ID: 1073441840

View in Genome Browser
Species Human (GRCh38)
Location 10:103556802-103556824
Sequence GCCTTGCCCGTCTGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073441829_1073441840 15 Left 1073441829 10:103556764-103556786 CCTTGGCCGGAGAGTTGGATTGG No data
Right 1073441840 10:103556802-103556824 GCCTTGCCCGTCTGTGGGGTGGG No data
1073441827_1073441840 21 Left 1073441827 10:103556758-103556780 CCTGGGCCTTGGCCGGAGAGTTG No data
Right 1073441840 10:103556802-103556824 GCCTTGCCCGTCTGTGGGGTGGG No data
1073441825_1073441840 28 Left 1073441825 10:103556751-103556773 CCAGTGGCCTGGGCCTTGGCCGG 0: 1
1: 0
2: 2
3: 39
4: 318
Right 1073441840 10:103556802-103556824 GCCTTGCCCGTCTGTGGGGTGGG No data
1073441832_1073441840 9 Left 1073441832 10:103556770-103556792 CCGGAGAGTTGGATTGGGCTGAC 0: 1
1: 1
2: 0
3: 18
4: 78
Right 1073441840 10:103556802-103556824 GCCTTGCCCGTCTGTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073441840 Original CRISPR GCCTTGCCCGTCTGTGGGGT GGG Intronic
No off target data available for this crispr