ID: 1073446562

View in Genome Browser
Species Human (GRCh38)
Location 10:103584495-103584517
Sequence GCAGTGTCACGCAGGGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073446562_1073446571 16 Left 1073446562 10:103584495-103584517 CCGAGAGCCCTGCGTGACACTGC 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1073446571 10:103584534-103584556 AGATAGCGAGCTGGTGCTCCCGG 0: 1
1: 0
2: 2
3: 6
4: 65
1073446562_1073446572 27 Left 1073446562 10:103584495-103584517 CCGAGAGCCCTGCGTGACACTGC 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1073446572 10:103584545-103584567 TGGTGCTCCCGGACTGTCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
1073446562_1073446568 7 Left 1073446562 10:103584495-103584517 CCGAGAGCCCTGCGTGACACTGC 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1073446568 10:103584525-103584547 CTCCCGCGCAGATAGCGAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073446562 Original CRISPR GCAGTGTCACGCAGGGCTCT CGG (reversed) Intronic
901530085 1:9847201-9847223 ACAGTGTCACTCAGAGCGCTGGG + Intergenic
903183488 1:21617173-21617195 GCACATTCACTCAGGGCTCTAGG + Intronic
906292810 1:44631113-44631135 CCAGTGCCATGCTGGGCTCTGGG + Intronic
907570220 1:55476471-55476493 TCAGTGACACCCAGGGTTCTGGG - Intergenic
913509617 1:119549883-119549905 GGAGTGTCAGGCAGGGCCCAGGG - Intergenic
915138309 1:153749583-153749605 GCAGTGCCACCTAGTGCTCTGGG + Intronic
915572673 1:156753124-156753146 CAAGTGTCATGCAGGACTCTGGG - Intronic
915677193 1:157542800-157542822 GCAGGGTGAGGCAGGACTCTTGG + Intronic
917240195 1:172939756-172939778 GCAGTGACACTCAAGGCTGTTGG + Intergenic
917618923 1:176774978-176775000 TCACTGTCACGGAGAGCTCTGGG - Intronic
917631069 1:176891919-176891941 GGAGTGTAAGGAAGGGCTCTTGG + Intronic
920650777 1:207835746-207835768 GGAGTGCCACCCAGGGCCCTAGG + Intergenic
923456338 1:234168715-234168737 GCAGTGGCAGGGAGGCCTCTGGG + Intronic
924720623 1:246619798-246619820 GCAGTAGAAGGCAGGGCTCTGGG + Intronic
1067344042 10:45425275-45425297 GCAGTGTCAGCCAGGGTCCTGGG + Intronic
1069543531 10:69313243-69313265 GCAGTGTCAAGCAGTGGGCTGGG + Intronic
1069637592 10:69935271-69935293 GCAGTCTCCAGCTGGGCTCTAGG + Intronic
1070787968 10:79173124-79173146 GCTGTATCAGGGAGGGCTCTGGG + Intronic
1070912387 10:80130138-80130160 GCAGTGTCACCCACTGCACTGGG - Intergenic
1073167588 10:101470969-101470991 GCACTGTCACCCACTGCTCTGGG - Intronic
1073446562 10:103584495-103584517 GCAGTGTCACGCAGGGCTCTCGG - Intronic
1075334171 10:121597199-121597221 CCAGCGCCACGCAGGGCCCTCGG + Intronic
1076756109 10:132572552-132572574 GCAGCGTGACCCAGGGCTCTTGG + Intronic
1076849337 10:133085544-133085566 GGAGGATCACGCAGGCCTCTGGG - Intronic
1077324854 11:1959302-1959324 GGTGCGGCACGCAGGGCTCTTGG - Intronic
1077340621 11:2024795-2024817 GCAGTCTCCCGCAGGGCCCTGGG - Intergenic
1079266368 11:18936884-18936906 GAAGTCTCATGCAGGGCTCCAGG - Intronic
1079268512 11:18959115-18959137 GAAGTTTCATGCAGGGCTCCAGG - Intergenic
1080751868 11:35158155-35158177 TGAGTGTCTCCCAGGGCTCTGGG - Intronic
1080931640 11:36817483-36817505 GCAGCGGCACACAGTGCTCTGGG + Intergenic
1085666045 11:78417003-78417025 GCAGTGTCACACCGGGGTCGGGG + Intronic
1086849556 11:91793221-91793243 CCAGAGTCTCACAGGGCTCTGGG + Intergenic
1089384634 11:118059743-118059765 TCAGAGTGAGGCAGGGCTCTGGG - Intergenic
1202807834 11_KI270721v1_random:14479-14501 GGTGCGGCACGCAGGGCTCTTGG - Intergenic
1202823606 11_KI270721v1_random:79984-80006 GCAGTCTCCCGCAGGGCCCTGGG - Intergenic
1102073057 12:110037609-110037631 GCTGTGTCAACCAGGGCCCTAGG + Exonic
1102339839 12:112112920-112112942 GCAGTGACTCGCTAGGCTCTGGG + Intergenic
1103783075 12:123412447-123412469 GCAGTGTTACACAGGGTTCTAGG + Exonic
1106527180 13:30551578-30551600 TCAATGTCACCCAGGCCTCTAGG + Intronic
1113675936 13:112208066-112208088 GAATTGGCACGCAGGGCTGTCGG - Intergenic
1114329018 14:21617612-21617634 GCTGTGTCACGCAGGTCTCCAGG + Intergenic
1116896870 14:50324549-50324571 ACAGTGTCAGGCAGTGTTCTAGG - Intronic
1117132244 14:52697494-52697516 GCAGTGATAGGCAGAGCTCTAGG - Intergenic
1118498318 14:66331094-66331116 GAAGAGTGACTCAGGGCTCTGGG - Intergenic
1119032815 14:71205718-71205740 GCAGCGTCAGGCTGGGCTCCTGG - Intergenic
1121797321 14:96745926-96745948 CCAGTGTCAGGTTGGGCTCTTGG + Intergenic
1122758859 14:104005328-104005350 GCAGTGGCCAGCAGAGCTCTCGG - Exonic
1123017855 14:105384117-105384139 TCAGTGGCACTCAGGGCTCTGGG + Intronic
1202915377 14_GL000194v1_random:165737-165759 GCAGTGGCAGGCAGAGTTCTGGG - Intergenic
1130547678 15:84868665-84868687 CCACTGTCACCCAGGGCTCCCGG + Exonic
1130843738 15:87725265-87725287 GCAGTGCCAGGCAGAGCTCCTGG + Intergenic
1130885245 15:88087337-88087359 GGAGTGTCCGGCAGGTCTCTCGG + Intronic
1132364518 15:101247503-101247525 GCAGTGTCCCCCAGGACTCAGGG + Intronic
1132503024 16:293059-293081 GCAGAGCCACTCAGGGCTCCTGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1134225297 16:12385437-12385459 ATTGTGTCCCGCAGGGCTCTAGG + Intronic
1139432179 16:66916920-66916942 GCAGACTCACACTGGGCTCTTGG + Intronic
1139777223 16:69324072-69324094 GCAGATTCAAGCAGGCCTCTGGG + Intronic
1140671787 16:77286805-77286827 GCAGTGTGACACAAGTCTCTGGG + Intronic
1140749135 16:78007510-78007532 GCTGTGTCACACAGGACTCAGGG + Intergenic
1141818772 16:86431043-86431065 TCAGTATCACAGAGGGCTCTTGG - Intergenic
1143865692 17:9921494-9921516 GCATTGACACACAGGGCTCAGGG - Intronic
1144586192 17:16489334-16489356 GGAATGTCATGCAGGCCTCTGGG - Intronic
1146263758 17:31437942-31437964 CCAGGGTCTCGCAGGGCTCTGGG - Intronic
1148023147 17:44566846-44566868 GCAGTGTCTCTCTGGCCTCTGGG - Intergenic
1148046585 17:44748613-44748635 GCATTGGCAAGCAGGGCTCCTGG - Intronic
1148071308 17:44910480-44910502 GCAGTGTCACGAAGGCCCCCAGG + Exonic
1151433843 17:74082032-74082054 GAAGTGTTACCCAGGGCCCTGGG + Intergenic
1151512586 17:74570388-74570410 GCAGTGCCAGGCAGGGCCCCGGG - Intergenic
1151517100 17:74603580-74603602 GCTGTGCAACGCAGGACTCTGGG + Intergenic
1151887437 17:76931551-76931573 GTTGTGTCCAGCAGGGCTCTGGG + Intronic
1152270375 17:79321044-79321066 GCAGTGGCACGGGGGCCTCTAGG - Intronic
1156440543 18:37182956-37182978 GCACTGTCACTCAGGGCATTTGG - Intronic
1159715568 18:71817745-71817767 GCAGTGGAACACAGGACTCTTGG + Intergenic
1160286590 18:77548946-77548968 TCAGTGTCACCCAGCGTTCTTGG + Intergenic
1162775225 19:12975203-12975225 GGAGGGTCATGAAGGGCTCTGGG + Intergenic
1163664548 19:18597108-18597130 GCAGTGTGGCCCAGGGCACTTGG + Intronic
1167763506 19:51463815-51463837 GCAGAGTCCCACAGGGGTCTGGG + Intergenic
1167910657 19:52699311-52699333 GAAGTGTCACGCACGTCTGTGGG + Intergenic
1168081269 19:54012185-54012207 GAAGTCTCACGCGTGGCTCTAGG - Exonic
925305676 2:2846652-2846674 ACAGGGTCACGCAGGGCTCTAGG + Intergenic
926057449 2:9782578-9782600 GCTGTGTCAAGCAGGCCTATCGG + Intergenic
926797329 2:16629639-16629661 GCACTGACGTGCAGGGCTCTGGG + Intronic
934851151 2:97702106-97702128 GCAGTGTCAGGCAGGACTGAAGG - Intergenic
935779311 2:106497574-106497596 GCAGTGTGAGGCAGTGCTCCTGG - Intergenic
947637545 2:231687751-231687773 GCAGAGGATCGCAGGGCTCTGGG - Intergenic
948607124 2:239143037-239143059 GCCCTGTCACGCATGGCTCCTGG + Intronic
1175445843 20:59018883-59018905 GCAGTGTCCTGCAGGTCTCTTGG - Intergenic
1175919824 20:62445593-62445615 GCAGTGACAGGCAGGGCCGTGGG + Intergenic
1176634727 21:9180381-9180403 GCAGTGGCAGGCAGAGTTCTGGG - Intergenic
1180698661 22:17770016-17770038 CCAGTGGCACGAAGGGCCCTGGG - Intronic
1181425435 22:22834631-22834653 GCAGCCTCAAGCAGAGCTCTTGG + Intronic
1181519576 22:23437342-23437364 GCAAAGACACGCCGGGCTCTGGG - Intergenic
1182308626 22:29388720-29388742 GCAGTCTCCCGCAGAGCCCTTGG + Intronic
1183403444 22:37618288-37618310 TCAGAGTCACACAGGCCTCTGGG - Intronic
1184402405 22:44281644-44281666 GCTGGGTCACACTGGGCTCTGGG + Intronic
1184604110 22:45562540-45562562 CCAGGGCTACGCAGGGCTCTTGG - Intronic
950710946 3:14812281-14812303 GCAGTGGCTGGCTGGGCTCTGGG - Intergenic
955392334 3:58530790-58530812 GCACTGTGAAGCAGGGCACTTGG - Intronic
957057275 3:75453375-75453397 GCATTGCCAGGCAGGGCTGTGGG - Intergenic
964172666 3:153789586-153789608 CCACTGTCACACAGGGCTTTTGG - Intergenic
964786430 3:160400710-160400732 GGAGTGTTAAGCGGGGCTCTCGG + Intronic
965607081 3:170508322-170508344 ACAGTTTCATGCAGGCCTCTGGG + Intronic
968660749 4:1797820-1797842 GCAGGGTCACCCTGGGCACTAGG + Intronic
968867720 4:3224554-3224576 GCAGTGACAGGCAGGGCCCAGGG - Intronic
969813798 4:9671069-9671091 GCATTGCCAGGCAGGGCTGTGGG + Intergenic
970238944 4:13988154-13988176 GCAATGCTACGCAGAGCTCTAGG - Intergenic
971345754 4:25810342-25810364 GCAGTGGCAGTCCGGGCTCTTGG - Intronic
979171956 4:117611184-117611206 GCATTGGCACACATGGCTCTAGG - Intergenic
983035870 4:162865049-162865071 GCTGTGTCATGCAGGTCTCCAGG - Intergenic
985298283 4:188458539-188458561 GCTGTTTCACGCCAGGCTCTGGG + Intergenic
985697472 5:1348921-1348943 CCAGTCTCACCCAGGGCCCTAGG - Intergenic
985830056 5:2221558-2221580 GAAGTCTCACGAAGGGCTCCTGG - Intergenic
986339153 5:6774775-6774797 GCAGAGACACCCCGGGCTCTTGG - Intergenic
986425573 5:7627820-7627842 GCTGTGGCAGGCATGGCTCTAGG + Intronic
990712295 5:58598569-58598591 TCAGTGTCAGGCAGTGTTCTAGG + Intronic
1001576998 5:172771099-172771121 GGAGCGTCACGCGGGGCTCCGGG + Exonic
1004241150 6:13924141-13924163 ACAGAGTCACTCAGGGCTCATGG + Intergenic
1007196003 6:40061256-40061278 GCAGTCTTAAGCAGGGCTTTGGG - Intergenic
1007209665 6:40182651-40182673 GCAGGGTCACACTGGGTTCTGGG + Intergenic
1008840515 6:55897562-55897584 GCAGAGTCAAGCAGAGCTCTTGG + Intergenic
1009580073 6:65521851-65521873 CCAGTGTCTCGTAGGGTTCTTGG + Intronic
1011431306 6:87289807-87289829 GCAATGTCAAGCTGGCCTCTGGG + Intronic
1014723308 6:124945830-124945852 TCAGGGTCAGGCAGGGATCTTGG + Intergenic
1017095423 6:150800497-150800519 GCAGTGGCACCCTGGGCTCATGG - Intronic
1017329710 6:153182141-153182163 GCAGTGTTACACAGAGCTCAAGG - Intergenic
1017499026 6:155006337-155006359 GCAGTAACACCCAGGGCTCAAGG + Intronic
1019591685 7:1838936-1838958 GCAAAGACACGCCGGGCTCTGGG + Intronic
1019707383 7:2502990-2503012 GGAGGGTCACGGAGGCCTCTGGG + Intergenic
1020262734 7:6539731-6539753 GGAGTGGCCCGCAGGCCTCTCGG + Exonic
1022388571 7:29924342-29924364 TCAGTGTCACTCTGGGGTCTGGG - Intronic
1023879224 7:44309039-44309061 GCAGTGCTGGGCAGGGCTCTGGG - Intronic
1024229046 7:47350159-47350181 GCAGTGCCTCCCAGGGCTCATGG - Intronic
1035682956 8:1501874-1501896 GCAGCCTCTCGCAGGGCCCTTGG - Intronic
1037415520 8:18645629-18645651 ACTGTGTCACGCTGGACTCTTGG - Intronic
1038453428 8:27655288-27655310 GCTGTGTTACTCAGTGCTCTTGG + Intronic
1040734416 8:50488708-50488730 CAAGTGTCATGCTGGGCTCTTGG - Intronic
1040967037 8:53093102-53093124 GCTGTGTCACACAGGTCACTAGG + Intergenic
1042225903 8:66514124-66514146 GCAGTGTCACTGAGGGGTGTCGG - Intronic
1042843652 8:73149046-73149068 GTTGTGTAACGCAGGGCTTTGGG - Intergenic
1045321327 8:101083769-101083791 GCAGAGTGTTGCAGGGCTCTGGG + Intergenic
1049242898 8:141547672-141547694 ACAGAGTCACTCAGGGCTCCAGG + Intergenic
1049251894 8:141593644-141593666 GCTTTGTCACTCATGGCTCTGGG - Intergenic
1049630445 8:143651976-143651998 GCAGTGGGAGGCAGGGCTCCAGG - Exonic
1050987560 9:12102289-12102311 GCAGAGACTAGCAGGGCTCTGGG + Intergenic
1051305730 9:15706910-15706932 GCAGTCTCAGGGAGTGCTCTTGG + Intronic
1056407421 9:86288089-86288111 GCAGTGCCACTCAGGTCTCTGGG - Exonic
1056816597 9:89806280-89806302 GCAGTGTCACCCCAGTCTCTGGG - Intergenic
1056987755 9:91379673-91379695 AAAATGTCACCCAGGGCTCTGGG - Intergenic
1057191021 9:93087759-93087781 GCAGTGGCACGCTGGGCTTGTGG - Intergenic
1057786548 9:98092376-98092398 GCAGGGGCACCCAGGGCCCTTGG + Intronic
1058880286 9:109279647-109279669 GCATTGTGACGCATGGCACTTGG + Intronic
1059261231 9:112978687-112978709 GCAGTAAAAGGCAGGGCTCTGGG + Intergenic
1060171951 9:121469098-121469120 GCAGTTTCACGCAGCGATCAGGG - Intergenic
1060311199 9:122464190-122464212 GCTGTGTCACACAGGTCACTAGG + Intergenic
1061816956 9:133203267-133203289 GAAGTGTGACACAGGGCTCGTGG - Intergenic
1203769817 EBV:43906-43928 ACAGTTTCAAGCAGGTCTCTGGG + Intergenic
1203757508 Un_GL000218v1:147690-147712 GCAGTGGCAGGCAGAGTTCTGGG - Intergenic
1196039266 X:111184377-111184399 TCAGTGTCACGCAGCACTATAGG - Intronic