ID: 1073440119

View in Genome Browser
Species Human (GRCh38)
Location 10:103547567-103547589
Sequence CAGAATCCCCAGAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073440109_1073440119 30 Left 1073440109 10:103547514-103547536 CCTCTGTAAGCTGGACCTGGGAG 0: 1
1: 0
2: 3
3: 23
4: 234
Right 1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG No data
1073440113_1073440119 15 Left 1073440113 10:103547529-103547551 CCTGGGAGAGGCAGGAAGCAGGC 0: 1
1: 1
2: 8
3: 101
4: 723
Right 1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073440119 Original CRISPR CAGAATCCCCAGAGGAAGGA GGG Intronic
No off target data available for this crispr