ID: 1073444846

View in Genome Browser
Species Human (GRCh38)
Location 10:103574524-103574546
Sequence GTTTAAACATAAAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073444836_1073444846 12 Left 1073444836 10:103574489-103574511 CCAAAAGCAACACCTTTCCCATT 0: 1
1: 0
2: 4
3: 34
4: 366
Right 1073444846 10:103574524-103574546 GTTTAAACATAAAAGGAGGCAGG No data
1073444837_1073444846 0 Left 1073444837 10:103574501-103574523 CCTTTCCCATTACCCTCCAGCTG 0: 1
1: 0
2: 0
3: 28
4: 340
Right 1073444846 10:103574524-103574546 GTTTAAACATAAAAGGAGGCAGG No data
1073444840_1073444846 -6 Left 1073444840 10:103574507-103574529 CCATTACCCTCCAGCTGGTTTAA 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1073444846 10:103574524-103574546 GTTTAAACATAAAAGGAGGCAGG No data
1073444839_1073444846 -5 Left 1073444839 10:103574506-103574528 CCCATTACCCTCCAGCTGGTTTA 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1073444846 10:103574524-103574546 GTTTAAACATAAAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073444846 Original CRISPR GTTTAAACATAAAAGGAGGC AGG Intronic
No off target data available for this crispr