ID: 1073443891

View in Genome Browser
Species Human (GRCh38)
Location 10:103569646-103569668
Sequence CAGAAGAGCCCCAGACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073443891 Original CRISPR CAGAAGAGCCCCAGACAGTC TGG (reversed) Intronic
900391190 1:2434681-2434703 CAGAGGAGCCCCAGGCTGCCCGG + Intronic
900648291 1:3718735-3718757 CCAAGGAGCCCCAGACACTCAGG - Intronic
900881559 1:5385381-5385403 CAGCAGAGCCACAGCCAGGCCGG - Intergenic
901066467 1:6496983-6497005 CAGAGGAGCCCCCGAAGGTCTGG + Exonic
901244896 1:7722130-7722152 CAGCAGACGCCCAGACACTCGGG + Intronic
901769282 1:11522369-11522391 CAGAAGAGCCCCTCACACTTCGG + Intronic
902273870 1:15325604-15325626 AGGAAGAGGCCCAGACAGGCAGG - Intronic
902633188 1:17718086-17718108 CAGAAAAGCCCCAGAGAGAGTGG + Intergenic
903131680 1:21283613-21283635 CAGAAGAAACCCAGGAAGTCGGG + Intronic
905235462 1:36543157-36543179 CAGAAGAGTCCCAGACACCCAGG - Intergenic
905296157 1:36955802-36955824 CAGAAAGGCCACAGACACTCTGG - Intronic
906415564 1:45619209-45619231 CAGAAATGCTCCAGGCAGTCAGG - Intergenic
906784776 1:48605373-48605395 CAGAGGAGCATCACACAGTCTGG - Intronic
910191002 1:84595654-84595676 CAGAAGTGCCACTAACAGTCTGG - Intergenic
910288251 1:85577284-85577306 CAGGAGAGCCCCAGGAAGCCAGG - Intronic
910767667 1:90798583-90798605 CACAAGGGCCCCAGAGACTCAGG - Intergenic
911723597 1:101218283-101218305 CTGAAGGGCCCCAGAAAGACTGG + Intergenic
912956006 1:114154365-114154387 TAGAAGACCCCAAGACAGGCGGG + Intergenic
913032117 1:114918450-114918472 CAGAATAGCCCAAGATATTCTGG - Intronic
914918702 1:151833436-151833458 GAGAAGAGCCACAGACAGGCAGG - Intergenic
915556857 1:156665532-156665554 CAGAGGAGCTCCTGACAGACAGG - Intergenic
915919216 1:159961734-159961756 CAGAAGAAGCCCACACAGGCAGG + Intergenic
917849388 1:179047428-179047450 GAGAGGAGGACCAGACAGTCAGG - Intronic
918243345 1:182639032-182639054 CAAAAGAGACCCAGGGAGTCTGG + Intergenic
920090694 1:203450905-203450927 GAGAAGAGCAAAAGACAGTCAGG - Intergenic
920340914 1:205274657-205274679 CATCAGAGTCCCAGACAGGCAGG - Intergenic
920712927 1:208312248-208312270 CAGAAGAGACCTTGTCAGTCTGG + Intergenic
920724532 1:208421645-208421667 CAGAAGAGCCTCTGACATTCTGG - Intergenic
923183443 1:231546787-231546809 CAGCAGAGCCCCAGAGAGCATGG - Intronic
924342549 1:243050730-243050752 CAGAACAGCTGCACACAGTCAGG + Intergenic
1062841619 10:677837-677859 CAGAAGTGCCACAGACAGGTGGG + Intronic
1063377801 10:5564420-5564442 CAGAAGTGCCCCAGGAAGTGTGG - Intergenic
1065417959 10:25509453-25509475 CAGAAGAGGCTCAGACATCCGGG - Intronic
1065944289 10:30592972-30592994 CAGAAGAGCAGCTGACAGCCAGG - Intergenic
1067828476 10:49596497-49596519 CATTAGAGCCCAACACAGTCAGG + Intergenic
1070890999 10:79942191-79942213 CAGAGGAGCCCCAGAAAGCAAGG - Intronic
1072715448 10:97749470-97749492 CAGAAGAGCCCCATAGAACCTGG - Exonic
1073351445 10:102822830-102822852 CAGGAGAGTCCCACACAGACGGG - Intergenic
1073443891 10:103569646-103569668 CAGAAGAGCCCCAGACAGTCTGG - Intronic
1074305575 10:112275079-112275101 CAGAAGATCTGCAGACAGTGTGG - Intergenic
1074389939 10:113048710-113048732 CACAAAAGCTCCAGAAAGTCAGG + Intronic
1075078306 10:119366323-119366345 CTGTAGAGCCCAGGACAGTCTGG - Intronic
1075390565 10:122087938-122087960 CAGAAGAGCTCCACACTGACAGG + Exonic
1076671314 10:132122365-132122387 CAGAAGACCCACAGTCAGGCTGG - Intronic
1076695696 10:132246316-132246338 GTGAAGACCCCCAGACAGGCAGG + Intronic
1077138168 11:1011873-1011895 AAGAAGAGCCGCAGACATTGTGG - Exonic
1077385070 11:2265454-2265476 CAGCAGAGCCCAGGACAGGCTGG + Intergenic
1078985297 11:16588555-16588577 ACAAAGAGCCCCAGACACTCAGG + Intronic
1080289613 11:30656150-30656172 CAGAGGCCTCCCAGACAGTCTGG + Intergenic
1083295148 11:61711296-61711318 CTGGAGAGGCCCAGACAGGCGGG - Intronic
1084009461 11:66339501-66339523 GAGATGAGCCCTGGACAGTCGGG + Intronic
1084564856 11:69922869-69922891 AAGAAGAACCCCAGACAGATCGG - Intergenic
1085810253 11:79673599-79673621 AGGAAGAGCCCCAGTCAGTGTGG + Intergenic
1085859180 11:80212115-80212137 CAGAGGAGCCCCAGAGAGGCTGG - Intergenic
1086072405 11:82813777-82813799 CAAAAGTGCCCCAGCCAATCTGG - Intergenic
1086984269 11:93231575-93231597 CACAAGGGCCCCAGCCAGTAGGG + Intergenic
1088361400 11:108993860-108993882 GGAAAGAGCACCAGACAGTCAGG - Intergenic
1088720720 11:112589793-112589815 CACTAGAGCCCTAGAAAGTCAGG + Intergenic
1089436360 11:118472130-118472152 TGGAAAAGCCCCAGAAAGTCCGG + Exonic
1089861192 11:121591252-121591274 CAGCAGAGTCCCAGACAGCAGGG - Intronic
1091917038 12:4277093-4277115 CAGCAGAGCCCCAGAAAGGAAGG - Intronic
1093061913 12:14616344-14616366 CACAAGAGCTACATACAGTCTGG - Intronic
1093577750 12:20753864-20753886 CAGAAGAGCATCAGGAAGTCAGG - Intergenic
1096651225 12:53062816-53062838 CAGGGGAGCCCCATACTGTCGGG + Intronic
1096749980 12:53752271-53752293 CAGAAGAGCCCCAATTAGTAGGG - Intergenic
1100233841 12:92637518-92637540 GAGAAGAGCCACAGACACACAGG + Intergenic
1101492297 12:105220881-105220903 TAGGAGAGACCCAGAGAGTCTGG - Intronic
1102217449 12:111171373-111171395 CAGAAAAGCCGCAGTGAGTCTGG - Intronic
1104108954 12:125688223-125688245 CAGAAGGGCCCCAGGAAGCCTGG - Intergenic
1105591575 13:21797457-21797479 CAGGAGAGACGAAGACAGTCAGG + Intergenic
1111013491 13:82344680-82344702 CAGCAGAGACCCTGACAGCCTGG - Intergenic
1111470855 13:88680636-88680658 CAGAAATGCCCCAGAAAGACAGG + Intergenic
1111767280 13:92547608-92547630 TAGGATAGCCCCAGACAGCCAGG + Intronic
1117150693 14:52884614-52884636 CAAAAAAACCCCAGCCAGTCTGG + Intronic
1117194872 14:53329717-53329739 CAGCAGAGCCTTTGACAGTCTGG + Intergenic
1119635338 14:76268805-76268827 CAGAAGAGACCCAGAGATCCAGG + Intergenic
1120584086 14:86289384-86289406 CAGAAAAGACCCAGAGAATCTGG - Intergenic
1121588256 14:95078850-95078872 CAGAAGAACCTCAGTCAGTGTGG - Intergenic
1122440859 14:101730913-101730935 CTGCAGAGGCCCAGACAGACTGG - Intronic
1122616279 14:103020144-103020166 CAGCTGAGGCCCAAACAGTCAGG - Intronic
1122692877 14:103539393-103539415 TAGAAGAGCCCAGGACAGACCGG - Intergenic
1125514360 15:40309468-40309490 CAGAAGGGCCCCAGACTGGAGGG - Intergenic
1127734357 15:61827967-61827989 CAGGAGGGACCCAGAAAGTCGGG - Intergenic
1128740240 15:70078786-70078808 CAGAACATCCCCAGTCATTCTGG + Intronic
1129262638 15:74377289-74377311 CTGAGGGGCCCCAGAGAGTCAGG - Intergenic
1129389690 15:75214388-75214410 GAGAAGAGTCACAGCCAGTCAGG - Intergenic
1132107413 15:99073217-99073239 CAGGAAAGCCCCACACAGACAGG - Intergenic
1132235254 15:100215361-100215383 CAGAAGAACGCCAGACATTCGGG - Intronic
1132670177 16:1099252-1099274 CTCAAGAGCACCAGACGGTCTGG - Intergenic
1133986581 16:10673596-10673618 CAGAAGAGGCCCAGGGAGTGGGG - Intronic
1134096311 16:11421110-11421132 CAGACGGGCCCCAGGCACTCAGG + Intronic
1136061720 16:27731137-27731159 CAAAAGACCCCCATACAGTATGG + Intronic
1136778214 16:32882618-32882640 CGGAAGATCTCCACACAGTCGGG + Intergenic
1139354549 16:66359854-66359876 GAGAAGAGACCCAGACAGGCAGG + Intergenic
1139509150 16:67416450-67416472 CGGACGAGGCCCAGCCAGTCTGG - Exonic
1141107810 16:81247964-81247986 CAGAAGAGACTGAGACAGACAGG - Intronic
1141334494 16:83141992-83142014 CTGAAAAGCCCCAGAAAGTGGGG + Intronic
1203080635 16_KI270728v1_random:1144727-1144749 CGGAAGATCTCCACACAGTCGGG + Intergenic
1143372233 17:6447580-6447602 CAGAAGAGCACCCGGCTGTCTGG + Exonic
1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG + Intergenic
1147422849 17:40331180-40331202 CAGAAGGGAGGCAGACAGTCTGG - Exonic
1148137365 17:45302797-45302819 CAGAAGAGCCACAGACTTTCTGG - Intronic
1150190474 17:63232969-63232991 CAGGGGAGCCCCAGCCAGTGAGG + Intronic
1151719298 17:75846483-75846505 CAGAAGAGCCCCAGACGGTGAGG + Exonic
1152137292 17:78512036-78512058 CAGAAGGGCCCTGGACAGTGTGG + Intronic
1152513340 17:80805161-80805183 CAGATGAGCTCAGGACAGTCGGG + Intronic
1152567723 17:81107589-81107611 CTGAGGAGCCCCAGACAGACAGG - Intronic
1153934152 18:9905794-9905816 ATGAAGAAACCCAGACAGTCTGG + Intergenic
1154012513 18:10587890-10587912 CCACAGAGCCCCAGAAAGTCTGG - Intergenic
1156667069 18:39421473-39421495 CAGGAGAGCCTCAGGCATTCTGG - Intergenic
1158226876 18:55210651-55210673 CAGAAGACCCCAACACAGTTGGG + Intergenic
1160579652 18:79876297-79876319 CCGAAGGGCCCCAGCCAGGCAGG + Intronic
1160614534 18:80114767-80114789 CAGATGAGGCCCAGACACTGTGG - Intronic
1160897869 19:1411183-1411205 CAAGAGAGCCCCAGAAAGGCCGG - Intronic
1162060778 19:8093818-8093840 CAGAAGAGCCCAGGCCAGACTGG + Intronic
1163619148 19:18347926-18347948 CAGAAGAGACGGAGACAGGCCGG - Intronic
1163796992 19:19343481-19343503 CAGCAGAGCCTCAGGCAGTCGGG - Intronic
1165093605 19:33398903-33398925 CAGAAGAGCGCCAGAGGGTATGG - Intronic
1165339291 19:35199198-35199220 TAGAAGAACCCCAGACAGGAGGG + Intergenic
1166066088 19:40359809-40359831 TAGAAGAGCCCCTGACATGCAGG - Intronic
1167041067 19:47022643-47022665 CAGAAAAGTGCCAGACAGGCAGG - Intronic
1167745943 19:51351953-51351975 CAGAAGAGCCACAGGCAGATGGG - Intronic
1167793357 19:51693795-51693817 CAGGAGAGGCCCAGAGGGTCAGG + Intergenic
1168684422 19:58339399-58339421 CTGAAGAGCCACAGACAGGGTGG + Exonic
925916119 2:8607575-8607597 CAGAAGAGATCAAGACAGACGGG - Intergenic
926888296 2:17617622-17617644 CAGAAGTGCCCCAGCCAGGGTGG + Intronic
928949336 2:36800476-36800498 CAGAAGAGCCTCAGTCAGAAAGG - Intronic
932445786 2:71780314-71780336 CCGAAGAGCAACAGACAGCCTGG - Intergenic
933109293 2:78376743-78376765 CAGAAGCTCCCCAGACTGGCAGG - Intergenic
934787582 2:97024808-97024830 CTGAAGATTCCCATACAGTCAGG - Intergenic
935174783 2:100640257-100640279 CAGGAGAGCCTCAGAAAGTCCGG - Intergenic
936266757 2:111016833-111016855 CAGATGGGCCCTAGAGAGTCTGG + Intronic
937905533 2:127051085-127051107 CAGGGGAGCCCCGGACAGGCAGG + Intronic
938781139 2:134585992-134586014 AAGAAGAGCCCAACAAAGTCTGG + Intronic
942228316 2:173836129-173836151 TAGAAGAGCCAGAGACAGTGAGG + Intergenic
945212066 2:207394143-207394165 CAGCAGAGAGCAAGACAGTCAGG + Intergenic
946688840 2:222295880-222295902 CAGACAAGCCCCAGACAACCGGG + Intronic
947715750 2:232338135-232338157 CAGGAGAGCCCCAAACAGGAAGG + Intronic
948396935 2:237651565-237651587 CAGTAGAGCACCCTACAGTCTGG + Intronic
948499766 2:238383203-238383225 AAGAGGAGCCCCACACAGTCTGG - Intronic
1170935348 20:20804915-20804937 CAGAATTGCCCCAGAGAGTGGGG + Intergenic
1172636562 20:36414073-36414095 CACAAGAGCCCCACACCGTTGGG + Intronic
1173257743 20:41406921-41406943 AAGAAGATGCCCAGGCAGTCAGG - Intronic
1174021098 20:47529927-47529949 AAGAAGAACCGCAGACATTCTGG + Intronic
1174892554 20:54412356-54412378 AAGCAGAGCACCAGACATTCTGG - Intergenic
1176419217 21:6500397-6500419 AAGATGAGCCCCAGACTGTGGGG + Intergenic
1176649240 21:9530412-9530434 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1178405537 21:32320235-32320257 CAGAACAGAGCCAGACAGGCTGG + Intronic
1179694710 21:43108719-43108741 AAGATGAGCCCCAGACTGTGGGG + Intergenic
1179880251 21:44290629-44290651 CAGAATCCCCCCAGACAGCCAGG - Intronic
1180007022 21:45027568-45027590 CACAAGATCCCCAGGCAGTGTGG + Intergenic
1180020798 21:45125303-45125325 AAGCAGAGCTCCAGACACTCAGG - Intronic
1180353259 22:11820783-11820805 CAGAAGAGTCCCTGAGAGTTGGG - Intergenic
1180384979 22:12171574-12171596 CAGAAGAGTCCCTGAGAGTTGGG + Intergenic
1181822370 22:25486100-25486122 CATAAGAGCACCAAAGAGTCTGG - Intergenic
1184182884 22:42842928-42842950 CAAGAGAGCCCCATACAGCCTGG - Intronic
1184467751 22:44678797-44678819 CAGAGCAGCCCCAGGCTGTCGGG - Intronic
1184718515 22:46295867-46295889 CAGAAGTGCCCGAGCCAGCCTGG + Exonic
951111419 3:18808857-18808879 CAGAAAAGCCACAGAGAATCAGG - Intergenic
956809138 3:72847644-72847666 CAGAAGAGCAGCAGACAGCAGGG + Intronic
957942870 3:87027110-87027132 AAGAAGAGCCTCAGAGAGACTGG - Intergenic
961118286 3:124350456-124350478 CAGCAGAGCCCCTGACAAGCTGG - Intronic
964845720 3:161042427-161042449 CAGCAGAAGCCCAGAAAGTCAGG + Intronic
967124354 3:186410929-186410951 CAGCAGAGCCCCTGGCAGCCTGG - Intergenic
967935451 3:194724029-194724051 TAGCAGTGGCCCAGACAGTCAGG + Intergenic
968131383 3:196194665-196194687 CAGAGGAGCCCTAGACAGTCAGG + Intergenic
968133381 3:196206037-196206059 CAAAACAACCCCAGAAAGTCAGG - Intronic
968466275 4:752906-752928 CAGAAGAGCCCTGGACAGACGGG - Intronic
968878441 4:3286388-3286410 CAGAAAATCCCCAGGCAGCCAGG - Intergenic
973959447 4:56095274-56095296 CAGAAGAGCCCCAACCACCCGGG - Intergenic
976494910 4:85716917-85716939 CAGAAGAGCACAAGAGAGACAGG - Intronic
977556883 4:98495870-98495892 CAGAAGAGTCCCAGACCTTGGGG - Intronic
978669756 4:111232606-111232628 CATCAGAGCCCCAGACTGCCAGG + Intergenic
979054575 4:115978875-115978897 CAGAAGCCCCCTAGACAATCAGG - Intergenic
982009315 4:151091576-151091598 CAGAAGACCCCAACATAGTCAGG - Intergenic
984322234 4:178209615-178209637 CAGAAGACCCCTAGACCATCAGG + Intergenic
985523648 5:391036-391058 CAGAACATCCTCAGACAGACGGG + Intronic
989215439 5:38900109-38900131 CAGATGAGCCCCAGCCAGAGAGG - Intronic
990766222 5:59186210-59186232 CATAACAGAGCCAGACAGTCTGG - Intronic
993703110 5:91141904-91141926 CAGAAAAGCCAGAGACAGCCAGG + Intronic
995619422 5:114007600-114007622 CAGAAGCCCCCAACACAGTCAGG - Intergenic
995687660 5:114788632-114788654 CAGAAAAGATCCAGACAGACTGG - Intergenic
996190227 5:120531399-120531421 CTGCAAAGCCCCAGACAGCCAGG + Intronic
997368580 5:133341565-133341587 CAAAAGAGCACCAGACAGAGAGG - Intronic
998602122 5:143595376-143595398 CAGAGGTGCTCCAGACAGGCTGG + Intergenic
999306142 5:150520962-150520984 CAGAAGTGCCCCAGGGCGTCAGG - Exonic
1000500320 5:162040295-162040317 CAGATGAGCACCAGATAATCAGG + Intergenic
1001334103 5:170783603-170783625 CAGACGATCTCCAGACACTCAGG + Intronic
1004281265 6:14281426-14281448 CAGACGAGCCCCAGGAACTCTGG - Intergenic
1011198939 6:84813279-84813301 CAGGAGAGCCCCAGTTAATCAGG + Intergenic
1014963790 6:127721187-127721209 CAGAGGAGCCCCAGACGTTTGGG + Intronic
1016834863 6:148466946-148466968 CAGAAGAGACACAGACACTTGGG - Intronic
1018093397 6:160363959-160363981 CAGGAGAGTCCCAGACAAACTGG + Intronic
1018664977 6:166126970-166126992 CTGAGGAACCCCAGAAAGTCAGG + Intergenic
1019453528 7:1112470-1112492 CAGGAGTGCCCCACACAGACAGG + Intronic
1021266991 7:18537023-18537045 CAGATGATCCCAAGAGAGTCAGG - Intronic
1021891349 7:25188838-25188860 TAGCAGAGCCGCAGACAGCCAGG - Intergenic
1022606059 7:31815396-31815418 CAGAAGAGCTCCAGGCAAACTGG - Intronic
1023888668 7:44377701-44377723 GGGAGGAGCCCCTGACAGTCGGG - Intergenic
1024434215 7:49330118-49330140 AAGAAAAGCCCAAGACAGCCAGG - Intergenic
1024647631 7:51383248-51383270 CAGAACAGCTGCACACAGTCAGG + Intergenic
1025275778 7:57580467-57580489 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1028671998 7:93411644-93411666 CAGAAGAGCCTCTGACAACCTGG - Intergenic
1029705372 7:102273149-102273171 CAGGAGTGCCTCTGACAGTCAGG + Intronic
1029991588 7:104967410-104967432 AAGCAGAGCCCCAGCCAGTAGGG + Intergenic
1030265334 7:107615243-107615265 CAGAAAAGCCACAGTCAGCCTGG + Intronic
1030981035 7:116185811-116185833 CAGAAGAGCTGCAGACCTTCGGG - Intergenic
1033018270 7:137694538-137694560 CAGAAAAGCACCAGAGAATCAGG + Intronic
1034385898 7:150740947-150740969 CTCAAGAGCCCCAGACACTTGGG + Intronic
1035732667 8:1863789-1863811 CTGGAGAGCCACAGACAGGCAGG + Intronic
1035734565 8:1878771-1878793 CAGAGGAGCCCTTGACTGTCTGG + Intronic
1037458109 8:19083576-19083598 CATGAGAGCCCTAGAAAGTCAGG + Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042225845 8:66513700-66513722 CAGAAGAGCACCAGGCCGCCTGG + Intronic
1042297830 8:67242018-67242040 CAGACGAGCCACAGCCAGACAGG + Intronic
1043387135 8:79759508-79759530 CAAAAGAGAGCCAGACAGGCAGG - Intergenic
1047067616 8:121303355-121303377 CAGAAGACCCCCTGACATTCTGG - Intergenic
1047420551 8:124704577-124704599 GGGAAGAGCCCCAGTCACTCTGG - Intronic
1047783405 8:128130117-128130139 TAGGAGATCCCCAGAGAGTCAGG - Intergenic
1048821489 8:138384504-138384526 CAGTAGAGCCTCTGCCAGTCTGG - Intronic
1049243130 8:141548765-141548787 CACAGGAGCCCCAGGCACTCTGG - Intergenic
1049347223 8:142145492-142145514 CACAGGAGCCCCAGCTAGTCAGG + Intergenic
1051439206 9:17066155-17066177 CAGAAGTGCCTCAGAGAGTGGGG + Intergenic
1053006857 9:34610753-34610775 CACAAGCACCCCAGACATTCAGG + Exonic
1053382089 9:37657484-37657506 CAGGGGAGCCCTGGACAGTCTGG - Intronic
1055534396 9:77223067-77223089 CAGAAGAGGCTCAGAGACTCTGG - Intronic
1059837730 9:118175570-118175592 CAGAAGAGCCAAAGACATTTGGG - Intergenic
1060435030 9:123585960-123585982 CACAATAGCCACAGCCAGTCTGG + Intronic
1061672163 9:132194797-132194819 CCGAGGAGCCCCAGGCAGCCAGG + Intronic
1062613028 9:137383463-137383485 CAGAGGAGCCCCAGGCATTGCGG - Intronic
1203626979 Un_KI270750v1:33960-33982 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1188287484 X:28345331-28345353 CAGAGGAGCCAGACACAGTCTGG - Intergenic
1189346246 X:40243575-40243597 CAGAAGAGCCCCAGAGAAAAGGG + Intergenic
1192381812 X:70625228-70625250 CAAAAGAACCCCAGATTGTCAGG + Intronic
1195551004 X:106171009-106171031 CAGCCGAGCCCCAGAAAGACAGG + Exonic
1199530110 X:148837121-148837143 TACAAGAGCCCCAGGCAATCTGG + Intronic