ID: 1073446582

View in Genome Browser
Species Human (GRCh38)
Location 10:103584585-103584607
Sequence GCCGCAGCGACGGCCGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073446582_1073446586 4 Left 1073446582 10:103584585-103584607 CCTGCGGCGGCCGTCGCTGCGGC 0: 1
1: 0
2: 4
3: 29
4: 362
Right 1073446586 10:103584612-103584634 GGCGGACGACGCGCGCCTCTCGG 0: 1
1: 0
2: 1
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073446582 Original CRISPR GCCGCAGCGACGGCCGCCGC AGG (reversed) Exonic
900113779 1:1020196-1020218 GCGGCAGCAGCGGCCGCAGCGGG - Exonic
902323567 1:15684297-15684319 GCCGCGGCGGCGGCGGCGGCAGG - Intergenic
902659494 1:17891352-17891374 GCAGCAGCGGCGGCGGCAGCAGG - Intergenic
903115521 1:21176259-21176281 GCCGCCGCTGCTGCCGCCGCCGG + Exonic
903738201 1:25543668-25543690 GCGGCAGCGGCGGCGGCGGCCGG + Exonic
903907486 1:26696765-26696787 GCTGCCGCCACCGCCGCCGCCGG - Exonic
903907688 1:26697433-26697455 GCTGCGGCGGCGGCCGCCTCGGG + Exonic
904236734 1:29121736-29121758 GCCGCCGCCTGGGCCGCCGCCGG - Exonic
904783000 1:32964593-32964615 GCCGCAGCGGCGGCCGGCGCCGG - Exonic
906204394 1:43979334-43979356 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
906520973 1:46466716-46466738 GCGGCGGCGACGGCGGCGGCGGG + Intergenic
906960923 1:50419101-50419123 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
907430053 1:54406369-54406391 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
907486433 1:54781323-54781345 GGCCCAGGGACGGCCGGCGCTGG - Exonic
908703898 1:66930283-66930305 GCGGCAGAGACGGCAGCGGCCGG + Intronic
910757323 1:90707059-90707081 GCCGCCGCCTCGGCCACCGCAGG - Intergenic
912337622 1:108877170-108877192 GGTGCAGCGGCGGCCGCCTCGGG - Exonic
913632521 1:120723955-120723977 GCCGCCGCCTCAGCCGCCGCCGG - Intergenic
914428599 1:147600194-147600216 GCCGCCGCCGCTGCCGCCGCCGG + Intronic
915128000 1:153679159-153679181 GCAGCAGCGGCGGCAGCAGCAGG - Exonic
915167860 1:153958534-153958556 GCCGCGGCGGAGGCCGCGGCTGG - Exonic
915495964 1:156282762-156282784 GCCGCAGCCGCCGCCGCCACCGG + Exonic
920314839 1:205069993-205070015 TCCGCAGCTACAACCGCCGCGGG + Exonic
920886871 1:209938121-209938143 GCGGCCGCGAGGGGCGCCGCGGG - Intergenic
921217737 1:212951477-212951499 GCGGCAGCGGCGGCGGCGGCGGG - Exonic
922763977 1:228148263-228148285 GCCGCAGTGAGGACAGCCGCAGG + Intronic
924052315 1:240091892-240091914 GCCGCAGCGACGGCAGCCACGGG + Exonic
924754787 1:246931493-246931515 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1063415496 10:5869717-5869739 GCAGCAGCTATGGCCGCCCCTGG + Intronic
1064380584 10:14838377-14838399 GCAGCAGGGACGGCAGCGGCAGG - Exonic
1064442985 10:15370675-15370697 GCCGCAGCGGCGACAGCAGCTGG + Intronic
1065021707 10:21507221-21507243 CCCGCAGCCATGGCCGCAGCCGG + Intergenic
1065023084 10:21516867-21516889 GCGGCGGCGGCGGCCGCCGCGGG - Exonic
1071661231 10:87504958-87504980 GCCGCAGCCAGGGCCGCGGCAGG - Exonic
1071695356 10:87863795-87863817 GCCGCCGCTGCCGCCGCCGCAGG - Exonic
1072757691 10:98031302-98031324 GGCTCCGCGACGGCCCCCGCAGG + Intergenic
1073137375 10:101227438-101227460 GCCGCAGCCGCCGCCACCGCCGG + Exonic
1073325978 10:102644170-102644192 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1073446582 10:103584585-103584607 GCCGCAGCGACGGCCGCCGCAGG - Exonic
1076536391 10:131180322-131180344 GCCGTAGAGACGGCTGCCACTGG + Intronic
1076638915 10:131901020-131901042 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076722087 10:132397163-132397185 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1077213337 11:1383433-1383455 GCAGCAGCGGAGGCCGCGGCCGG + Intergenic
1079450781 11:20598298-20598320 GCCGCGGCGGCCGCGGCCGCAGG - Intergenic
1080551538 11:33376816-33376838 GCAGCAGCGTCGGTGGCCGCGGG - Intergenic
1081774000 11:45665506-45665528 GCCGCAGCCCCGGGCGCCGGAGG + Exonic
1083491175 11:63015979-63016001 GCCTCAGCGAGGGCCGCTGGGGG + Intergenic
1084021323 11:66420004-66420026 GCCGCAGCCGCGGCAGCCGCCGG + Intergenic
1084180608 11:67443705-67443727 GCCTCTGCGGCGGCCGCCGTCGG - Intronic
1084433958 11:69127225-69127247 GCCGCAGCCACGCCAGCCCCAGG - Intergenic
1089543668 11:119206289-119206311 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1090699079 11:129278942-129278964 CCCGCAGCGCCGTCCGCCCCGGG + Intronic
1094041122 12:26122642-26122664 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
1094107916 12:26833159-26833181 GCGGCTGTGACGGCCGCAGCGGG - Exonic
1095261744 12:40105953-40105975 GCCGCCGCCACGGCCGCTCCGGG + Intronic
1096466186 12:51848683-51848705 GCGGCTGCTGCGGCCGCCGCGGG + Intergenic
1096983739 12:55743398-55743420 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1097648138 12:62260606-62260628 GCTGCCCCGGCGGCCGCCGCCGG - Intronic
1100391309 12:94148357-94148379 GCGGCCGCGGCGGCCGCGGCGGG + Intergenic
1103120087 12:118372866-118372888 GCAGCAGCGGCGGCGGCCGCGGG - Exonic
1104049561 12:125186487-125186509 GCCGCGGCGGCGGCGGCGGCGGG + Intergenic
1105480736 13:20773439-20773461 GCCCCAGCGACAGGCGCCGCGGG + Intronic
1106269219 13:28138195-28138217 GCAGCGGCGACGGCCGTCTCAGG + Intergenic
1106719934 13:32427328-32427350 GCCACTGCCACGGCCGCCCCGGG + Intronic
1106735857 13:32586990-32587012 GCGGCGGCGACGGCGGCGGCGGG - Intronic
1110119758 13:71866530-71866552 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1111951278 13:94711391-94711413 GCAGCGGCGGCCGCCGCCGCCGG - Exonic
1111951317 13:94711550-94711572 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1112507813 13:99985446-99985468 GCCGCCGCTGCCGCCGCCGCTGG - Exonic
1114037928 14:18646560-18646582 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1114120693 14:19668471-19668493 ACCGCTGCGGCCGCCGCCGCTGG - Intergenic
1117875879 14:60249582-60249604 GCGGCGGCGACGGCGGCAGCCGG - Intronic
1117913019 14:60652441-60652463 GCTGCAGCGAGGGCAGCAGCCGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118607703 14:67515407-67515429 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1118796697 14:69151742-69151764 GCCGCGGCGACAGCTGCCCCTGG - Intronic
1118849483 14:69573096-69573118 GCGGCGGCGGCGGCGGCCGCGGG + Exonic
1118992501 14:70809266-70809288 CCCCCAACGACGGCGGCCGCAGG + Exonic
1119145527 14:72310267-72310289 GCAGCAGCGGCGTCAGCCGCTGG + Intronic
1119759643 14:77141483-77141505 CCGGCAGCGCCGGCAGCCGCGGG + Intronic
1119821038 14:77616452-77616474 GCCGCAGCCGCAGCCGCCGCCGG - Exonic
1122183498 14:99971991-99972013 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1122445018 14:101761786-101761808 GCGGCGGCGGCGGCGGCCGCGGG + Exonic
1122582117 14:102777544-102777566 GCGGCAGCCGCGGCGGCCGCCGG + Exonic
1122918211 14:104868479-104868501 GCAGCAGCGGCGCCCGCCACCGG + Exonic
1122940384 14:104978492-104978514 GCCGCGGCGACGGCAGCCAATGG - Intergenic
1122976946 14:105174629-105174651 GGCGCAGCCGCGGCCGCCGCCGG - Intronic
1122982164 14:105196785-105196807 GCCCCCGCGCCGGGCGCCGCGGG - Intergenic
1123037095 14:105475931-105475953 GCTGCAGGGAAGGCCGCCACTGG + Intronic
1123053760 14:105559885-105559907 GCCTCAGCGGCTGCCGCAGCGGG + Intergenic
1123078343 14:105680302-105680324 GCCTCAGCGGCTGCCGCAGCGGG + Intergenic
1125200738 15:37099013-37099035 GCCGCCGCCGGGGCCGCCGCTGG - Intronic
1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG + Exonic
1125524832 15:40368290-40368312 GCGGCAGCGTGGGCAGCCGCAGG - Exonic
1125626835 15:41115991-41116013 GCCGCCGCGACGGCGGCGGAGGG + Exonic
1125674247 15:41494060-41494082 GTCGCTGCGGCCGCCGCCGCGGG + Exonic
1126767006 15:52019444-52019466 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1129348284 15:74938174-74938196 GCCGTAGCCCCCGCCGCCGCCGG - Intergenic
1130411699 15:83653723-83653745 GACGCCGCCACCGCCGCCGCCGG - Intergenic
1130908599 15:88256345-88256367 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1131431747 15:92393908-92393930 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1132466205 16:78385-78407 GCAGCAGCGAGCGCGGCCGCGGG + Intronic
1132546497 16:535665-535687 GCTGCAGCCACGCCCGCCTCTGG - Intronic
1133079287 16:3305687-3305709 GCTGGAGCGGCGGCGGCCGCAGG + Intronic
1133188364 16:4116063-4116085 CCCCCAGCGCCCGCCGCCGCGGG - Exonic
1133784411 16:8963567-8963589 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1134061657 16:11202911-11202933 GCCCCAGTGACGGCCACCACTGG - Intergenic
1134490815 16:14694169-14694191 GCAGCAGCGACGGCAGTAGCAGG + Exonic
1134496196 16:14733287-14733309 GCAGCAGCGACGGCAGTAGCAGG + Intronic
1136154606 16:28374543-28374565 GCAGCAGCTACGGGAGCCGCAGG - Intergenic
1136208485 16:28740721-28740743 GCAGCAGCTACGGGAGCCGCAGG + Intergenic
1136226502 16:28863897-28863919 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1136414739 16:30096221-30096243 GCCGCAGCGGCGGCAGCAGCTGG - Intronic
1136641549 16:31569424-31569446 GCCGCGGCGGCCGCCACCGCAGG + Intergenic
1138179321 16:54931409-54931431 GCGGCGGCGGCGGCGGCCGCGGG - Exonic
1138247622 16:55479275-55479297 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
1138248676 16:55485697-55485719 GCCGCAGCGATGGCTTCCTCTGG + Exonic
1138516197 16:57536564-57536586 GCAGCTGCGACCGCCGCCGGAGG + Exonic
1139570126 16:67806511-67806533 GCGGCAGCGACGGCAGACCCGGG - Exonic
1139615364 16:68085386-68085408 GTCGCCGCCACCGCCGCCGCGGG - Intronic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1141054613 16:80804012-80804034 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1141704533 16:85657461-85657483 GCGGCAGCGGCGGCTGCGGCAGG + Exonic
1141949980 16:87333982-87334004 GCCGCAGCTACGGCATCCCCAGG + Exonic
1141959020 16:87392351-87392373 GCCGCAGCAGCCGCCGCCCCCGG + Exonic
1142671948 17:1491565-1491587 GGCGCGGGGACGGCGGCCGCGGG - Intronic
1143148330 17:4790419-4790441 GCCGCGGCGAGGGCCGCCCCCGG + Intergenic
1144021349 17:11241651-11241673 GCCGCCGCCACAGCCGCCGCGGG - Exonic
1144339674 17:14301369-14301391 GCAGCAGCAGCGGCGGCCGCGGG + Exonic
1144547998 17:16215478-16215500 GCCGCGGCGGCGGCGGCGGCTGG - Exonic
1145307523 17:21683607-21683629 GCTGCAGCGGCGGCGGCGGCTGG + Intergenic
1145307754 17:21684772-21684794 GCTGCAGCGGCGGCGGCGGCTGG + Intergenic
1145379007 17:22376857-22376879 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145379485 17:22379227-22379249 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145379964 17:22381597-22381619 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145380444 17:22383969-22383991 GCTGCAGCCGCGGCTGCCGCTGG - Intergenic
1145380922 17:22386319-22386341 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145381402 17:22388694-22388716 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382135 17:22392468-22392490 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382610 17:22394833-22394855 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382890 17:22396196-22396218 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145383463 17:22399019-22399041 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145383977 17:22401487-22401509 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145384415 17:22403689-22403711 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145384734 17:22405151-22405173 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1146214894 17:30971222-30971244 GCGCCCGCGACGCCCGCCGCTGG + Exonic
1147144577 17:38477672-38477694 GCCGCAGCCCCCGCCGCCGCCGG - Exonic
1147161773 17:38572780-38572802 GCAGCCGCGGCCGCCGCCGCCGG + Intronic
1147162925 17:38578455-38578477 GCCGCAGCCGCAGCCGCAGCCGG + Intronic
1147307401 17:39573630-39573652 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1147486357 17:40818873-40818895 GCCGGAGCTGCTGCCGCCGCCGG + Exonic
1147486410 17:40819065-40819087 GCCGCCGCCGTGGCCGCCGCCGG + Exonic
1147486428 17:40819137-40819159 GCCGCCGCGTCCGCCGCCTCCGG + Exonic
1148698624 17:49575651-49575673 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1149430614 17:56593723-56593745 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1151323699 17:73366268-73366290 GCCGCAGTGACGGAAGCCTCGGG + Intronic
1152111509 17:78359825-78359847 GGCGCAGCGCGGGCCACCGCTGG - Exonic
1153794399 18:8609486-8609508 GCCGCTGCCGCCGCCGCCGCCGG - Exonic
1154940789 18:21111368-21111390 GCCCGAGCGGCGGCCGCAGCTGG - Exonic
1156036155 18:32770288-32770310 GCAGCAGCAGCCGCCGCCGCAGG - Exonic
1158435991 18:57435823-57435845 GCCCCCGCCACTGCCGCCGCCGG - Exonic
1160725378 19:615949-615971 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
1160763566 19:797563-797585 GCCGCCGCGCCGGCCTCCCCGGG + Intronic
1160822481 19:1064983-1065005 GCCGCCACGAAGGCCGCTGCCGG - Exonic
1161129480 19:2579582-2579604 GGCGAGGGGACGGCCGCCGCTGG + Intronic
1161397980 19:4054691-4054713 GCAGCGGCGGCGGCGGCCGCGGG + Exonic
1161400708 19:4065464-4065486 GCCGCCGCCACCGCCGCCGCCGG - Intronic
1161495015 19:4581744-4581766 GTCGCAGCGGCGGCCGCGGCGGG - Intergenic
1162312413 19:9914743-9914765 GGCCCAGCGGCTGCCGCCGCCGG - Intronic
1162470926 19:10871661-10871683 GGCGCAGCGGCGGCGGCGGCGGG + Exonic
1162954324 19:14090033-14090055 GCCGCAGCCACAGCCGCCGCCGG - Exonic
1163154473 19:15432491-15432513 GCCACCGCCACCGCCGCCGCGGG - Intronic
1163606982 19:18280985-18281007 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1163804151 19:19386014-19386036 GCCGCCACAGCGGCCGCCGCGGG + Exonic
1163807251 19:19406449-19406471 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
1165061445 19:33207064-33207086 GCCGCCGCCTCGGCCGCCTCTGG + Exonic
1165458714 19:35931436-35931458 GCTGCAGAGAAGGCAGCCGCGGG - Intergenic
1166008524 19:39924569-39924591 GTCGTAGCGACGGCCGTCGAAGG + Exonic
1166361250 19:42253866-42253888 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1166389558 19:42401576-42401598 GCTGCTGCGGCGACCGCCGCAGG - Exonic
1166975122 19:46601370-46601392 GCTGCAGCTGCTGCCGCCGCCGG + Exonic
1167001038 19:46746034-46746056 GCCGCCGGGACGGCCGGCGGGGG - Exonic
1167019097 19:46861100-46861122 GCCGCCGCCTCAGCCGCCGCTGG + Intergenic
1167466212 19:49652152-49652174 GCAGCACCGACCGCCGCCGCGGG + Exonic
1167466217 19:49652164-49652186 GCCGCCGCGGGGGCAGCCGCAGG + Exonic
1168721770 19:58558394-58558416 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
926077112 2:9950980-9951002 GCCCCAGGGACTGCCGCCGAGGG + Intergenic
926914410 2:17878700-17878722 GCCGCCGCGGCGGCAGGCGCGGG + Intronic
927472270 2:23385400-23385422 CCCGCAGCCGCGGCGGCCGCGGG - Exonic
927920810 2:26970813-26970835 GCCGAGGCGACGGACGCCGTGGG + Intronic
928983218 2:37156918-37156940 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
929188786 2:39120983-39121005 GCCGCCGCCACCGCCGCCGCCGG + Exonic
931355835 2:61537465-61537487 GGCGCGGCGGCGGCGGCCGCGGG - Intronic
933666861 2:84971284-84971306 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
934248015 2:90324087-90324109 GCCGCGGCGGCGGCGGCGGCGGG + Intergenic
939900615 2:147845245-147845267 GCGGCCGCGGCGGCCGCTGCTGG + Intronic
940883355 2:158968658-158968680 GCTGGAGCGGCGGCCGCCTCGGG + Exonic
941029314 2:160493444-160493466 GCCGCCGCTGCCGCCGCCGCCGG - Exonic
942241118 2:173964684-173964706 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
942278090 2:174336938-174336960 GGCGCCGCGGCTGCCGCCGCCGG + Exonic
942278205 2:174337481-174337503 GCGGCGGCGGCGGCCTCCGCGGG + Exonic
944273087 2:197804958-197804980 GCCGCCGCCACTGCCGCCGCTGG + Exonic
944831218 2:203535341-203535363 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
945225826 2:207530329-207530351 GCTGCCGCCCCGGCCGCCGCTGG - Intronic
946329582 2:219001841-219001863 GCGGCCGCGGCGGCCACCGCAGG + Intergenic
946431021 2:219627527-219627549 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
947741664 2:232487583-232487605 GCCGCAGCCGCAGCCGCAGCCGG + Intronic
948115809 2:235493942-235493964 GACGCAGCGCCGGCGGCCGGAGG + Intergenic
948530323 2:238599916-238599938 GCGGCACTGACGGCCTCCGCAGG + Intergenic
948570114 2:238912562-238912584 CCCGGAGAGGCGGCCGCCGCAGG - Intergenic
1169073743 20:2749531-2749553 GGCCCAGCCCCGGCCGCCGCGGG + Intronic
1170756916 20:19212877-19212899 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1171122433 20:22578509-22578531 GCCGGCCCGCCGGCCGCCGCAGG - Intergenic
1172474491 20:35226777-35226799 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1173231522 20:41202576-41202598 GCCGCAGCAAGTGCCGCTGCTGG + Exonic
1174287770 20:49484197-49484219 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
1174504785 20:51010191-51010213 GGCGCAGCGGCTGCGGCCGCAGG - Exonic
1174611665 20:51802287-51802309 GCCCCAGCGGCGCCCGCGGCGGG - Exonic
1175149860 20:56925245-56925267 GCCGGAGCGGCGGCGGGCGCGGG + Intergenic
1175429102 20:58890247-58890269 GCCGCGGCGGCGGCGGCCTCGGG - Intronic
1175429374 20:58891238-58891260 GCCGCGGCGGCGGCGGCGGCTGG - Intronic
1175944137 20:62550977-62550999 GCGGCAGCGGCGGCGGGCGCAGG - Exonic
1175962264 20:62643013-62643035 TCGGCAGCAGCGGCCGCCGCAGG - Exonic
1176068950 20:63216133-63216155 GCAGCGGCGACGGCGGCGGCAGG + Exonic
1176078711 20:63260992-63261014 GCAGCAGCCACGGCCTCTGCAGG + Intronic
1176380746 21:6111156-6111178 GCAGCAGCGGCGGCGGCAGCCGG + Exonic
1176380777 21:6111270-6111292 GCGGCAGCGGCGGCAGCGGCGGG + Intronic
1176548984 21:8213468-8213490 GCCGCGGCCACGGGCGCGGCCGG - Intergenic
1176550023 21:8217026-8217048 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1176556877 21:8257680-8257702 GCCGCGGCCACGGGCGCGGCCGG - Intergenic
1176567913 21:8396498-8396520 GCCGCGGCCACGGGCGCGGCCGG - Intergenic
1176575817 21:8440717-8440739 GCCGCGGCCACGGGCGCGGCCGG - Intergenic
1177011054 21:15730367-15730389 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1178334670 21:31732280-31732302 GCCGCGGCCGCCGCCGCCGCCGG - Intergenic
1179742695 21:43426970-43426992 GCGGCAGCGGCGGCAGCGGCGGG - Intronic
1179742726 21:43427084-43427106 GCAGCAGCGGCGGCGGCAGCCGG - Exonic
1180018173 21:45101078-45101100 GCCGCGGCGGCGGCCGCTGCCGG + Intronic
1180060312 21:45381651-45381673 GCCACAGCCAAGGCAGCCGCAGG + Intergenic
1180090520 21:45531533-45531555 GGCGCAGCTGCGGCCGCCGCAGG + Exonic
1180462055 22:15573602-15573624 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1180754332 22:18149971-18149993 GCGGCTGCAACGGCAGCCGCGGG + Exonic
1181026854 22:20131826-20131848 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1181155512 22:20917647-20917669 GCCGCAGCGGAGGCCACCCCGGG - Exonic
1184899342 22:47434597-47434619 GCTGCACCGACGGCCGCAGCGGG - Intergenic
1203238464 22_KI270732v1_random:30911-30933 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1203253868 22_KI270733v1_random:129775-129797 GCCGCGGCCACGGGCGCGGCCGG - Intergenic
1203254913 22_KI270733v1_random:133352-133374 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1203261924 22_KI270733v1_random:174854-174876 GCCGCGGCCACGGGCGCGGCCGG - Intergenic
1203262969 22_KI270733v1_random:178431-178453 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
951217777 3:20040637-20040659 GCTGCAGCCACTGCCGTCGCCGG - Exonic
951981969 3:28575977-28575999 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
952382922 3:32818306-32818328 GCCGCGCCGCCGCCCGCCGCCGG - Exonic
953485077 3:43286921-43286943 GCCGCAGTGACGGCTCCCGCCGG - Intronic
954025726 3:47781772-47781794 GCCGCAGCGGCGGGCGGCGGCGG - Exonic
954615554 3:51967340-51967362 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
955911574 3:63863959-63863981 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
955911611 3:63864056-63864078 GCTGCAGCCGGGGCCGCCGCCGG - Intergenic
959591872 3:108090817-108090839 GGCGAAGCGACAGCAGCCGCAGG + Intronic
962301862 3:134250564-134250586 GCAGCAGCGGCGGCGGCGGCGGG + Exonic
963253356 3:143121096-143121118 GCCGCAGCGGGGGCAGCCGGAGG + Exonic
963253391 3:143121201-143121223 GCCGCCCCGACGGCGGCAGCGGG - Exonic
966182199 3:177197561-177197583 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
966787752 3:183636126-183636148 GCCGCGGGGCCGGGCGCCGCCGG + Intronic
967867730 3:194204137-194204159 GCAGCAGCGAAGGCAGCCGCGGG + Intergenic
967890188 3:194359352-194359374 GCAGCAGCAACAGCCGACGCAGG + Exonic
968081545 3:195849836-195849858 GCCGCAGGGCCGGGTGCCGCCGG + Intergenic
968372715 4:10815-10837 GGCGCAGAGACGGACGCCGACGG + Intergenic
968372721 4:10844-10866 GGCGCAGAGACGGACGCCGCCGG + Intergenic
968584765 4:1411104-1411126 GCTGCAGAGGCGGCCGCGGCTGG + Intergenic
968618740 4:1594061-1594083 GCTGCAGGGAGGGGCGCCGCGGG + Intergenic
968701300 4:2059401-2059423 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
969394211 4:6910023-6910045 GCTGCAGCGCCGGCCGAGGCGGG + Intronic
972321550 4:37977358-37977380 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
972725774 4:41745776-41745798 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
973246594 4:48016754-48016776 CCCGCAGCCCCGCCCGCCGCGGG + Exonic
975633097 4:76421312-76421334 GCCCCAGCGACGGCGTCCGGCGG - Intronic
975986258 4:80203236-80203258 GCGGCTGCGGCGGCGGCCGCGGG + Exonic
976593929 4:86876342-86876364 AGCGCAGCGACGGCCGGGGCCGG + Intronic
980923945 4:139115460-139115482 GCCGCGGCGAGGGCAGCGGCGGG + Intronic
981270747 4:142845728-142845750 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
981550600 4:145937740-145937762 GCGGCAGCGGCGGCGGCGGCTGG - Intronic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
984462904 4:180058775-180058797 GCTGGAGCGACCGCCGCGGCCGG + Intergenic
985996708 5:3600910-3600932 GACGCAGCGCCGGGCGACGCCGG - Intronic
986330464 5:6713471-6713493 GCCGCCGCCGCCGCCGCCGCAGG + Intergenic
986813659 5:11385160-11385182 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
986859023 5:11904513-11904535 GCGGCAGCAGCGGCAGCCGCGGG + Intergenic
987812259 5:22853088-22853110 GCAGCACCGACGGCCGCAGCAGG + Exonic
988825299 5:34929659-34929681 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
990955145 5:61332804-61332826 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
996019133 5:118572954-118572976 GCGACAGCGACGGACACCGCAGG + Intergenic
997013381 5:129904559-129904581 GCTGCCGCCACCGCCGCCGCCGG + Exonic
997521538 5:134526880-134526902 CCCGCCGCTCCGGCCGCCGCCGG - Intronic
997975415 5:138439078-138439100 GCCGCTGCAGCAGCCGCCGCGGG - Exonic
999374928 5:151080582-151080604 GCCGCAGCGCCGCCCGCACCCGG + Intronic
1000319030 5:160119163-160119185 CCCGCCGCCACCGCCGCCGCCGG - Exonic
1001506371 5:172283712-172283734 GCTGCAGCGGCGGCGGCGGCGGG - Exonic
1002895678 6:1378800-1378822 GCCGCGGCGCCGGCCGCAGCCGG - Intergenic
1002927346 6:1611910-1611932 GCGGCGGCGGCGGCGGCCGCAGG + Exonic
1002927867 6:1615098-1615120 GCCGCAGCGCCGGCCCGGGCAGG - Intergenic
1003049415 6:2766049-2766071 CCCGCCGCGGCGGCGGCCGCCGG - Exonic
1003624091 6:7727052-7727074 GCTGCCGCGGCCGCCGCCGCCGG + Exonic
1004216869 6:13711564-13711586 GCCGCAGCGACAGCGCCCCCGGG - Exonic
1004395894 6:15246048-15246070 GCCGCCGCCGCCGCCGCCGCTGG + Intergenic
1004903200 6:20212443-20212465 GCTGCAGCCACGGGCGCCGTAGG + Intergenic
1006472511 6:34236747-34236769 GCGGCAGCGGCGGCGGCGGCTGG + Intergenic
1007600163 6:43076369-43076391 GCCGCAGCAGCAGCCGCAGCCGG - Intronic
1007625405 6:43243676-43243698 GCCGCAGCCGCAGCCGCAGCGGG + Exonic
1010141921 6:72622250-72622272 GGCGCAGCGGCGGCGGCGGCGGG + Exonic
1011643057 6:89433159-89433181 CCCGCCGCGTCCGCCGCCGCAGG - Intronic
1014137540 6:117907190-117907212 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1015149218 6:130019840-130019862 CCCGCGCGGACGGCCGCCGCGGG - Intronic
1015220638 6:130801496-130801518 GCGGCAGCGGCGGCAGCGGCGGG + Intergenic
1015799335 6:137044683-137044705 GCGGCAGCGGCAGCGGCCGCAGG + Exonic
1017163934 6:151390824-151390846 GCAGCAGCGGCGGCAGCAGCAGG + Intronic
1017842269 6:158231986-158232008 GCCGCCGCGCCGCCCGCCACCGG - Intergenic
1018400331 6:163414610-163414632 GCCGCTGCTGCCGCCGCCGCTGG + Intronic
1018400494 6:163415143-163415165 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1018795507 6:167182149-167182171 GCCGCAGCCGCAGCCGCAGCAGG - Exonic
1018820814 6:167372914-167372936 GCCGCAGCCGCAGCCGCAGCAGG + Exonic
1019111917 6:169723981-169724003 GCGGCAGCGGCGGCGGCGGCCGG - Exonic
1019474247 7:1236432-1236454 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1019676264 7:2314372-2314394 GCCGCCCCGACTGCAGCCGCGGG + Exonic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1020130538 7:5556472-5556494 GCCGCAGCGACTTCCTCCGCGGG + Intronic
1020178101 7:5898803-5898825 GCTGCAGCGGCGGCCGGGGCCGG + Exonic
1020304826 7:6826172-6826194 GCTGCAGCGGCGGCCGGGGCCGG - Exonic
1022106222 7:27199716-27199738 GCAGCAGCGGCGGCAGCCGACGG + Exonic
1022106289 7:27199923-27199945 GCTGCAGCGGCGGCGGCTGCCGG - Exonic
1022107181 7:27204989-27205011 GCCGCTGCCGCGGCTGCCGCCGG - Intergenic
1022739726 7:33109417-33109439 GCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1023418298 7:39951393-39951415 GCAGCAGCAGCGGCGGCCGCCGG + Exonic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1023703000 7:42911616-42911638 GCCGCTTGCACGGCCGCCGCGGG - Intronic
1023951283 7:44848047-44848069 GCAGCACCGACCGCCGCCGCCGG + Exonic
1028198481 7:87934335-87934357 GCCGCAGCACCGGCCGGGGCTGG + Intronic
1028477085 7:91264805-91264827 GCCGCAGGGGGAGCCGCCGCCGG + Exonic
1028922403 7:96322268-96322290 GCCGCAGAGGCCGCCGCTGCTGG - Intergenic
1029080757 7:97972229-97972251 GCTGCAGCGGCGGCCGGGGCTGG - Intergenic
1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG + Exonic
1029348736 7:99997712-99997734 GCCGCAGCGACGGCGGTCTGCGG + Intergenic
1030176619 7:106660890-106660912 GCCGCATCGAAGGCCGCTCCGGG + Exonic
1032020693 7:128405910-128405932 GCAGCAGCGGCGGCAGCGGCGGG - Intronic
1032525753 7:132577245-132577267 GCCGCTGGCTCGGCCGCCGCCGG + Exonic
1035167921 7:157002665-157002687 GTCGCAGTGACGGCCGCCGCAGG + Intronic
1035169541 7:157009947-157009969 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1036723697 8:11200976-11200998 GCCGGAGCCGCCGCCGCCGCAGG - Exonic
1038633039 8:29263229-29263251 GCCGCAGCGAAGGCGGGGGCGGG + Intergenic
1039595535 8:38787391-38787413 GACGCAGCGCCGGCTGCCGGCGG + Exonic
1040415238 8:47189238-47189260 GCTGCTGCGGCGGCCGCGGCCGG - Intergenic
1041059500 8:54022274-54022296 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1041552680 8:59119259-59119281 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1042155691 8:65841973-65841995 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1042532864 8:69833000-69833022 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1042785094 8:72537380-72537402 GCAGCGGCGGCGGCGGCCGCGGG - Exonic
1045738014 8:105318843-105318865 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1048981170 8:139703915-139703937 GCCGCCGCGCCCGCCGCCCCCGG - Intergenic
1049681182 8:143919075-143919097 GCCGCCGTGGCTGCCGCCGCCGG + Exonic
1049694299 8:143976106-143976128 GCCGCAGCGGCGTGGGCCGCGGG + Intronic
1051352189 9:16207397-16207419 GCAGCTGCGACGGCCGCGGTCGG - Intronic
1051896407 9:21994201-21994223 GCCACAGCGGCGGGCGCCCCTGG + Intronic
1052362157 9:27573213-27573235 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053114608 9:35490118-35490140 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053430630 9:38039782-38039804 GCCTCAGCGAGGGCAGCGGCTGG + Intronic
1053435139 9:38069204-38069226 GTGGCAGCGACAGGCGCCGCCGG - Exonic
1054775658 9:69121697-69121719 GCCGCGGCGGCGGCCGCCACCGG + Intronic
1054835570 9:69672286-69672308 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1055611962 9:78032205-78032227 GCAGCAGTCACGGCCGCCCCCGG + Intergenic
1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG + Intergenic
1057245540 9:93451700-93451722 GCGGCAGCGGCGGCGGCGGCAGG + Exonic
1057489145 9:95508368-95508390 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1057573216 9:96219424-96219446 GCCCCAGGCACGGCCCCCGCAGG - Intergenic
1059633937 9:116154346-116154368 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1060280634 9:122213576-122213598 ACCGCAGCGCCGGGAGCCGCTGG - Intronic
1060389890 9:123268525-123268547 GCCGCCGCAGCCGCCGCCGCTGG - Intronic
1062022595 9:134326513-134326535 GCCGCCGCCACCGCAGCCGCCGG + Intronic
1062065874 9:134525938-134525960 GCCGCAGCGCAGGCTGCCGCCGG - Intergenic
1062414263 9:136439826-136439848 GACCCAGCAACCGCCGCCGCGGG + Intergenic
1062452609 9:136621872-136621894 TTCCCAGCGCCGGCCGCCGCAGG + Intergenic
1062537633 9:137027896-137027918 GCCGCAGCGCCGGCAGGCGAGGG + Exonic
1062575509 9:137205493-137205515 GCAGCAGCGGCGGCAGGCGCGGG - Exonic
1203470268 Un_GL000220v1:112919-112941 GCCGCGGCCACGGGCGCGGCCGG - Intergenic
1203478089 Un_GL000220v1:156891-156913 GCCGCGGCCACGGGCGCGGCCGG - Intergenic
1187518154 X:19990952-19990974 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1189137119 X:38561513-38561535 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1189323300 X:40098594-40098616 GCGGCAGCGGCTGCTGCCGCTGG - Intronic
1190108444 X:47574519-47574541 GCAGCAGCGCCCGCCCCCGCAGG - Exonic
1190542864 X:51496501-51496523 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1194977594 X:100409721-100409743 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1195803302 X:108735941-108735963 GCAGCAGCGGCGGCCGCCTCTGG - Exonic
1195923186 X:110002678-110002700 GCCGCGGCGGCGGCCGCCAGGGG + Intronic
1196684067 X:118495881-118495903 GCAGCGGCCGCGGCCGCCGCGGG + Intronic
1196793233 X:119482756-119482778 GCCGCAGCGGCAGCAGCCGATGG + Intergenic
1200068781 X:153517817-153517839 CCCGCAGCGACAGCGCCCGCCGG + Intronic
1200128915 X:153830658-153830680 GCGGCAGCGGCGGGCCCCGCGGG - Intergenic
1200277852 X:154751143-154751165 GCCGCTGCGACCCCCGCCTCCGG + Intronic