intergenic
1062735854 9:138137087-138137109 CTCCAAGGTCCAGCCTGCAAGGG - Intergenic
1190113583 X:47610999-47611021 GGCCCAGGTCCTGCTTACAGTGG + Intronic
1191112022 X:56811621-56811643 GTCCCAGGTCAAGCTCAGAGTGG + Intergenic
1191742692 X:64452538-64452560 TGCTCAGGTCCAACTTACAGTGG - Intergenic
1193547073 X:82844105-82844127 CTCCCATGTCCAGATAACACTGG + Intergenic
1193841567 X:86413839-86413861 AGCTCAGGTCCAACTTACAGTGG - Intronic
1194163088 X:90479722-90479744 AGCCCAGGTCCATCTCACAGTGG - Intergenic
1195277811 X:103299416-103299438 TTCCCAGGTCCAGGTAATAGTGG + Intergenic
1197002128 X:121451722-121451744 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1197591708 X:128418163-128418185 AGCTCAGGTCCAACTTACAGTGG + Intergenic
1198272491 X:135067651-135067673 CTCCCAGGTCCAGGTAATAGTGG - Intergenic
1198534393 X:137573057-137573079 CTCCCAGAGCCAGATTATAGGGG - Intronic
1200398077 X:156002897-156002919 CTCCAAGGTCCAGCCTGCAAGGG - Exonic
1200509361 Y:4057454-4057476 AGCCCAGGTCCATCTCACAGTGG - Intergenic
1202080088 Y:21075177-21075199 CTCCCTGGTTCTGCCTACAGGGG + Intergenic
1202263539 Y:22994474-22994496 TTCCTAGGTGCTGCTTACAGAGG + Exonic
1202416529 Y:24628215-24628237 TTCCTAGGTGCTGCTTACAGAGG + Exonic
1202454258 Y:25041871-25041893 TTCCTAGGTGCTGCTTACAGAGG - Exonic