ID: 1073440113

View in Genome Browser
Species Human (GRCh38)
Location 10:103547529-103547551
Sequence GCCTGCTTCCTGCCTCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 834
Summary {0: 1, 1: 1, 2: 8, 3: 101, 4: 723}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073440113_1073440118 14 Left 1073440113 10:103547529-103547551 CCTGGGAGAGGCAGGAAGCAGGC 0: 1
1: 1
2: 8
3: 101
4: 723
Right 1073440118 10:103547566-103547588 GCAGAATCCCCAGAGGAAGGAGG No data
1073440113_1073440121 17 Left 1073440113 10:103547529-103547551 CCTGGGAGAGGCAGGAAGCAGGC 0: 1
1: 1
2: 8
3: 101
4: 723
Right 1073440121 10:103547569-103547591 GAATCCCCAGAGGAAGGAGGGGG No data
1073440113_1073440117 11 Left 1073440113 10:103547529-103547551 CCTGGGAGAGGCAGGAAGCAGGC 0: 1
1: 1
2: 8
3: 101
4: 723
Right 1073440117 10:103547563-103547585 GAAGCAGAATCCCCAGAGGAAGG No data
1073440113_1073440119 15 Left 1073440113 10:103547529-103547551 CCTGGGAGAGGCAGGAAGCAGGC 0: 1
1: 1
2: 8
3: 101
4: 723
Right 1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG No data
1073440113_1073440116 7 Left 1073440113 10:103547529-103547551 CCTGGGAGAGGCAGGAAGCAGGC 0: 1
1: 1
2: 8
3: 101
4: 723
Right 1073440116 10:103547559-103547581 AGAGGAAGCAGAATCCCCAGAGG No data
1073440113_1073440120 16 Left 1073440113 10:103547529-103547551 CCTGGGAGAGGCAGGAAGCAGGC 0: 1
1: 1
2: 8
3: 101
4: 723
Right 1073440120 10:103547568-103547590 AGAATCCCCAGAGGAAGGAGGGG No data
1073440113_1073440122 18 Left 1073440113 10:103547529-103547551 CCTGGGAGAGGCAGGAAGCAGGC 0: 1
1: 1
2: 8
3: 101
4: 723
Right 1073440122 10:103547570-103547592 AATCCCCAGAGGAAGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073440113 Original CRISPR GCCTGCTTCCTGCCTCTCCC AGG (reversed) Intronic
900146403 1:1160739-1160761 GCCTGAGTCCTGGCCCTCCCAGG + Intergenic
900303292 1:1988781-1988803 GGCTGCTTCCTCCCTCCCACAGG - Intronic
900433126 1:2612233-2612255 GCCTCCTGCCTGCAGCTCCCTGG + Intronic
900609351 1:3537892-3537914 GCCTGGTCCCAGCCCCTCCCAGG - Intronic
900623795 1:3599049-3599071 GCCTGCTGCCTGCCTCAGGCAGG - Intronic
900720781 1:4174535-4174557 GTCCGCCTCCTGCCTCTCCCAGG - Intergenic
901613486 1:10518285-10518307 GTCTACTCCCTGCCTCCCCCGGG + Intronic
901625753 1:10624008-10624030 GCCTGCGTCCTTCATCTCCTGGG - Intronic
901633519 1:10659157-10659179 CTTTGCTTCCTGCCTCCCCCAGG + Intronic
901972412 1:12918483-12918505 GGCTGCTGCCTGCCTGTCCCTGG - Exonic
902012767 1:13283279-13283301 GGCTGCTGCCTGCCTGTCCCTGG + Exonic
902184129 1:14712328-14712350 TCCTGCTATCTCCCTCTCCCTGG - Intronic
902376549 1:16032634-16032656 TCCTGCTTCCTGCTCCTCCTGGG + Intronic
902581094 1:17408126-17408148 GCCTGGATCCTGCCTCGCGCGGG - Exonic
902597614 1:17520136-17520158 GCCAGCTTCCTGGTCCTCCCAGG + Intergenic
902623749 1:17665000-17665022 GCCTGGGTCCTGCCTTGCCCTGG + Intronic
902652807 1:17847498-17847520 TCCTCCTTGCTGCCTCTGCCTGG + Intergenic
902715588 1:18270437-18270459 TCCTGCTTCATGCCTCTCCAGGG + Intronic
903179977 1:21600310-21600332 TCCTGCATACTGCGTCTCCCTGG + Intronic
903191973 1:21661999-21662021 GCCTGCCTCCTCCCTGTCACGGG - Intronic
903238522 1:21966781-21966803 GGCTGCCTCCTTCATCTCCCAGG - Intergenic
903754233 1:25649711-25649733 CCCTGCAACCTGCCCCTCCCGGG + Intronic
903828494 1:26161341-26161363 GTCGGCTTCCAGCCTCTCCACGG - Exonic
904037190 1:27565212-27565234 GCGTGCAACCTGCCTCCCCCAGG + Intronic
904457801 1:30657852-30657874 GCAGGCTCCCTGCCTCTGCCTGG - Intergenic
904524197 1:31120351-31120373 CCCAGCTTTCTGCTTCTCCCAGG - Intergenic
904528971 1:31155457-31155479 GCCCCCTCCCGGCCTCTCCCGGG - Intergenic
904701543 1:32361406-32361428 GCCTGCTCCCTGCGGCTCCGCGG - Exonic
904956331 1:34287119-34287141 CCATGCATCCTGCCTCTCCATGG - Intergenic
905358140 1:37399156-37399178 GCCAGGTTCCTGCCTTTTCCTGG - Intergenic
905371984 1:37487218-37487240 CCCTACTTCCTGCCTCTTTCAGG - Intergenic
905387598 1:37615005-37615027 GCCTGCTTCCAGCCAAGCCCTGG - Intronic
905516967 1:38569120-38569142 GGCTGCTTTCTGCCCCTCGCAGG + Intergenic
905911146 1:41655670-41655692 CCCTGCTTCATGCTTCTCCATGG + Intronic
905920192 1:41714145-41714167 GCCTTCTTCCAGCCTCCCCTCGG - Intronic
906194341 1:43920566-43920588 GCTTTCCTCCTCCCTCTCCCAGG - Intronic
906208050 1:43997441-43997463 GCCTGCCCCCTGCCACGCCCTGG - Intronic
906240400 1:44239043-44239065 TCCAGCTTCCTCCCACTCCCTGG + Intronic
906673479 1:47676890-47676912 GCCTTCTTGCTGCCTCTCCATGG + Intergenic
907042012 1:51269843-51269865 CCCAGCTTCCTACCCCTCCCAGG + Intronic
907091607 1:51730101-51730123 GCCTCCTTCCCGCCGCCCCCTGG + Intronic
907550534 1:55301191-55301213 GCCTGGTTCCTGCCTCTCTCCGG + Intergenic
907785823 1:57611711-57611733 GCCTGCATCATGCCTGTCCTGGG + Intronic
907938717 1:59066376-59066398 GCCTACTGGCTGCTTCTCCCTGG - Intergenic
908825870 1:68132182-68132204 TTCTGCCCCCTGCCTCTCCCAGG - Intronic
908836394 1:68232712-68232734 GCCTGCAACCTGTCTCTCCAAGG + Intronic
910115864 1:83730911-83730933 TCCTGCTTCCTTACTCTCTCAGG + Intergenic
910294331 1:85629211-85629233 CCCTGCTTTCTGCTTCTCTCTGG - Intergenic
911115065 1:94237908-94237930 GCCTTTTTCCTCCCTCTTCCAGG + Intronic
911647617 1:100352819-100352841 GCCTGCTGCCTCCCTCGGCCAGG + Exonic
911769265 1:101718631-101718653 CCCTGCTTCCTACCTCTCCAAGG - Intergenic
912225266 1:107725838-107725860 GCCTGTTTCCTGGGTCTCCTGGG + Intronic
912390722 1:109300756-109300778 GCCTCCTTCCTTGCTCTCGCGGG - Intronic
912452545 1:109776279-109776301 CGCTCTTTCCTGCCTCTCCCTGG + Intergenic
912547976 1:110465083-110465105 CCCTTCTTCCTCCCTCTCCCGGG - Intergenic
912951698 1:114124740-114124762 CCATGCGTCCTGCCTCTTCCTGG - Intronic
914136865 1:144909188-144909210 GGCTGCTTCCTGGCTCACTCTGG - Intronic
914343654 1:146780225-146780247 GACTGATCCCTGCCTCTCCCCGG + Intergenic
914418913 1:147510363-147510385 GCCTGATTGCTGCCCATCCCAGG - Intergenic
914450187 1:147784684-147784706 ACCTGATTCCTGCATTTCCCTGG - Intergenic
915122272 1:153637019-153637041 GCTTGCTACCTGCCTCTTACAGG - Intronic
915213618 1:154326625-154326647 GCCTGCTTCCAGTCTCCCCAGGG + Intronic
915436630 1:155911449-155911471 GCCCTCTTCCCGCCCCTCCCAGG + Intergenic
916072194 1:161176912-161176934 GCCTGTTTCCTACTTCGCCCTGG - Intronic
916167277 1:161975413-161975435 GCCTGCTTCTTGCCTTCCCATGG + Intergenic
916475287 1:165163009-165163031 GCCTGCATCCTGCCTGCCCCAGG + Intergenic
916842391 1:168613788-168613810 GGCTGCTTCCAGCCTGTCCCGGG + Intergenic
916878881 1:168999547-168999569 GACAGCTTCCTGCCTCTCTCTGG + Intergenic
917351658 1:174084351-174084373 CCCTGCAACCTCCCTCTCCCAGG + Intergenic
917812958 1:178678022-178678044 GCCTGCAACCTCCTTCTCCCAGG - Intergenic
918175038 1:182036130-182036152 CCCTGCTTCCTTTCTTTCCCTGG + Intergenic
919772506 1:201171379-201171401 CCCAGCCTCCTGCCCCTCCCTGG - Intronic
920230504 1:204466827-204466849 CCCTGCTGCCAGCCTCTGCCCGG - Intronic
920400012 1:205670562-205670584 CCCTGGTGCCTGCCTCCCCCAGG + Intronic
920528620 1:206685699-206685721 GACCGCTTCCGGCCGCTCCCGGG + Intronic
920531549 1:206706270-206706292 GCCCTCTCCCTGCCTTTCCCTGG + Intronic
920868053 1:209769630-209769652 TACCACTTCCTGCCTCTCCCAGG + Intronic
921163469 1:212489119-212489141 TCAGGCTGCCTGCCTCTCCCTGG - Intergenic
921214915 1:212928562-212928584 GACTGCTACCTGCCTTGCCCAGG + Intergenic
922290537 1:224205686-224205708 GGCTCCTGCCTGACTCTCCCAGG + Intergenic
923226485 1:231942824-231942846 GCCTCCTTCCTGCTTCTACCAGG + Intronic
923262023 1:232276638-232276660 GCCTGCTTCCTCCCTATCCAGGG + Intergenic
923620562 1:235575857-235575879 GCCTGTGTCCTGACTCTGCCTGG + Intronic
924161325 1:241235411-241235433 GCCTGGTTCCTGCCTGTTCCAGG - Intronic
924612920 1:245588738-245588760 GTCTCCTTCCTGCCCCTCGCTGG + Intronic
1063015219 10:2070446-2070468 TCTTACTGCCTGCCTCTCCCTGG + Intergenic
1063881677 10:10538246-10538268 GTCTCCTTCCTGCCTCCCTCTGG + Intergenic
1065197965 10:23285138-23285160 TCCTCCTTCCTGTTTCTCCCAGG - Intronic
1065952932 10:30668188-30668210 GCCAGTGTCATGCCTCTCCCTGG + Intergenic
1066369617 10:34809435-34809457 CCCTGCCTGCTGCCTCTCCTGGG - Intronic
1066732584 10:38449032-38449054 GCCTACTTCCTGCCTCCCGGTGG + Intergenic
1067348922 10:45458034-45458056 GCCTGGGTCCTGCCTCTGCCTGG - Exonic
1067467447 10:46511417-46511439 CCCTGGTTCGTGCCTCTCCTGGG - Intergenic
1067541872 10:47160728-47160750 TCCTGCTTCGTCCCTCTGCCAGG - Intergenic
1067562252 10:47312265-47312287 GCCTGCTTCCTGGTGCTCCGCGG + Intronic
1067619739 10:47873188-47873210 CCCTGGTTCGTGCCTCTCCTGGG + Intergenic
1067809601 10:49417086-49417108 GCATTCTCCCTGCCTCTCCATGG + Intergenic
1068690001 10:59905712-59905734 CCCAGCTTCCTCCCTCTTCCAGG + Intronic
1069829326 10:71272842-71272864 TCCTGCCTGCTGCCACTCCCAGG + Intronic
1069867815 10:71514517-71514539 CCCCGCTGCCTGCCTCTCCTTGG + Intronic
1069956302 10:72053953-72053975 GCCTCCTCCCTGACTCTGCCAGG - Intergenic
1070216600 10:74388941-74388963 GCCTTCTTTCTCCCTCTCCATGG + Intronic
1070283400 10:75066694-75066716 GCCACCTTCCTGCCTCGGCCCGG - Intergenic
1070548422 10:77470910-77470932 GCCTGCTTCATTCCCCACCCCGG - Intronic
1070799268 10:79235541-79235563 GGCTGCTCCCTGCTACTCCCTGG + Intronic
1070964139 10:80519144-80519166 GCCTGCCATTTGCCTCTCCCCGG + Exonic
1072611104 10:97018256-97018278 GCCTTCTTCCTGCTCCTGCCAGG - Intronic
1072664465 10:97383822-97383844 CCCTGCCTCTTGCCGCTCCCTGG - Intronic
1073440113 10:103547529-103547551 GCCTGCTTCCTGCCTCTCCCAGG - Intronic
1073564413 10:104522815-104522837 GCCTGCTTTGTGCCTGGCCCTGG - Intergenic
1074892099 10:117744226-117744248 GCCTTCATTCTGCCTTTCCCTGG - Intergenic
1075097731 10:119483620-119483642 GCCTGCTTCCTATCTATGCCAGG + Intergenic
1075949222 10:126462770-126462792 GCCTGGGTCCTCCCTCTCCTGGG + Intronic
1076238591 10:128884648-128884670 GCCTCCCACCTCCCTCTCCCAGG + Intergenic
1076302237 10:129437124-129437146 TCCATCTTCCTGCCTCACCCTGG + Intergenic
1076365111 10:129916641-129916663 CCCTGCATCCAGCCTCTCGCTGG - Intronic
1076765822 10:132632502-132632524 GCCTGGTTCCTGCCTCTCAGAGG - Intronic
1077093427 11:789581-789603 GCCGCCTGTCTGCCTCTCCCAGG + Intronic
1077159347 11:1105642-1105664 GCCTCCCTCCTGCCTCCTCCTGG + Intergenic
1077352784 11:2100607-2100629 GCGGGCTTCCTGCCTGGCCCCGG - Intergenic
1077432021 11:2520419-2520441 ACCTGCTTCCTGGCTCTGCATGG - Intronic
1077456720 11:2685840-2685862 GGCTGCCTCCTGCTTCACCCAGG + Intronic
1077536363 11:3126657-3126679 GCTGACTTCCTGCCCCTCCCAGG - Intronic
1077551118 11:3200750-3200772 GCCTGGTTCCTGCCTCTGCCAGG - Intergenic
1078449592 11:11430604-11430626 TCCTGCTGCCTGCCTCTTCTGGG + Intronic
1078508054 11:11966598-11966620 TCTTCCGTCCTGCCTCTCCCAGG - Intronic
1078635476 11:13045766-13045788 TCCTTCTTCCTACCTCTCCCTGG - Intergenic
1078648339 11:13163608-13163630 GCATGCTTCCTGCCACTGCCTGG + Intergenic
1078898636 11:15621135-15621157 GTCTTCTTCCTGCCTCCACCTGG + Intergenic
1079140267 11:17804072-17804094 GGCTAATTCCTGCTTCTCCCTGG + Intronic
1079769996 11:24446576-24446598 ATCTGTCTCCTGCCTCTCCCTGG + Intergenic
1080558416 11:33438568-33438590 GCCTGCATCCTTGCTCTCCTTGG - Intergenic
1081163832 11:39785152-39785174 TCCTGCTTCCTGGCTATGCCTGG - Intergenic
1081649321 11:44813060-44813082 CCCAGCTTCCTCACTCTCCCAGG + Intronic
1081808604 11:45903081-45903103 GCCCCCTGCCTGCCTCTCCGAGG + Exonic
1081911046 11:46700317-46700339 ACCTTCTTCCTGCCTTCCCCAGG - Intronic
1081961410 11:47140503-47140525 GCCTTCACCCCGCCTCTCCCTGG + Intronic
1083203349 11:61132934-61132956 CCCTGCTTCCTGCTTCCCTCCGG - Intronic
1083319227 11:61835020-61835042 GCCTCCTCCCTGCCTCCCCAGGG + Intronic
1083727439 11:64636013-64636035 CCCTGCTTCCGCCCTCACCCAGG + Intronic
1083729573 11:64645456-64645478 GCCTGTCTCCTGCCTCTCCCAGG - Intronic
1083736548 11:64684925-64684947 GCTTGCTTTCTGCCTCCCCTTGG - Intronic
1083742444 11:64718035-64718057 GCCAGCTCACTGCCCCTCCCTGG - Intronic
1083747391 11:64743650-64743672 GCCCTCTTCCTCCCTATCCCCGG + Intronic
1083798446 11:65032293-65032315 CCCTCCTTCCTCCCTGTCCCTGG + Intronic
1084045225 11:66564308-66564330 GCGTGCTTCCTCCCTGCCCCAGG - Intronic
1084147699 11:67273808-67273830 TCCTGCTTCCTGCTGTTCCCAGG + Intronic
1084660637 11:70544541-70544563 CCCTGCTGAGTGCCTCTCCCTGG - Intronic
1085175230 11:74480565-74480587 ACCCACTTCCTGCCTCCCCCTGG - Intergenic
1085289597 11:75388434-75388456 ACCTGGTTCCTGTCCCTCCCTGG + Intergenic
1085302044 11:75464470-75464492 GCCTGCTCCGTGCCTCGCCCTGG + Intronic
1086527967 11:87751272-87751294 GCCATCTTCCTTCCTCTGCCAGG - Intergenic
1086937074 11:92756861-92756883 TCCTGCCTCCTGGCTCTGCCTGG + Intronic
1087199586 11:95332274-95332296 GCCACCTACCTGCCTCTCCTGGG + Intergenic
1087818470 11:102685002-102685024 GCCTGCTTCCAGCTTCTGGCTGG + Intergenic
1089295626 11:117465521-117465543 GACAGCTCCCTGCCTCTCTCTGG + Intronic
1089386771 11:118073670-118073692 GCCGGGTGCCTGCCTGTCCCTGG + Intergenic
1089738295 11:120564556-120564578 GGCGGCTCCCGGCCTCTCCCTGG + Intronic
1089760222 11:120717661-120717683 TCCTGCTTCCTGCATCACCAAGG + Intronic
1089804155 11:121068162-121068184 GCCTGCTTGATGCCTCTGCCTGG + Intronic
1090499476 11:127247476-127247498 GCCTCCTTCCTGAGTCCCCCAGG - Intergenic
1090838680 11:130471887-130471909 GACAGCTGCCAGCCTCTCCCTGG + Intronic
1091007606 11:131967556-131967578 GCCTGCTCCTTGCTCCTCCCTGG - Intronic
1091347451 11:134864720-134864742 GCCTGCTGCGTGGCTCTCCACGG + Intergenic
1091370862 11:135056710-135056732 CCCTGCTTCCTGCCACGCCCTGG + Intergenic
1091400169 12:176481-176503 TCATGCTCACTGCCTCTCCCAGG - Exonic
1091448627 12:559232-559254 GCCTCCTTCCTTCCTCCTCCTGG + Intronic
1091685788 12:2561209-2561231 GTATGGTTCCTGCCTCTCCGCGG - Intronic
1091712706 12:2753146-2753168 GCCTGCGCCCTGCCTGCCCCTGG + Intergenic
1091743227 12:2974696-2974718 GCCTGGCTCCTCCTTCTCCCAGG + Intronic
1091826092 12:3514026-3514048 CCCTGCCCCCTGCCTCTGCCCGG - Intronic
1092168845 12:6360694-6360716 GCCATCTCCCTGCCTCTGCCTGG - Intronic
1093856808 12:24114222-24114244 CCCTGCATTCTGCTTCTCCCAGG - Intergenic
1094006078 12:25752945-25752967 GCCTGACTCTTCCCTCTCCCAGG - Intergenic
1095367639 12:41427111-41427133 GGCTGTTTTCTGCTTCTCCCTGG + Intronic
1095905925 12:47377916-47377938 GCTTGTTCCCTGGCTCTCCCTGG - Intergenic
1096578808 12:52571303-52571325 GCCTCCTTCCCGACTCTTCCAGG - Intronic
1097013052 12:55966762-55966784 CCCTGCTTCCCGCGTTTCCCTGG - Exonic
1097029677 12:56081659-56081681 GCCTGCCTCCTGCCTCCCCAGGG - Intronic
1097050771 12:56221839-56221861 GCCGGGTCCCAGCCTCTCCCGGG + Exonic
1097058702 12:56266854-56266876 CCTTCCTTCCTTCCTCTCCCAGG + Exonic
1098105870 12:67068975-67068997 GCCCGGTGCCTCCCTCTCCCCGG - Intergenic
1098309711 12:69136226-69136248 CCAACCTTCCTGCCTCTCCCAGG - Intergenic
1099890186 12:88580547-88580569 GCCTGCTTCTCGCCTACCCCGGG - Intronic
1100515292 12:95321712-95321734 CCCTGGCTCCCGCCTCTCCCAGG + Intergenic
1101967373 12:109290861-109290883 GCCTGCTACCTGCCAGGCCCTGG + Intronic
1102097286 12:110250593-110250615 GCCGTCTCCCTGCATCTCCCTGG + Intergenic
1102256922 12:111421013-111421035 GGCTCCTTCATGCCTCCCCCAGG + Intronic
1102304205 12:111792327-111792349 GCCTGTCCCCAGCCTCTCCCTGG + Intronic
1102909623 12:116702841-116702863 TCATTATTCCTGCCTCTCCCAGG - Intergenic
1102956212 12:117060768-117060790 CCCTGCTGCCCGACTCTCCCTGG + Intronic
1103395099 12:120601134-120601156 GGCTGCTTCCTGGGTGTCCCGGG + Intergenic
1103845850 12:123901572-123901594 GCCTGCTGCATTCATCTCCCGGG + Intronic
1104248412 12:127065089-127065111 GCCTCCTTCCTCCATCTCCATGG + Intergenic
1104870172 12:131989258-131989280 CCGTGCCTCCTGCCTCTCGCTGG + Intronic
1104916434 12:132267220-132267242 GCCTGCCTCCTTCCCCGCCCTGG - Intronic
1104944853 12:132411011-132411033 TCCTGCTTCCTCCCACCCCCGGG + Intergenic
1105879538 13:24592050-24592072 GTCTGTCTCCTGCCCCTCCCTGG + Intergenic
1106578725 13:30999772-30999794 GCCTTCCACCTGCCTCTCTCGGG - Intergenic
1108115060 13:47118543-47118565 GCCTGCAAACTGCCTCTCTCAGG - Intergenic
1108253594 13:48590204-48590226 GCTTGCTTCCTCTCTCTGCCAGG + Intergenic
1108280729 13:48858777-48858799 CCCTGGTTACTGCCTTTCCCAGG - Intergenic
1108531167 13:51328672-51328694 GCCTCCCTCCTGCATCTCTCAGG - Intergenic
1109299727 13:60578580-60578602 GCCTGCTTCCCAGCTCTCCAGGG - Intergenic
1110391663 13:74981605-74981627 TCCTTCTTCCTGCCTCTGCTTGG + Intergenic
1110710654 13:78647282-78647304 GCCTGTCTCCTGCCTGCCCCGGG + Intronic
1111285898 13:86091462-86091484 GCCTGATTACTACATCTCCCTGG + Intergenic
1111546253 13:89741135-89741157 GCGGGGTTCCTGCCTCTTCCAGG - Intergenic
1112608294 13:100929683-100929705 GCCTGCTTTCAGTCTCTGCCAGG - Intergenic
1112774972 13:102833724-102833746 TCCAGCTTCCTGGTTCTCCCAGG - Intronic
1113440936 13:110327285-110327307 GCTTGCTTCCTGCCCTTCCCGGG + Intronic
1113676188 13:112209458-112209480 TCCGGCCTCCTGCCTCTCCAAGG + Intergenic
1113796193 13:113060100-113060122 GGCTGCCTCCTGGGTCTCCCTGG + Intronic
1113867790 13:113539335-113539357 AGCTGCGTCCTGCCTCTCTCAGG + Exonic
1113921844 13:113917764-113917786 GAGTGTTTCCTGCCTCTCCCCGG + Intergenic
1114537879 14:23434303-23434325 CCCACCTTCCTGCTTCTCCCTGG + Intronic
1117483695 14:56173120-56173142 GCCTCCTCCATGCCTCCCCCCGG + Intronic
1118139039 14:63059625-63059647 GCCTGCTTGATGCCTCTACTTGG - Intronic
1118860056 14:69656001-69656023 CCCTGCCTCCAGCCTCTGCCAGG + Intronic
1119163397 14:72471732-72471754 GCCTGGTACCCGCCTATCCCCGG - Intronic
1119182798 14:72615666-72615688 TCCGGCTTCCTACCTCGCCCTGG + Intergenic
1119471898 14:74905679-74905701 GTCCACGTCCTGCCTCTCCCTGG - Exonic
1119706954 14:76788971-76788993 GCCCCCCTTCTGCCTCTCCCAGG + Exonic
1119800904 14:77444272-77444294 GCATGCTTACTGCCTCTTCTAGG + Exonic
1120869284 14:89322745-89322767 GCCTCCTTCTTGCCTCTTCCTGG - Intronic
1121017356 14:90556769-90556791 CCCTGATGCCTGCATCTCCCTGG - Intronic
1121042296 14:90759064-90759086 GGCAGCTGCCTGCCTCTGCCTGG + Intronic
1121099575 14:91241286-91241308 ACCAGCTTCCTGCCACTCACAGG + Intronic
1121435379 14:93915703-93915725 CTCTGCTTTCTTCCTCTCCCTGG - Intergenic
1121496270 14:94393504-94393526 GCGTGCTTGCTTTCTCTCCCAGG - Intergenic
1121570594 14:94943990-94944012 CCTTGCTCTCTGCCTCTCCCTGG - Intergenic
1122016253 14:98799342-98799364 GAGTTCTTTCTGCCTCTCCCTGG + Intergenic
1122771700 14:104100597-104100619 CCCTTCTTCCTGCTGCTCCCTGG + Intronic
1122785925 14:104163226-104163248 GCCTGCCTCTGGCCTCGCCCAGG + Intronic
1122787509 14:104170808-104170830 TCCTGGGTCCTGCCCCTCCCCGG + Intronic
1122821085 14:104345537-104345559 GTCTGGGTCATGCCTCTCCCTGG - Intergenic
1122997415 14:105272745-105272767 GATTGCTGCCTGCCTCTACCTGG - Exonic
1123105370 14:105838987-105839009 GGCAGCTTCCAGCCTCTCCCAGG + Intergenic
1123447223 15:20340234-20340256 GCCGGCTGGCTGGCTCTCCCAGG - Intergenic
1124031770 15:26018509-26018531 GCCTTGTTCCTGCCCCTCCTAGG + Intergenic
1124049290 15:26180118-26180140 GCCTGCTCCCTGTCTCTCTCAGG - Intergenic
1124237376 15:28002375-28002397 GCCTGCTTCCTTTCTCTGCAGGG + Intronic
1124611765 15:31214405-31214427 CCCGGCTTCATCCCTCTCCCTGG - Intergenic
1124912904 15:33939992-33940014 GCTTGCTTCCTTTCTCTACCAGG + Intronic
1125720360 15:41842345-41842367 GCCTGCTTCCCGCTTCTCCGTGG + Intronic
1126025411 15:44441629-44441651 GCTTGCTTTCTGTCTCTCCTAGG + Intronic
1126581936 15:50250080-50250102 CCCTGTTTTCTGCCTCTCACTGG - Intronic
1127273499 15:57422281-57422303 GTCTGCTTCCTGCCACCCTCAGG + Intronic
1128343243 15:66837202-66837224 CCGTGCCTCCTGCCTTTCCCTGG - Intergenic
1128512943 15:68324957-68324979 GGCTCCTTCCTGCCTCTCTCGGG - Intronic
1128514921 15:68336018-68336040 TCCTGGGTCCTGCCTCTTCCAGG - Intronic
1128541384 15:68536893-68536915 GCCTGCTTCCTGCAGCCACCTGG + Intergenic
1129168543 15:73793755-73793777 GGCTGAATCCTGTCTCTCCCTGG + Intergenic
1129319904 15:74768704-74768726 GACAGATTCCTGCCTCTCCGGGG - Intergenic
1129326392 15:74802302-74802324 GACTGACTCCTGCCTCCCCCTGG + Intronic
1129364730 15:75047377-75047399 TCCTGCTTCCTCCCTGTCCCTGG + Intronic
1129393193 15:75230872-75230894 GCCTCCTCCCTGCCTGTCCAGGG + Intergenic
1129696140 15:77741562-77741584 GCCTGCGGCCTGCCCCTCCTGGG - Intronic
1130025057 15:80263709-80263731 GCCTGGTCCTTGCTTCTCCCTGG + Intergenic
1130154987 15:81342806-81342828 CCCTACTTCCTGCCTCCCCAAGG + Intronic
1130252383 15:82307945-82307967 CCCTTCTTCCTGCCTCTCACTGG - Intergenic
1130311063 15:82754807-82754829 GCCTTATTCCTCCCCCTCCCAGG - Intergenic
1131019807 15:89088503-89088525 GTCTGGTTCCTGCAGCTCCCCGG - Exonic
1131441624 15:92463986-92464008 GCCTGCCTTCTGCCACTCCAGGG - Intronic
1131560392 15:93434651-93434673 TCCTGCTTCTAGCCTCTCCCTGG - Intergenic
1131748788 15:95482459-95482481 ACCCTCCTCCTGCCTCTCCCGGG + Intergenic
1132144022 15:99416276-99416298 GGCTGCTTCCAGGCTCTCTCTGG + Intergenic
1132617313 16:848039-848061 GCCTGCTTGCTGCCTCCTGCTGG + Intergenic
1132982476 16:2745558-2745580 CCCTACTTCCTGCCCCTGCCTGG + Intergenic
1133087312 16:3374968-3374990 GACTGCTGTCTGCCTCTCTCTGG - Intronic
1133129178 16:3665693-3665715 GCCCTCTTCCTGCCACTCCCTGG + Intronic
1133255796 16:4514845-4514867 GTCTGCTTCCTCCCTCCCCCAGG + Exonic
1133751081 16:8725978-8726000 GCATGCTCCCTGCCCCTCCCTGG + Intronic
1134036618 16:11036193-11036215 GCCCGCTAGCTGCCTCTCCTGGG + Intronic
1134237017 16:12474459-12474481 GCCCACGCCCTGCCTCTCCCCGG - Intronic
1134861736 16:17566262-17566284 GCCTGCTTCCTGCCTCAACCTGG + Intergenic
1134914861 16:18060937-18060959 ACCTGCTTCCTGGCGGTCCCAGG + Intergenic
1135326751 16:21530968-21530990 TCCTGCCTCCAGCCTCTGCCTGG + Intergenic
1136235496 16:28911194-28911216 GCCTTCAGCCTGCATCTCCCAGG + Intronic
1136337006 16:29616382-29616404 TCCTGCCTCCAGCCTCTGCCTGG + Intergenic
1136551696 16:30985510-30985532 GCCTGGTTGCTGCAGCTCCCAGG + Intronic
1137270144 16:46897869-46897891 GCCTCCTTCCTGCCTTTCTGAGG + Intronic
1137507580 16:49067875-49067897 GCCTGCTTTCTGAGTGTCCCTGG - Intergenic
1138229892 16:55329126-55329148 GACAGCCTCCTGCCTCTGCCCGG + Exonic
1138525110 16:57600655-57600677 GCCCGCTTCCTGCCTCTGCCAGG + Intergenic
1138561314 16:57802373-57802395 GCCTGGATCCTGCCTCCGCCAGG - Exonic
1139349946 16:66328616-66328638 GCCAGCTTCATGCCCCACCCTGG - Intergenic
1139761641 16:69188395-69188417 GCCAGCTTCCTACCACTCACAGG + Intronic
1139949766 16:70663213-70663235 GCCTTCTCTCTGCCTCTCCCAGG - Exonic
1139955385 16:70690686-70690708 GCCAGCTGTCTGCCCCTCCCAGG + Intronic
1139956839 16:70697291-70697313 GCCTGCTCCTTGCCCCTACCCGG + Intronic
1139990338 16:70935109-70935131 GACTGATCCCTGCCTCTCCCCGG - Intronic
1141046352 16:80719267-80719289 TCCTGCTCCCAGCCTCTTCCGGG - Intronic
1141129392 16:81425053-81425075 ACCTCCTTCCTGTCTGTCCCTGG - Intergenic
1141414774 16:83862045-83862067 GACTGCGGCCTGCATCTCCCAGG + Intergenic
1141425084 16:83939622-83939644 TCCTGTTTCCTTCCTCTGCCGGG - Intronic
1141509691 16:84504488-84504510 GCCTGGGCCCTGCCCCTCCCTGG - Intronic
1141647985 16:85377713-85377735 GCCTGGTGCCGGCCACTCCCGGG - Intergenic
1141656319 16:85418552-85418574 GCAGCCTTCCTGCCCCTCCCAGG + Intergenic
1141679313 16:85535168-85535190 GCCTTCCTCATGCCTCCCCCAGG - Intergenic
1141692365 16:85603454-85603476 CCCTGCATCTGGCCTCTCCCAGG + Intergenic
1141953396 16:87353672-87353694 GCCTCCTTCCCGCCTCTCACAGG - Intronic
1141953418 16:87353758-87353780 GCCTCCTTCCCGCCTCTCACAGG - Intronic
1141954194 16:87359301-87359323 GCCTCCTGCCTGCCTATGCCCGG + Intronic
1142039802 16:87885718-87885740 TCCTGCCTCCAGCCTCTGCCTGG + Exonic
1142085164 16:88176060-88176082 ACCTGCTTCCTGCCACCCCAGGG + Intergenic
1142352322 16:89586010-89586032 CCCTGCTAACTGCCCCTCCCTGG - Intronic
1142435170 16:90052234-90052256 TTGAGCTTCCTGCCTCTCCCTGG + Intergenic
1142492970 17:290431-290453 GGCTCCTGCCTGCCTCCCCCGGG + Intronic
1142536941 17:624690-624712 GCATACGTCCAGCCTCTCCCAGG + Intronic
1142559706 17:802814-802836 GCCTCCTCCGTGCCTCTCCTGGG + Intronic
1142640569 17:1283361-1283383 GATGGCTTCCTGCCTCCCCCGGG - Intronic
1142805037 17:2367086-2367108 GCCTCCTTCCACACTCTCCCAGG + Intronic
1142852121 17:2709368-2709390 GCCTCCTTCCTGTCCCACCCAGG + Intronic
1142955515 17:3518935-3518957 GCCTGCTGCCTCCTTCTCTCTGG + Intronic
1143164864 17:4892703-4892725 GCGTCCTTCCAGCCTCTCACGGG + Exonic
1143563881 17:7709932-7709954 GCCTTCTTTCTGCCTCTCACTGG + Exonic
1143622604 17:8089438-8089460 GCCTGCCTCCTCACTCTCCCTGG - Intergenic
1143711553 17:8739389-8739411 ATCTGCTTCCTGCCACCCCCAGG - Intronic
1143733850 17:8896797-8896819 GGTTGCTCCCTGCCTCCCCCAGG - Intronic
1143762656 17:9116264-9116286 GGCTGCTTCCTGACCCTCCCGGG - Intronic
1143863578 17:9908337-9908359 GGCTGCCTTCTGCCTCGCCCAGG - Intergenic
1144580946 17:16459132-16459154 GCCTGCTTCCTGCCTGGTGCAGG + Intronic
1145934282 17:28705851-28705873 GCCTGCTCCCTCCCTCCCCTAGG - Intronic
1146360463 17:32171701-32171723 GCCTTCTGCCTGACACTCCCTGG + Intronic
1146948438 17:36889942-36889964 TCCTCCTCCCTGCCTGTCCCAGG + Intergenic
1147248671 17:39139491-39139513 CCCTGCTTCCATCCCCTCCCCGG + Intronic
1147449655 17:40496175-40496197 ACCTGCTTCCTGCCGTCCCCTGG - Exonic
1147566649 17:41540529-41540551 GCCTGCCTCCTGCCTTTGTCAGG - Intergenic
1148180522 17:45601669-45601691 GCCTCCTGCCTGCCTCTCCAAGG - Intergenic
1148268377 17:46244225-46244247 GCCTCCTGCCTGCCTCTCCAAGG + Intergenic
1148567790 17:48643904-48643926 TCTTGCTTCCTTCCCCTCCCAGG - Intergenic
1148577926 17:48724501-48724523 GCCTTCTTCCTGGGTCTCTCGGG + Exonic
1148617706 17:49013506-49013528 CCCCACTTCCAGCCTCTCCCTGG + Intronic
1148690386 17:49523841-49523863 GCCTGCCTCACGCCTCTCCAGGG + Intergenic
1148740898 17:49891616-49891638 GCCAGTTTCCTGCCTCTCATTGG - Intergenic
1148759377 17:49991547-49991569 CCCTGCACCATGCCTCTCCCGGG - Exonic
1149287224 17:55177983-55178005 GTGTGCGTCCTCCCTCTCCCTGG + Intergenic
1149359793 17:55883240-55883262 GGCAGCTTCCTACATCTCCCAGG + Intergenic
1149461833 17:56834704-56834726 GCCCCCTTCCTGCCTTTCCGGGG - Intronic
1149609366 17:57948985-57949007 GCCCAGTTCCTGCCTCACCCTGG + Intronic
1149623803 17:58065382-58065404 GGCCTCTTCCTGCCTCTGCCAGG - Intergenic
1149661528 17:58336641-58336663 GGCTGCCTTCTGCCTCTCTCTGG - Intergenic
1150208227 17:63425778-63425800 ACCTTCTTCCAGCCTCTGCCTGG - Exonic
1150388771 17:64779492-64779514 GCCCATTTCCTGCCGCTCCCCGG + Intergenic
1150482936 17:65524508-65524530 GCGTGTTTCCCGCCTCTCCAGGG - Intergenic
1151376766 17:73694617-73694639 GCCTGCTTCCCGCCTGTCCTGGG + Intergenic
1151497376 17:74466911-74466933 CCCTGGCTCCTTCCTCTCCCAGG - Intronic
1151564874 17:74892495-74892517 GCCTGCATCCTCCTTCTCCCAGG + Intronic
1151681943 17:75626985-75627007 GCCAGCTTCCAGCCTTGCCCAGG - Exonic
1151791064 17:76306358-76306380 CTCTTCTTCCTGCCTCTTCCCGG + Intronic
1151953010 17:77365659-77365681 TCCTGCTCCCTGCCCTTCCCGGG + Intronic
1151962876 17:77416488-77416510 GCCTGCTGCCGGCATGTCCCTGG - Intronic
1151983830 17:77529360-77529382 GCCTCCTGCCTGCATCCCCCTGG + Intergenic
1152097275 17:78279305-78279327 GGCTTCTCCCTTCCTCTCCCTGG - Intergenic
1152120362 17:78414686-78414708 CCCTGCTTCCTGCCGCGCCGGGG + Intronic
1152322987 17:79618860-79618882 TCCTGCTCCCCGTCTCTCCCAGG - Intergenic
1152381655 17:79945349-79945371 GCCAGCGTCCTGCCACGCCCGGG - Intronic
1152471967 17:80494533-80494555 GCCTGCTTTCAGGCTCTCCTTGG + Intergenic
1152484160 17:80578845-80578867 TCCTGCTTCCTTCTGCTCCCAGG - Intronic
1152508370 17:80768563-80768585 GCCTCACTCCTGCCTGTCCCAGG + Intronic
1152550373 17:81026819-81026841 GCGTGCTTCCTGCATGTCACTGG + Intergenic
1152555314 17:81050063-81050085 TCCGGGTTCCTCCCTCTCCCAGG - Intronic
1152613962 17:81329532-81329554 GGCAGCTTCCCTCCTCTCCCAGG + Intronic
1152739409 17:82012475-82012497 CTCTGCTTCCTGCCTGGCCCCGG + Intronic
1152835622 17:82528903-82528925 GTCTGCCTCCTTCCCCTCCCTGG + Intronic
1153834991 18:8955723-8955745 GGCTGCTTCCTGGCCATCCCTGG - Intergenic
1154471430 18:14706195-14706217 ATCTGCTTTTTGCCTCTCCCAGG + Intergenic
1154480403 18:14817405-14817427 CCCTGCTTCCTTCCTCTGCATGG + Intronic
1155528379 18:26740933-26740955 GCCTGCTCCCTGTCTCTCTATGG + Intergenic
1156287951 18:35717482-35717504 ATCTGCTTCATGCCTCTCCTAGG - Intergenic
1156480967 18:37436134-37436156 GGCTGGTTCCTGCCGCTCCCTGG - Intronic
1156490222 18:37491686-37491708 CCACGCTGCCTGCCTCTCCCTGG - Intronic
1156528464 18:37791674-37791696 TTCTGCTTCCTTCATCTCCCAGG - Intergenic
1157056464 18:44234817-44234839 GCCTGCTGTCTGCCTCTTCTGGG + Intergenic
1157195804 18:45619332-45619354 GCCTGCTCACTGCTTCTCCTGGG + Intronic
1157482553 18:48064806-48064828 GCCTGCATCCTACTCCTCCCGGG - Intronic
1157571131 18:48713130-48713152 GCCTCCTTCTTCCCTCTACCAGG - Intronic
1157762131 18:50272955-50272977 GCCTGTTTCCTACTTCTCCCAGG - Exonic
1158656483 18:59339955-59339977 GCCTGTTTCCTGTCTCTCCTTGG - Intronic
1158677940 18:59539246-59539268 GCCATCTTGCTGGCTCTCCCTGG + Intronic
1159356426 18:67342378-67342400 GCCTTCTTATTTCCTCTCCCAGG - Intergenic
1160222205 18:76985591-76985613 GCCTGCCTCCTCCCTCTGTCCGG - Intronic
1160369791 18:78362537-78362559 GCAGGCCTCCTGCCTCCCCCAGG + Intergenic
1160566158 18:79787970-79787992 GCCTGCGTCCCGCCTCCCCCGGG - Intergenic
1160856416 19:1219964-1219986 GCCTGCTTCCAGCCCATCGCTGG + Intronic
1160874590 19:1291149-1291171 CCCACCTTCCTGCCCCTCCCAGG - Intronic
1160959853 19:1715664-1715686 CCCTCCTCCCTGCCTCCCCCAGG + Intergenic
1160963475 19:1735088-1735110 GCCACCTGCCTGCCCCTCCCCGG - Intergenic
1160972307 19:1775073-1775095 GTGCGCCTCCTGCCTCTCCCCGG + Intronic
1161071148 19:2261807-2261829 GCCAACTTCCTGCCTCTGCCAGG + Intronic
1161209971 19:3061414-3061436 TCCTGCCCCCCGCCTCTCCCGGG + Intronic
1161267982 19:3373813-3373835 GCCTGCTGCATGCCGGTCCCAGG - Intronic
1161399453 19:4060886-4060908 GCCTCCTTCCCTGCTCTCCCTGG - Intronic
1161448440 19:4330628-4330650 CCCTGTTTCCTACCTCACCCTGG - Intronic
1161458180 19:4380400-4380422 ACCTCCTTCCTGCCTCACCCTGG - Intronic
1162460520 19:10811545-10811567 GTGTGCTTCCTGCAGCTCCCAGG + Intronic
1162525422 19:11203654-11203676 CCCAGCTTCCAGCCTCCCCCAGG - Intronic
1162747425 19:12806565-12806587 GCCTGCTTCCGGCCAATCCGCGG - Exonic
1162866021 19:13547680-13547702 GCCTGCTTCCAGCCCCTCAAGGG - Intronic
1162958334 19:14112233-14112255 CTCTGCTTCCTGTCTCTTCCAGG + Intronic
1162988678 19:14288380-14288402 ACCTGTCTTCTGCCTCTCCCTGG - Intergenic
1163256930 19:16161573-16161595 GCATCCTTCCTGCCTGTCCCAGG - Intronic
1163332615 19:16650632-16650654 CACTGCATCCTGCATCTCCCAGG - Intronic
1163535232 19:17872857-17872879 TCCTCCTTCCTGCCCCTCGCCGG - Intronic
1163554001 19:17982456-17982478 GCCTGCTGCCTGCGCCCCCCGGG - Intronic
1163639945 19:18456501-18456523 TCCTCCTTCCTGCTCCTCCCTGG - Intronic
1163765793 19:19162637-19162659 CCCTCCTTCCCACCTCTCCCTGG + Intronic
1163849251 19:19654227-19654249 ACCTCCCTCCTGCCTCCCCCAGG + Intronic
1164434647 19:28218971-28218993 GGCTCCTCCCCGCCTCTCCCAGG + Intergenic
1164459864 19:28437505-28437527 TCCTCCTTCCTACTTCTCCCAGG - Intergenic
1164549442 19:29196909-29196931 GCCTGCCTCCTGCCCCTGCCCGG - Intergenic
1164609096 19:29620286-29620308 TCCTGCTCCCGGCCTGTCCCAGG - Intergenic
1164681055 19:30133996-30134018 GCCTGGTTCCTGCCTGCCACAGG - Intergenic
1164760258 19:30723121-30723143 TCCTGGTTCCTGCCTCCGCCTGG - Intergenic
1164866819 19:31611322-31611344 CCCTGGTTCCTCTCTCTCCCTGG - Intergenic
1164951130 19:32338175-32338197 GCCTGCTGCCTGTCTCTGCCTGG + Intergenic
1165266097 19:34664749-34664771 CCCTGCTGCCTCCCTTTCCCTGG + Intronic
1165742152 19:38210863-38210885 GCCTGCACCCTGCCTCTCCCCGG - Intergenic
1165826142 19:38706926-38706948 GCCTGCCTCTTGCCGCCCCCTGG - Intronic
1166099094 19:40560421-40560443 TCGGGCTTCCTGCCTCCCCCTGG + Intronic
1166169402 19:41016939-41016961 GCCAGCTTCCTTCCCCTCCATGG + Exonic
1166220938 19:41364052-41364074 GCCTGGCTCGCGCCTCTCCCAGG + Exonic
1166672395 19:44718812-44718834 GCAGGCTTCCTTCCTCTCCCTGG - Intergenic
1166980801 19:46630999-46631021 TGCTGCTTCCTGCCACCCCCAGG - Intergenic
1167108188 19:47443290-47443312 GGCTGTTTCCTGCCACCCCCTGG - Intronic
1167315078 19:48758074-48758096 GCTCGCTTCCTGCCACTACCAGG + Exonic
1167359208 19:49020912-49020934 GGCTGCTTCCTCCCTCTACCAGG + Intergenic
1167366902 19:49059159-49059181 GGCTGCTTCCTCCCTCTGCCAGG + Intronic
1167502000 19:49853831-49853853 ATCTCCTTCCTGCCTCCCCCCGG + Intronic
1167648221 19:50717066-50717088 GCCTCCTTCCTGCCTATCTTGGG - Intronic
1167818945 19:51908645-51908667 ATCTGCCTCCTGCCTGTCCCTGG - Intronic
1167853068 19:52216507-52216529 GCCTGCCTCTTCTCTCTCCCAGG + Exonic
1168145776 19:54419384-54419406 GTCTGCTTCCTCCATGTCCCCGG - Intronic
1168296513 19:55379598-55379620 TCCCCCTTTCTGCCTCTCCCTGG - Intronic
1168686527 19:58352526-58352548 GCCTGCTCCCTGGCTCTCGATGG - Exonic
1168708381 19:58482601-58482623 GCAGGGTTCCTGCCCCTCCCAGG - Intronic
925070258 2:960914-960936 TCCTGCTCCCTGCCACTCCAGGG + Intronic
925147986 2:1593850-1593872 GCCAGGTTGCTGCCCCTCCCTGG + Intergenic
925280969 2:2684195-2684217 GTCCTCTTCCTCCCTCTCCCTGG + Intergenic
925310063 2:2875744-2875766 CACTCCTTCCTGCCTCTGCCGGG - Intergenic
925362486 2:3289186-3289208 GCCTGCTTCCTGGACCTCTCAGG + Intronic
925767173 2:7247297-7247319 CCCTTCTTCCTGCCTCTCTCAGG + Intergenic
925957050 2:8977038-8977060 GTCTCCCTCCTGCCTCTCCCTGG - Intronic
926012031 2:9416144-9416166 TCCAGCTTCCTGCCTGTGCCTGG + Intronic
926131215 2:10304033-10304055 GCGTGTTTTGTGCCTCTCCCTGG + Intronic
926219673 2:10926293-10926315 GCCTGCTTAGAGCCTCCCCCAGG + Intergenic
926312309 2:11683612-11683634 CCCTGCCTCCTGCCTCCTCCTGG + Intronic
926577397 2:14597082-14597104 TCCTGCTTCCTGACTCTGCTGGG + Intergenic
927192576 2:20526889-20526911 CCCTGCCCCCTGCCTCTCCTTGG + Intergenic
927496597 2:23555463-23555485 CCCTCATTCCTGCCTCTCCCAGG + Intronic
927521046 2:23698287-23698309 GCCTGCATCCTGCCCCTGCAAGG - Intronic
927673982 2:25091224-25091246 GTCTGTTTCCTGCCACTCACAGG + Intronic
927830552 2:26346317-26346339 CCCTGCTCCCGGCCTCGCCCAGG + Intronic
927882330 2:26697568-26697590 GCCTGCTGCTTGCCACACCCTGG + Intronic
927936332 2:27078759-27078781 GCCTGGTCCCTGCCCCTCTCAGG - Exonic
928394512 2:30933239-30933261 GGCTGCTTCCTGCATCCCACTGG + Intronic
929452420 2:42046792-42046814 GGCAGCTTCCTGCCTCCCTCTGG - Intergenic
929992379 2:46801091-46801113 GAGTTCTTCCTGCCTCTCCCCGG + Intergenic
932025745 2:68130765-68130787 GCCAGCCTCCAGCCTCTCTCGGG - Exonic
932397176 2:71456134-71456156 GCCTGCTGCCTGGCTCTTCGGGG + Intronic
934954018 2:98601672-98601694 GCCTGCTTCCTGCCAGGCCATGG - Intronic
936077281 2:109409634-109409656 GCGTGGCTGCTGCCTCTCCCAGG + Intronic
937052245 2:118901991-118902013 GCCTCATCCCTGCCCCTCCCAGG + Intergenic
937116891 2:119413013-119413035 CCATGCCTCCTGCCTCTGCCTGG + Intergenic
937363077 2:121242534-121242556 TCCTGCTTCCCACCTCACCCAGG + Intronic
938013397 2:127847282-127847304 GCGTGCTTCTTCCGTCTCCCAGG + Exonic
938013960 2:127851864-127851886 GACTGCTACCTCCCTCTCCCGGG + Intronic
938289498 2:130141876-130141898 GCCTGCTTGCTGCCCCACCCTGG + Intronic
938405479 2:131030675-131030697 CCCTTCTTACTGCCTCTCTCAGG - Intronic
938467032 2:131531062-131531084 GCCTGCTTGCTGCCCCGCCCTGG - Intronic
939574106 2:143875224-143875246 GCCTGCTTCCAGTCTGTCCCAGG + Intergenic
941911738 2:170770935-170770957 GCCTCCACCCTGCCTCTCCGTGG + Intergenic
942944300 2:181656712-181656734 CCGCGCTTCCTCCCTCTCCCCGG - Intronic
943792161 2:191945364-191945386 GCCTCCTTCCAGCCTCACCGTGG - Intergenic
943910537 2:193560952-193560974 GTCTGCTTCCTGACTGACCCTGG - Intergenic
944869694 2:203897457-203897479 GCCTCCTTCCTGCCTCTGATTGG + Intergenic
946103040 2:217343490-217343512 CCCTTCTCCCTGCCCCTCCCTGG + Intronic
946155829 2:217806084-217806106 GCATGCTTCCTCCCTCTGCCAGG - Intronic
946157514 2:217816753-217816775 GCCTGTTTCCTGCCGCCCACCGG - Intronic
946201324 2:218072504-218072526 GCCTTCTTGCTGCCTGGCCCTGG - Intronic
947025990 2:225738504-225738526 TCCTGCTCCCTGCCTGTCCACGG + Intergenic
947634601 2:231673555-231673577 TCCCACTTCCTGCCTCTCACCGG + Intergenic
948034818 2:234849649-234849671 GCCTGGTTCCTGCCTCTGTGAGG - Intergenic
948225744 2:236308130-236308152 GACTGGTTCCACCCTCTCCCAGG - Intergenic
948892428 2:240914008-240914030 GGCTGCTGCCTTTCTCTCCCGGG - Intergenic
948935135 2:241158978-241159000 GCCTGCCTCCTGCCTCCCTTTGG + Intronic
948947382 2:241227861-241227883 GCCCTTTTCCTGCCTTTCCCGGG - Exonic
1168959261 20:1857582-1857604 GCCTCCTTAATGCCCCTCCCTGG + Intergenic
1169198741 20:3697411-3697433 GCCTCCTTCCTGCTCCTTCCAGG - Intronic
1169204059 20:3730329-3730351 ACCAGCTTCCTGCATCTCCCTGG - Intergenic
1169421800 20:5466433-5466455 GCCAGCTTCCTCACTCACCCTGG - Intergenic
1169450990 20:5710821-5710843 GCCTGCTACCTGCTTATTCCTGG - Intergenic
1170692896 20:18631190-18631212 GGCTGAGTCCAGCCTCTCCCTGG + Intronic
1170784321 20:19454195-19454217 GCCTGCTTCCTGCCCATCTAAGG + Intronic
1171248895 20:23634171-23634193 GACTGCTCCATCCCTCTCCCAGG + Intronic
1171336276 20:24388555-24388577 GCTTGCTGCCTGACTCTCCAGGG - Intergenic
1171438544 20:25142615-25142637 GCCTGCTGGCTGCCTCAACCAGG + Intergenic
1172172400 20:32946284-32946306 ACCAGCTTCCAGCTTCTCCCTGG - Intronic
1172215130 20:33230365-33230387 GCCTTCCTCCTGACTCTTCCTGG + Intergenic
1172230612 20:33333354-33333376 GCCTCCATCCTGCTGCTCCCAGG - Intergenic
1172290158 20:33770299-33770321 GCCTCCTGCTTCCCTCTCCCTGG + Intronic
1172291358 20:33779524-33779546 CACTGCATCCTGCATCTCCCAGG + Intronic
1172591517 20:36121486-36121508 GGCTGGTTCTTGCCTCTCTCTGG + Intronic
1172846767 20:37934297-37934319 GTCTCCTGTCTGCCTCTCCCAGG - Intronic
1173522679 20:43711372-43711394 GCCTCCTTCCTGCCTTACCCAGG + Intronic
1174322510 20:49753071-49753093 TCTTTCTTGCTGCCTCTCCCTGG - Intergenic
1174544745 20:51316997-51317019 CTCTGCTTCCAGGCTCTCCCAGG + Intergenic
1174565705 20:51463144-51463166 CCCTGCTCACAGCCTCTCCCGGG - Intronic
1175137267 20:56833606-56833628 GCCTTCTGCCTGCCTCTCTCAGG + Intergenic
1175479231 20:59300054-59300076 GCTGGCTCCCTACCTCTCCCAGG - Intergenic
1175769004 20:61611202-61611224 GCCCCTTTCCTTCCTCTCCCTGG + Intronic
1175826332 20:61938461-61938483 GTCAGCTTTCTGTCTCTCCCAGG + Exonic
1175852642 20:62101978-62102000 GCCTGGGCTCTGCCTCTCCCTGG + Intergenic
1175921075 20:62450908-62450930 GCCCTCTTCCTTCCTCCCCCAGG + Intergenic
1175927825 20:62479731-62479753 GCCTGCTGCATGCCCATCCCGGG - Intergenic
1175973610 20:62699348-62699370 GCCTGCTTCCTGGCTCACGGAGG - Intergenic
1176024427 20:62978563-62978585 TCCTCCTTCCTTCCTCCCCCAGG + Intergenic
1176029053 20:63002044-63002066 GCCTGCTTCCTTGCTCCCCAGGG - Intergenic
1176088238 20:63307664-63307686 GCCCGCCTCCTGCCCCACCCGGG + Intronic
1176371651 21:6065986-6066008 TTCTGCTGCCCGCCTCTCCCTGG + Intergenic
1176407688 21:6430380-6430402 AAATGTTTCCTGCCTCTCCCCGG + Intergenic
1176800145 21:13418848-13418870 CCCTGCTTCCTTCCTCTGCATGG - Intergenic
1176803054 21:13451740-13451762 ATCTGCTTTTTGCCTCTCCCAGG - Intergenic
1177800100 21:25820269-25820291 GCCTGCAACCTCCATCTCCCGGG + Intergenic
1178398135 21:32260584-32260606 ACCTTCCTCCTGCTTCTCCCGGG - Intergenic
1178748145 21:35273586-35273608 CTCAGCTTCCAGCCTCTCCCAGG + Intronic
1178876515 21:36418524-36418546 GCCTGCTTCCTGGCCATACCTGG + Exonic
1179113993 21:38472996-38473018 GCCTGCTGCCTGCCTCATGCCGG - Intronic
1179185943 21:39085335-39085357 GCCTGCTGTCTCCTTCTCCCAGG + Intergenic
1179238540 21:39568347-39568369 GCCTGCTTCCTGGCCTTCCGTGG + Intronic
1179494132 21:41761022-41761044 GGCTGCTTCCTCCCTCTCCAGGG + Intronic
1179654514 21:42837132-42837154 GCCTCCTCCATGCCTCACCCTGG - Intergenic
1179683178 21:43038711-43038733 AAATGTTTCCTGCCTCTCCCCGG + Intergenic
1179751868 21:43472553-43472575 TTCTGCTGCCCGCCTCTCCCTGG - Intergenic
1179766089 21:43574137-43574159 GCCAGCATCCTGCCTTCCCCTGG + Intronic
1179766217 21:43574945-43574967 CTCTGCTTCCTTCCACTCCCAGG + Intronic
1179786527 21:43733458-43733480 GCCTCCTTCCTGTATCTCCCAGG - Intronic
1179896509 21:44366382-44366404 GCCTGGGCCCTGCCTCCCCCGGG - Intronic
1179902105 21:44399700-44399722 GGCTTCTGCCTGCCGCTCCCAGG - Intronic
1180006051 21:45021191-45021213 GCCACCTTCCTGCTACTCCCAGG - Intergenic
1180122586 21:45763806-45763828 GCCCCCTTCCTCTCTCTCCCCGG + Intronic
1180168013 21:46040116-46040138 TCCTCCCTCCAGCCTCTCCCAGG + Intergenic
1180752035 22:18131227-18131249 GCCTGATTCCTGCCTTACCCAGG + Exonic
1180947412 22:19704124-19704146 TCCTCCTTCCTGCCCCACCCCGG - Intergenic
1180990117 22:19930634-19930656 GCCTGCTCTCTGCCCCTGCCCGG - Intronic
1181055281 22:20258034-20258056 GCCTGCACCTGGCCTCTCCCTGG + Intronic
1181055895 22:20260358-20260380 GCTTCCCTCCTGGCTCTCCCTGG - Intronic
1181435772 22:22909972-22909994 GCTTGCTTCCAACTTCTCCCTGG + Intergenic
1181647893 22:24243646-24243668 TCCTGCTCCCTGCCTCCCACTGG - Intronic
1181935840 22:26437804-26437826 CCCTCCTTCCTGCCTCTTTCAGG + Intronic
1182044889 22:27266709-27266731 CCCTGCTACCTCCATCTCCCAGG + Intergenic
1182085141 22:27556161-27556183 CTCTGCTCCCTGCTTCTCCCCGG - Intergenic
1182394019 22:30022312-30022334 GCCAGCTTGCTGAGTCTCCCTGG - Intronic
1182431756 22:30302935-30302957 ACCTGCTTCCTGCCTGACTCTGG - Intronic
1182554094 22:31119666-31119688 TCCTCCTTCCTTTCTCTCCCTGG - Intronic
1182695646 22:32197934-32197956 GCTTGCTTCCAACTTCTCCCTGG + Intronic
1183190216 22:36317662-36317684 GACCGCTTTCTGCCTCTCTCCGG - Intronic
1183357330 22:37366758-37366780 CTCTGCTTCCTGCCAGTCCCAGG - Intergenic
1183591686 22:38782803-38782825 GCCTGCTTCCTGAATCTCCTGGG - Exonic
1183734635 22:39637022-39637044 GCAAGCATCCAGCCTCTCCCTGG + Intronic
1183951117 22:41353677-41353699 CCCTGCTCCCTGCCACACCCTGG - Intronic
1183978398 22:41526178-41526200 GCCTGCTGCCTGCCTCTGGAGGG + Exonic
1183987001 22:41575501-41575523 CCCCTCTTCCTGCCTCTCCATGG - Exonic
1184416165 22:44352955-44352977 GCCTTCTTCCTGCCTGCCCCGGG + Intergenic
1184423896 22:44397716-44397738 GCCTGCGTCTTGCTCCTCCCAGG - Intergenic
1184782801 22:46657550-46657572 CCCTGCCTCCTCCCTCTGCCTGG + Intronic
1185107501 22:48882708-48882730 GCCACCATCCTGCCTCCCCCAGG - Intergenic
1185161530 22:49232854-49232876 CCCTGCTTCCTGCTCCTCCTGGG + Intergenic
949895235 3:8763394-8763416 TTCTCCTTCCAGCCTCTCCCTGG - Intronic
950123866 3:10499709-10499731 GCCTGTCTCCAGCCTCTCTCTGG + Intronic
950172100 3:10845896-10845918 TCCTCCTTGCTGCCTCTTCCAGG + Intronic
950282739 3:11720749-11720771 TCCTCCTCCCTGCCCCTCCCCGG - Intronic
950439906 3:13004529-13004551 GCCTCCCTCCTCCCTCTCCTTGG + Intronic
950451115 3:13066458-13066480 GCCTCTTTCCTGACTCCCCCAGG - Intronic
950452717 3:13074171-13074193 GCCTCCTTCCCGCCTCTCTTGGG - Intergenic
950756071 3:15173741-15173763 ACCTGCTTCCTGCTTCCTCCTGG + Intergenic
951518650 3:23589834-23589856 GCCTGCTGCCTGCCGCCCCGCGG + Exonic
952407263 3:33015662-33015684 GCCTCCTGCCTGGCTCTCACAGG - Intronic
952879817 3:37976827-37976849 GCCTGCTGCCTGACACTTCCAGG + Intronic
953406654 3:42663167-42663189 CCCTGATTCCTGCCCCTCCCAGG - Intronic
953749411 3:45597728-45597750 GCCAGCTGTCTTCCTCTCCCAGG - Intronic
954110264 3:48429517-48429539 GGCTGCTTCCGGCCTGGCCCGGG - Intronic
954622849 3:52005639-52005661 GCCTGCTGCCTGCCTGGCACAGG + Intergenic
954692311 3:52402146-52402168 GCCTGGTTCCTCCCATTCCCAGG + Exonic
954712938 3:52513948-52513970 GCCTGCCTTCAGCCTCTTCCGGG + Exonic
955106733 3:55905900-55905922 GCCTGCCTCCCACCTGTCCCTGG + Intronic
955358611 3:58252780-58252802 TTCTGCCTCCAGCCTCTCCCTGG + Intronic
955651226 3:61196219-61196241 GCCTTCTTTCTACCTCTCTCTGG - Intronic
956726030 3:72157143-72157165 CCTTGATTCCTGACTCTCCCGGG - Intergenic
956751853 3:72349728-72349750 CCCTGCATCCTGAGTCTCCCGGG + Intergenic
956814495 3:72895302-72895324 GCCAGCTTCTTGCCTTTCACTGG + Intronic
958604837 3:96343902-96343924 GCCTGATGCTTTCCTCTCCCAGG - Intergenic
961032813 3:123621391-123621413 GGCTGTTTCCTCCCTCTCTCAGG - Intronic
961103347 3:124220761-124220783 ACATGCTTCCTGCCTCTCCTTGG + Intronic
961431619 3:126888065-126888087 TCCTGCCTGCTGCCTCTCTCTGG + Intronic
961474132 3:127136374-127136396 GCCTGGTCCGTGCCTCTCACAGG - Intergenic
961620510 3:128220511-128220533 GCCTGCTTCCCCCCATTCCCTGG + Intronic
961722250 3:128904652-128904674 CCCCGCTGCCTGCCTATCCCTGG - Intronic
961811666 3:129525471-129525493 TCCTGCTTCCTTCCCCTCTCTGG - Intergenic
962213583 3:133500798-133500820 GTCTGCTTCCTGCCTCCACCAGG - Intergenic
962736518 3:138329953-138329975 GACTCCCTCCTGCCTCTCCCTGG - Intergenic
963811150 3:149777653-149777675 TCCTGCTTTCTGTCCCTCCCTGG + Intronic
963949678 3:151185258-151185280 GCTTGCTTCCTGCCTCTTGCTGG + Intronic
964087563 3:152835670-152835692 GCCTGCTCCCTTCCGCTCGCTGG + Exonic
964468735 3:157028393-157028415 ATCTGCTTCCTACCTCTTCCTGG - Intronic
966269193 3:178084179-178084201 ACCTGCTTCCTTCCACTGCCTGG + Intergenic
967078086 3:186023177-186023199 GGCTGTTTTCTGCCTCCCCCAGG - Intergenic
968549027 4:1213030-1213052 TCCTTCCTCCTGCATCTCCCAGG - Exonic
968651219 4:1761000-1761022 GCCTGTGTCCTGGCCCTCCCGGG - Intergenic
968754703 4:2409286-2409308 GCCTGCTGCCATCCTCTCGCTGG + Intronic
968923566 4:3535291-3535313 GTGTGCTTCCTGCCTTTGCCTGG - Intergenic
969053243 4:4386999-4387021 CCTCCCTTCCTGCCTCTCCCGGG - Exonic
969073574 4:4559116-4559138 CCCTGCTGCCTGCCCCACCCAGG - Intergenic
969477819 4:7431368-7431390 GCCCTCTCCCGGCCTCTCCCAGG + Intronic
969656540 4:8501944-8501966 GCTGGCTTCCCGCCTCTTCCCGG + Intergenic
969666153 4:8558544-8558566 GCCTTGTTCCTGACTCACCCAGG + Intergenic
971326628 4:25649811-25649833 GCCAGCTTACTACCTCTGCCTGG - Intergenic
971384232 4:26128153-26128175 ACCTGCTTCCTGCCTTCCCAAGG - Intergenic
971843137 4:31880569-31880591 TTCTTCTTCCTGCCTCTCCCTGG - Intergenic
974847015 4:67363560-67363582 GCCAGCATCCTGCCCATCCCTGG + Intergenic
975029662 4:69599766-69599788 CCCTCCTTCCTTCCTTTCCCAGG - Intronic
975676463 4:76832281-76832303 GCCTGTACCCTGCCTCTTCCTGG + Intergenic
975892116 4:79042385-79042407 GAATTCTTCCTGCCTCTCACAGG + Intergenic
976673328 4:87677982-87678004 GCGTGCTTCCTTCCTCCCCACGG - Intergenic
976966720 4:91051662-91051684 GCCTGCTTCCTTCCTTTCTAGGG - Intronic
978446736 4:108787474-108787496 ACCTGGATCCTGCCTCTCACGGG - Intergenic
981081543 4:140643316-140643338 GGCAGCTTCCTGCTTCTCCAAGG + Intronic
981579351 4:146236533-146236555 GCTTGATTCCTGGCTCTCTCTGG - Intergenic
982122320 4:152155154-152155176 GGCTGGGTCCTTCCTCTCCCAGG + Intergenic
982560628 4:156924905-156924927 GCCTGCATCCTGTCTCTTCCTGG - Intronic
983572385 4:169224143-169224165 GCCTGCTTCCTGTCCCTCATAGG - Intronic
984749486 4:183257772-183257794 GCCTTCCTCATGCTTCTCCCAGG + Intronic
984863304 4:184258406-184258428 TCCTGCTTCATCCCTTTCCCAGG - Intergenic
985118608 4:186616576-186616598 GCGTGCTTCCTGCATCTGCGCGG - Intronic
985421098 4:189785991-189786013 GCCTGCCTCCTACATCTCTCAGG - Intergenic
985629118 5:1005605-1005627 GCCCCCTGCCTGCCTCTTCCAGG - Intergenic
985763303 5:1763003-1763025 GGCTGCCTCCCTCCTCTCCCTGG + Intergenic
985778013 5:1855293-1855315 CTCTGGCTCCTGCCTCTCCCTGG - Intergenic
985789714 5:1918983-1919005 GACTCCTTCCTGCCCCTCCCAGG + Intergenic
985935836 5:3097270-3097292 GCTTGCTTTCTCCCTCTCCTTGG + Intergenic
986473337 5:8097514-8097536 CCTTACTTCCTGACTCTCCCAGG - Intergenic
989332745 5:40278820-40278842 GCCTCCTTCCTCCCTCAGCCTGG - Intergenic
989646151 5:43634964-43634986 GCTTCCTTCCTGGCTTTCCCTGG + Intronic
991251184 5:64563035-64563057 TCCTGCTTGCACCCTCTCCCTGG + Intronic
991587582 5:68215920-68215942 GCCGGCTTCCTTCCTCTGCGGGG - Exonic
992081222 5:73235210-73235232 GCTTGATTCCTGCCAATCCCTGG + Intergenic
995175659 5:109173588-109173610 GCCTACTTCATGCCTCACCCAGG + Intronic
997196677 5:131985054-131985076 CCCTGCTTTCTGCCCCTGCCTGG - Intronic
997199309 5:132000100-132000122 TTCTGCCTCCAGCCTCTCCCAGG + Intronic
997359892 5:133288385-133288407 GGCTGCTGCCTGCCCCTCCCAGG + Intronic
997425626 5:133800904-133800926 GCCTGCTTCCTGCCACCACCAGG - Intergenic
997693593 5:135844279-135844301 GCCTGCTGCATACCTCTCCAGGG + Intronic
998177629 5:139911615-139911637 TCCTGCTGCCAGCCTCTTCCAGG + Intronic
998390343 5:141783372-141783394 GCCTGCTCCCTGGGACTCCCAGG - Intergenic
998415393 5:141942448-141942470 GCCTGCTCCCTCAGTCTCCCAGG + Intergenic
1001586375 5:172835800-172835822 GCCGGCTTCTTGCCCCTGCCGGG + Intronic
1002099899 5:176852198-176852220 GCCGGCCACCTGCCTCTGCCAGG + Intronic
1002607232 5:180390548-180390570 GCCTCCTTCCTGCCCATCCCTGG + Intergenic
1003093793 6:3126532-3126554 GCCTGCCTCCGACCTCCCCCTGG - Intronic
1003209343 6:4046731-4046753 CACTGCTACCTCCCTCTCCCAGG + Intronic
1003320808 6:5049421-5049443 CCCTGCATCCTGCCACCCCCAGG + Intergenic
1003528718 6:6920084-6920106 TTCAGCTTCCTGCCTCTCCTTGG + Intergenic
1004205306 6:13586946-13586968 GCCTGCTTCCTGCCTGTCCCTGG + Intronic
1005061829 6:21783743-21783765 GCCTGCTGCCTGCCCTTCCATGG + Intergenic
1005386912 6:25294116-25294138 GCCTGCTTCCTACCTCTAAGAGG - Intronic
1006423649 6:33950643-33950665 GCCTGCATCTTACCTCACCCAGG + Intergenic
1006871658 6:37257566-37257588 ACCTGCTTCTTCCCTCTCGCGGG + Exonic
1006948162 6:37799472-37799494 GCCTCTGTCCTCCCTCTCCCTGG + Intergenic
1007176189 6:39899250-39899272 GCGTGCTTCCTGCCCCTAGCTGG - Intronic
1007396943 6:41583336-41583358 GGCTGAGTCCTGCCTCTGCCAGG + Intronic
1007628988 6:43262375-43262397 GGCTGCTTCCTGCTGCTTCCAGG - Intronic
1007915899 6:45561413-45561435 GTCATCTTCCTGCCTTTCCCAGG - Intronic
1008000247 6:46352688-46352710 GCCTGGATCCTGGGTCTCCCAGG - Intronic
1008201614 6:48598048-48598070 GCCTGCTTGTTGCCGCTCTCTGG + Intergenic
1008885824 6:56430975-56430997 ACCTGCATCCTGCCTCGCACTGG - Intergenic
1010634141 6:78235660-78235682 GCCTGCAACCTGCCTCTTACAGG + Intergenic
1011627672 6:89296614-89296636 GACTGCTCCCTGCCCCTGCCTGG - Intronic
1011925915 6:92644693-92644715 GCCTTCTTCCTGGGTCTCTCGGG - Intergenic
1012286111 6:97390536-97390558 GCCAGTTTCCAGCCCCTCCCTGG - Intergenic
1013449756 6:110268524-110268546 GCCTGCTTGCTGCCATTCCTGGG + Intronic
1013662623 6:112313558-112313580 GCCTCCTTCCTGCCCATACCAGG + Intergenic
1014139737 6:117927527-117927549 CCCTGCTCCCAGCATCTCCCAGG - Intronic
1016354440 6:143202782-143202804 TGCTGCTTGCTTCCTCTCCCGGG - Intronic
1016392152 6:143585329-143585351 TTCTGCTTCCAGCCTCTTCCTGG - Intronic
1016555717 6:145334901-145334923 CACTTGTTCCTGCCTCTCCCTGG + Intergenic
1017158286 6:151341805-151341827 GCCTCCTTCCTTCCCGTCCCAGG + Intronic
1017563778 6:155662505-155662527 ACCTCATTCCTGCCACTCCCCGG - Intergenic
1017817556 6:158026765-158026787 GCCATCCTCCTGCCTCTCCGAGG + Intronic
1017877392 6:158536398-158536420 CCCCGCCTTCTGCCTCTCCCGGG + Intergenic
1018463581 6:164022031-164022053 TTCTGGTTCCTGCCTCTGCCAGG + Intergenic
1018678240 6:166241637-166241659 GCCTCCTTCCTGCCTGCCCTAGG - Intergenic
1018832128 6:167451256-167451278 CTCTGTTTCTTGCCTCTCCCTGG + Intergenic
1018997014 6:168717586-168717608 GCCTGCCTCCTGCCTCACAGAGG + Intergenic
1019010609 6:168841310-168841332 CCCTGGTTCCTGCGCCTCCCTGG - Intergenic
1019174164 6:170151613-170151635 GCATGCTTCCCTCCTCTCCTGGG + Intergenic
1019331333 7:462208-462230 GCCCACTGCCAGCCTCTCCCAGG - Intergenic
1019471460 7:1223708-1223730 GCCTGCATCTTCCCTCTCCTGGG - Intergenic
1019488550 7:1300581-1300603 GCCTGCTCCCAGCCTCTGCAGGG + Intergenic
1019619870 7:1986651-1986673 ACGGGCTTCCTGCCTCTGCCTGG + Intronic
1019780538 7:2937238-2937260 GCCTTCGTCCCGCTTCTCCCTGG - Intronic
1020096088 7:5370472-5370494 GGCTGCTTCCAGCTTCTCCAAGG + Exonic
1020124950 7:5528374-5528396 GGCTGCTTCCAGCTCCTCCCTGG - Exonic
1021783650 7:24131347-24131369 GCCTGCTTAATGCTTCTACCAGG - Intergenic
1022516540 7:30978286-30978308 GGATGCTTCTTGCCCCTCCCAGG - Intronic
1022619872 7:31972030-31972052 GTCTGCTTCTTGCCTAACCCTGG + Intronic
1022702906 7:32778148-32778170 GCCTGGTGCCTCCCTCTCCAGGG - Intergenic
1023599360 7:41865906-41865928 GACTGCTTCCTGCCACTATCTGG + Intergenic
1023632575 7:42178806-42178828 GCCTGCCTCCTGCCTACCCCCGG - Intronic
1024075321 7:45814948-45814970 CCCGGCTTCCTGCCTCTCGAAGG + Intergenic
1024253725 7:47524468-47524490 GCCTGCATCCTGGCTGCCCCTGG + Intronic
1024373940 7:48617462-48617484 ACCAGCCTCCTGCCTCTCCACGG - Intronic
1026390001 7:69891134-69891156 CCCTTCTTCCTATCTCTCCCAGG + Intronic
1026443485 7:70463807-70463829 TCCTCCTTCCTCCCTCTCCATGG - Intronic
1026991164 7:74586614-74586636 GCCTGGTTCCTCCTTTTCCCAGG - Intronic
1027035604 7:74922880-74922902 GCCAGCTCCCAGCCCCTCCCAGG - Intergenic
1027122766 7:75533797-75533819 GCCAAATTCCTTCCTCTCCCAGG - Exonic
1028024486 7:85820820-85820842 GCAGGGTTCCTGCCTGTCCCTGG - Intergenic
1028342267 7:89736038-89736060 TCCTCCTTCCTGCCACCCCCCGG + Intergenic
1029394454 7:100298257-100298279 GCCAGCTCCCAGCCCCTCCCAGG + Intergenic
1029433429 7:100547457-100547479 GACTGCTTCCCTCCTGTCCCAGG + Intronic
1029924140 7:104297782-104297804 GACTGCAACCTCCCTCTCCCAGG - Intergenic
1033460312 7:141541604-141541626 GCCTCCTGCCTCCTTCTCCCTGG + Intergenic
1034284555 7:149875894-149875916 GCCTGCCTCCTTCCTTGCCCAGG - Intronic
1034411281 7:150943543-150943565 TCCTTCTCCCTGTCTCTCCCAGG + Intergenic
1034531112 7:151697014-151697036 GCCACCTGCCTGCCTCTCCCTGG - Intronic
1034693010 7:153029055-153029077 GCCCTCTTCCCGCCCCTCCCTGG + Intergenic
1035317525 7:158006113-158006135 CCCTTCCTCCTGCCTCTCCTGGG + Intronic
1035361891 7:158318701-158318723 GCCGGCTGCCTGCAGCTCCCCGG + Intronic
1035430310 7:158815227-158815249 GCCTGTCTCCTGTCTCTCCAGGG + Intronic
1035434673 7:158850346-158850368 GCCTGTTTCTGGCCACTCCCAGG + Intergenic
1035629028 8:1094176-1094198 CCCAGTTCCCTGCCTCTCCCAGG - Intergenic
1035695799 8:1594903-1594925 GACTTCTTCCTGCCACTCACTGG + Intronic
1035760077 8:2062383-2062405 CCCTGCTCCCTCCCGCTCCCAGG - Intronic
1036004703 8:4648507-4648529 GCCTGCTTTCTCCCTCTCTTAGG + Intronic
1036487922 8:9196350-9196372 GACTCCTTCCTGAGTCTCCCAGG - Intergenic
1036950011 8:13132072-13132094 GCGAGCTTCCTTCCTCTCTCCGG + Intronic
1037787043 8:21909439-21909461 GCCTCCTCCATGCCTCACCCCGG + Exonic
1038033841 8:23669525-23669547 TCCTACTTCCTACCTCTCCCAGG + Intergenic
1038044635 8:23755746-23755768 TCCTCCTTCCTTTCTCTCCCTGG + Intergenic
1038081359 8:24140465-24140487 GCCTTCTTACTGTCACTCCCTGG + Intergenic
1038572526 8:28675153-28675175 GACTGTTTGGTGCCTCTCCCAGG - Intronic
1040619345 8:49072229-49072251 GCTTGCTTGCTGCCTCTGGCTGG + Intronic
1042011689 8:64253108-64253130 TCTTTCTTTCTGCCTCTCCCAGG - Intergenic
1044078475 8:87854686-87854708 GCCTTCTTCTTGCCCTTCCCTGG - Intergenic
1044610015 8:94082211-94082233 GCCTGTTTCCTGTCACTCTCTGG + Intergenic
1044976413 8:97669838-97669860 GCCTGCAACCTCCGTCTCCCAGG - Intronic
1045289639 8:100821436-100821458 GCGTCCTTTCTGCCTCTCACTGG + Intergenic
1047749720 8:127871167-127871189 GCCTGCTGTGTGCCTCTCCAGGG + Intergenic
1048296732 8:133220318-133220340 GGCTGCGTCCTTCCACTCCCTGG + Intronic
1048410703 8:134169263-134169285 GTCTGCCTCCTGCCACTCTCAGG + Intergenic
1048509450 8:135049136-135049158 GCCTGCCTCTTCTCTCTCCCAGG + Intergenic
1048854144 8:138672486-138672508 CCATGCTTCCTGCCTCTCTTAGG + Intronic
1049060588 8:140273358-140273380 GCCTGTCTCCTGCCTGGCCCCGG + Intronic
1049229402 8:141474289-141474311 GCCTACTTCCTGCATGTGCCGGG + Intergenic
1049240984 8:141537229-141537251 CCCTGCTTCCTGGGTCTCCCTGG + Intergenic
1049306642 8:141907520-141907542 GGCTGCTTCATGCATCTCTCTGG - Intergenic
1049306656 8:141907601-141907623 GGCTGCTTCATGCATCTCTCTGG - Intergenic
1049306685 8:141907764-141907786 GGCTGCTTCATGCATCTCTCTGG - Intergenic
1049343522 8:142126550-142126572 GCCTGCTTCCTGCATATGCTGGG - Intergenic
1049507881 8:143013527-143013549 GCTTGGTTCCCGCCTCTCCCAGG - Intergenic
1049600485 8:143505233-143505255 GCCTGCCTTCTTCCTCTCCATGG + Intronic
1049796131 8:144498066-144498088 GACTCCTTCCTGCCTCCCTCCGG + Intronic
1049797814 8:144504582-144504604 GCCTGCTCCCCTCCCCTCCCAGG + Exonic
1049838480 8:144755191-144755213 GCTGGCTTCCGGCCTCTCCCCGG - Intronic
1050004916 9:1119835-1119857 GCCTGCTCCCTGCCTCTTGGAGG + Intergenic
1050745779 9:8874402-8874424 GCCACTTTCCTGTCTCTCCCAGG - Intronic
1052468178 9:28856646-28856668 GCCTACTTCCAGTCTTTCCCTGG - Intergenic
1052819451 9:33127301-33127323 GCAGGATGCCTGCCTCTCCCAGG + Intronic
1052867638 9:33474529-33474551 CCCTGCATCCTCCCTCTCCCAGG + Intergenic
1053241553 9:36499713-36499735 CCCTGCCCCCTGCCTCTTCCTGG - Intergenic
1053267109 9:36723518-36723540 GCCTGCTCCTGGACTCTCCCAGG + Intergenic
1053799275 9:41754315-41754337 GTGTGCTTCCTGCCTTTGCCTGG - Intergenic
1054145937 9:61560684-61560706 GTGTGCTTCCTGCCTTTGCCTGG + Intergenic
1054187685 9:61966374-61966396 GTGTGCTTCCTGCCTTTGCCTGG - Intergenic
1054650831 9:67622207-67622229 GTGTGCTTCCTGCCTTTGCCTGG + Intergenic
1055401921 9:75933082-75933104 GCTTGCTTCTAGGCTCTCCCAGG - Intronic
1055592674 9:77833688-77833710 GCTTGCTTCCTTGCTCTCCAAGG - Intronic
1056481840 9:87013587-87013609 GCCTCAATCCAGCCTCTCCCTGG - Intergenic
1056810013 9:89756988-89757010 GCTTGCTGCCTGTCCCTCCCTGG + Intergenic
1056963117 9:91143883-91143905 CCCTGCTGCCTGGCTCTCCCTGG - Intergenic
1057421942 9:94919844-94919866 GCCTGGTTCCCCCCTCTCTCGGG + Intronic
1057670054 9:97078609-97078631 GCCTGGCTCCTGCCTCTGCAGGG - Intergenic
1057698940 9:97349016-97349038 GCCCGCCTGCTGCCTCTTCCAGG - Intronic
1057800908 9:98191258-98191280 CCCAGCTTCCTGCCCCTCCTGGG - Intronic
1057867372 9:98692234-98692256 ACCTGCCTCCTGCCACGCCCTGG - Intronic
1058382848 9:104397132-104397154 GACTACTTCCTCCCTCTCCAGGG + Intergenic
1058835509 9:108855861-108855883 GCCGTGTTCCTGCCTCTCCAGGG + Exonic
1059365948 9:113786568-113786590 GCCTCTTTCCTGCCTTTCCTGGG - Intergenic
1059379526 9:113912355-113912377 GTCTGCTGCCTGCATCTGCCAGG - Intronic
1060276448 9:122186550-122186572 CCCAGCTTGCCGCCTCTCCCTGG + Intronic
1060414528 9:123421033-123421055 GCCTGCCTCCTGCTTCTGTCTGG - Intronic
1060485218 9:124042220-124042242 GCCTAATTCTTGCTTCTCCCAGG + Intergenic
1060487909 9:124061194-124061216 GCTTTCTTCCTACCTCTTCCTGG + Intergenic
1060595934 9:124848943-124848965 CACTGCTTCCTGCCCTTCCCTGG + Intergenic
1060821957 9:126666295-126666317 GCCTGCCCCCTGCCCCTCCAGGG - Intronic
1061151277 9:128829623-128829645 GCCTGCTTCCCGCTGATCCCAGG - Intronic
1061290776 9:129649304-129649326 GCCTGGTCCCCGCCTCTCCCAGG + Intergenic
1061482988 9:130906351-130906373 CCCTCCTGCCTGCCTCTCCCCGG + Intronic
1062116783 9:134813876-134813898 GCCTGCTGTCTGCCTGCCCCTGG - Intronic
1062346866 9:136119008-136119030 GCCTGCGCACTGCCTCTCCACGG - Intergenic
1062416204 9:136451535-136451557 GCCCCCTTCCTGCCTCCCTCTGG - Intronic
1062460197 9:136659770-136659792 TCCAGCTTCCTGCCCCTGCCGGG + Intronic
1062607307 9:137353990-137354012 TCCTCCTTCCGGCCTCGCCCAGG + Intronic
1203790888 EBV:151009-151031 GCCCGCTTTCTACCTCTCTCCGG + Intergenic
1185511294 X:666795-666817 GGGTCCTTCCTGCCTCTCCCAGG - Intergenic
1185536846 X:869252-869274 GGGTCCTTCCTGCCTCTCCCAGG + Intergenic
1185890329 X:3816398-3816420 CCCTGCGTCCTGGGTCTCCCCGG - Intergenic
1186122711 X:6381175-6381197 GGACTCTTCCTGCCTCTCCCAGG + Intergenic
1186288769 X:8073616-8073638 TCCTGCCTCCTGACTCTTCCTGG + Intergenic
1187089085 X:16075290-16075312 ACCTGCTTTCTGCCTCAGCCAGG - Intergenic
1187930754 X:24291698-24291720 GAGTGCTGCCTGCTTCTCCCAGG - Intergenic
1188811990 X:34661801-34661823 GACAACTTCCTGCCTTTCCCTGG - Intergenic
1188965406 X:36545465-36545487 GCTTGATTCCTCCCTCTGCCAGG + Intergenic
1189332653 X:40153075-40153097 GCCAGCTTCCTGCCCTGCCCAGG + Intronic
1189752053 X:44232226-44232248 CCCTGCCTCCTGCCTGTGCCTGG + Intronic
1190242287 X:48666776-48666798 AACTGCTTCCTGCCTCTTCAGGG + Intergenic
1192318134 X:70067463-70067485 CCCTCCTTCCTTTCTCTCCCAGG - Intergenic
1192342614 X:70276762-70276784 CCCTGCCTCCAGCCTCTGCCAGG + Intronic
1192917895 X:75673548-75673570 GCCTGCTGCCAGCCACTCCCAGG + Intergenic
1193287153 X:79726108-79726130 GCCTCCTTACTGCCACTACCAGG + Intergenic
1195159301 X:102155600-102155622 GCCTGCTTCCTGCAGGTCCGCGG - Exonic
1195404603 X:104499109-104499131 GCATGCTTCAAACCTCTCCCTGG - Intergenic
1196820135 X:119694606-119694628 CCCTTCTTCCTCTCTCTCCCTGG - Intergenic
1197101995 X:122667296-122667318 GCCTCCTACCTGTCTATCCCAGG + Intergenic
1197957789 X:131971570-131971592 GCCTGCTACCTTGGTCTCCCAGG + Intergenic
1199608589 X:149595314-149595336 GCCTCCTTCCTGCCTCTCCTCGG + Intergenic
1199630533 X:149774046-149774068 GCCTCCTTCCTGCCTCTCCTCGG - Exonic
1200034300 X:153318243-153318265 GCCTCCTTCCACCATCTCCCAGG + Intergenic
1200056228 X:153462778-153462800 GCCTGCCTCCTGGCCCACCCTGG - Intronic
1200175118 X:154108754-154108776 TCCTGTTGCCTGCCTGTCCCAGG - Intergenic
1200231981 X:154448668-154448690 GTCTGCCTGCTCCCTCTCCCAGG + Exonic
1201236970 Y:11921221-11921243 GGATCCTTCCTGCCTCTCCCAGG - Intergenic
1201237443 Y:11924590-11924612 GGACACTTCCTGCCTCTCCCAGG - Intergenic