ID: 1073446603

View in Genome Browser
Species Human (GRCh38)
Location 10:103584700-103584722
Sequence TTGAGTGAGTTCTGCGGGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073446603_1073446609 16 Left 1073446603 10:103584700-103584722 CCCATCCCGCAGAACTCACTCAA 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1073446609 10:103584739-103584761 GCGCTGCCGGCGCAGCTCGACGG 0: 1
1: 0
2: 0
3: 9
4: 70
1073446603_1073446607 3 Left 1073446603 10:103584700-103584722 CCCATCCCGCAGAACTCACTCAA 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1073446607 10:103584726-103584748 GCAGCACAGCCGCGCGCTGCCGG 0: 1
1: 0
2: 1
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073446603 Original CRISPR TTGAGTGAGTTCTGCGGGAT GGG (reversed) Exonic
900950998 1:5858295-5858317 GAGAGTGGGGTCTGCGGGATGGG + Intergenic
903925278 1:26827136-26827158 TTGAGTGAGTTCCGCTGCCTCGG + Exonic
905369099 1:37473824-37473846 CTCAGTGAGTTCTGCGGTATGGG + Intergenic
908798709 1:67856756-67856778 TTGAGTGCCTTCTGTGGGCTGGG + Intergenic
910897325 1:92082498-92082520 TTGAGTGAGCTCTTAGGGATTGG + Intronic
912092000 1:106089728-106089750 TTGAGTGGCTTCTGTGGGCTAGG - Intergenic
913489870 1:119368911-119368933 TTGAGTGTGTTCTGTGTGCTTGG + Intronic
915340789 1:155175592-155175614 TGGGGAGAGTTCTGCGGGAGAGG - Exonic
921732839 1:218596508-218596530 TTTAAAGAGTGCTGCGGGATGGG + Intergenic
1065377713 10:25059962-25059984 TTGTGTGCGTTCTGTGGGGTTGG + Intronic
1065687830 10:28303189-28303211 ATGAGGGAGTTCTGCTGGAGAGG - Intronic
1069049664 10:63779076-63779098 GTGAGTGAGTCCAGCGGTATGGG - Intergenic
1069534153 10:69240823-69240845 CTGAGTGAATTCGGCGGGAAGGG + Intronic
1073446603 10:103584700-103584722 TTGAGTGAGTTCTGCGGGATGGG - Exonic
1076614993 10:131749233-131749255 TTCAGTGAGTTTTGGGGGAGGGG + Intergenic
1079039256 11:17046969-17046991 TTCAGTGAGTGCTGAGGGACAGG + Intergenic
1089874211 11:121704453-121704475 TTGAGTGAATTCAGCTGGGTGGG - Intergenic
1092812248 12:12282497-12282519 TTGAGTGAGATCTGAGGATTAGG + Intergenic
1093071028 12:14707591-14707613 TTTAAAGAGTGCTGCGGGATGGG + Intergenic
1096104926 12:48991577-48991599 TGGAGTAAGTTCTGGGGGAAGGG + Intergenic
1096806110 12:54142051-54142073 TTGAGTCAGTTCTGCAAGAGTGG + Intergenic
1096966152 12:55629685-55629707 TTCAGTGAGCTCTGGGGTATAGG + Intergenic
1097359746 12:58645832-58645854 TTGAGTTAGATTTGCAGGATGGG - Intronic
1102583622 12:113908084-113908106 TTGAGTGAGGTGTGTGGGGTGGG - Intronic
1110705341 13:78597364-78597386 CTGAGTGAGTCCTGCGGGCTTGG + Intergenic
1112736095 13:102420701-102420723 ATGAGTGAGTTCTGTGCAATGGG - Intergenic
1119776323 14:77251170-77251192 TTTAGTCAGTTCTCCGTGATTGG + Intronic
1121677968 14:95769892-95769914 TTGACTCAGTTCTGCATGATTGG + Intergenic
1128092172 15:64926552-64926574 TAGTGTGAGTTCTGAGGGACTGG + Intronic
1129254748 15:74327776-74327798 TGGAGTGAGTCCTGGGGGAGGGG - Intronic
1132633960 16:933794-933816 TTGACTGCGTTGTGTGGGATGGG + Intronic
1135559181 16:23462109-23462131 TTGTCTGAGTTCTGTGGGGTGGG - Intergenic
1137845774 16:51686489-51686511 TTGAGTGAGTGCTGCTGGCAAGG - Intergenic
1139839624 16:69868007-69868029 TTGAGTGAGTTCTCCAAGAGAGG + Intronic
1141253076 16:82376410-82376432 TTGAGTGCTTTATGCTGGATAGG + Intergenic
1146590627 17:34125430-34125452 TAGAGTGGGTTCTGTGGAATTGG - Intronic
1146732727 17:35208894-35208916 TTGAGTGTGTTGTGGGGGAGGGG - Intergenic
1146943184 17:36858011-36858033 TGGAGTGAGTTATGGGGGAGGGG + Intergenic
1153859885 18:9191885-9191907 TTCAGTGGGTTCTGGGGTATGGG - Intronic
1156603253 18:38635713-38635735 TTAAGTGATTTCTGTGGGACTGG + Intergenic
1157331683 18:46708638-46708660 TTCAGTGGGTTCTGGGGCATAGG - Intronic
1159451671 18:68610594-68610616 TTCAGTGAGTTTTGGGGGCTTGG + Intergenic
1159742380 18:72188564-72188586 TTGTGTGTGTTTTGGGGGATGGG - Intergenic
1168622500 19:57890563-57890585 CTGAGTGGGTTCTGGGGGAGAGG + Intronic
933275487 2:80279358-80279380 TTGAGTGTCTTCTCCAGGATTGG + Intronic
934947339 2:98551398-98551420 TTGAGTGCGGTCTGCTGCATGGG + Intronic
936251686 2:110872791-110872813 GTGTGTGAGTGCTGGGGGATAGG + Intronic
937986091 2:127638766-127638788 TTGAGTGAGTGGTGAGGGATTGG + Exonic
938197804 2:129345858-129345880 TAGTTTGATTTCTGCGGGATGGG - Intergenic
941538092 2:166745784-166745806 TACAGTGATATCTGCGGGATGGG + Intergenic
942924180 2:181411901-181411923 TTGAGTGACATCTGCAGGCTTGG + Intergenic
946305997 2:218857430-218857452 TAGAGTGAGTGCTGCAGGAGGGG + Intergenic
947606045 2:231486386-231486408 TTGGGTGAGTTCAGTGGTATTGG - Intergenic
1169101247 20:2951573-2951595 TTCAGTGAGTTCTGCAGCATAGG - Intronic
1174781632 20:53394840-53394862 TTTGGTGAGTTCTGGGGGACAGG - Intronic
1175086070 20:56460050-56460072 TTGAATTAGTTCTGTGAGATTGG + Intronic
1180129136 21:45815057-45815079 TTGAGTGAGTGATGAGTGATGGG + Intronic
1181823789 22:25496601-25496623 TTGTGTAAGTTCTGTGGGACTGG - Intergenic
1182817715 22:33180894-33180916 ATTAGTGATTTCTGGGGGATAGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184540172 22:45117252-45117274 TGAAAGGAGTTCTGCGGGATTGG + Intergenic
950300341 3:11871776-11871798 TTGAGTGATTGCTGAAGGATGGG + Intergenic
951764699 3:26184835-26184857 TTGAGTGAGAGCTACGGGAAGGG - Intergenic
953377001 3:42437056-42437078 TTCAGGGGGTTCTGGGGGATAGG - Intergenic
957781404 3:84822040-84822062 TTGAGTGAGTTCCTTGGTATGGG + Intergenic
958070196 3:88600107-88600129 TTGAGTGAGATCTACAAGATAGG - Intergenic
960434553 3:117609709-117609731 TTGAGTGATTTCTGGGGCAGAGG - Intergenic
965070456 3:163910539-163910561 TTTAAAGAGTTCTGTGGGATGGG - Intergenic
966880609 3:184348060-184348082 TTAAGTGAGTTCTGAGTAATTGG - Intronic
968823190 4:2872118-2872140 TTGAGTGACATCTGGGGGATGGG + Intronic
973294882 4:48507507-48507529 TTGAGTGAGTTTTGGCCGATAGG - Intronic
975288331 4:72646485-72646507 TTGAGTGCGTTCTCTGGGAAGGG + Intergenic
982401132 4:154968968-154968990 TTGAGTGGTTTCTGCAGGGTAGG + Intergenic
988525950 5:31987684-31987706 TGGAGTGGGTTCAGCGGTATGGG - Intronic
1000295378 5:159908961-159908983 TTGAGTGAGTGCTCGGGGAATGG - Intergenic
1006353273 6:33537172-33537194 TTCAGTGAGTTCTGCCAGTTTGG - Intergenic
1013444422 6:110207854-110207876 TTGAGTGATTTCTACAGGGTTGG - Intronic
1013627790 6:111954808-111954830 TTGAGTGAGTTCTGACAGGTTGG + Intergenic
1018693156 6:166365877-166365899 CTGAGGGAGTGCTGCGGGACTGG - Intronic
1020353630 7:7252684-7252706 TTGAGTGATTTCTTTGGGAGGGG + Intergenic
1022291921 7:29013304-29013326 TTGAGTGAGCTCAGCTGGGTGGG - Intronic
1024963902 7:55005052-55005074 TGGGTTGATTTCTGCGGGATGGG - Intergenic
1027986076 7:85292048-85292070 TTGCCTGAGTTCAGCTGGATGGG + Intergenic
1032937019 7:136744851-136744873 TTGTGTGAGTTCTGCAACATTGG - Intergenic
1034918272 7:155058653-155058675 TTGCCTGAGTTCTGTGGGACAGG + Intergenic
1037127473 8:15368600-15368622 TTAAATGAGGTCTTCGGGATGGG + Intergenic
1045092133 8:98756906-98756928 TTGAGTGGGTTCTGGGGCATAGG - Intronic
1045405335 8:101860735-101860757 TTGAGGGAGAGCTGCGGAATGGG + Intronic
1046021679 8:108672721-108672743 TTCAGAGAGATCTGAGGGATAGG - Intronic
1049797998 8:144505303-144505325 TAGAGTGGGTACTGGGGGATGGG - Exonic
1050787343 9:9422096-9422118 TTGAGTGTGTACTGTGTGATTGG + Intronic
1053055335 9:34990252-34990274 TTGAGTAGGTTCTTGGGGATTGG + Intronic
1053449240 9:38179579-38179601 TTGAGTGAGTTCACTGGGGTGGG - Intergenic
1056932504 9:90890581-90890603 TTCAGTGAGTTCTGCAGGCTTGG + Intronic
1062121295 9:134835402-134835424 TTGGGAGAGTTCTGTGGGTTAGG + Intronic
1193445639 X:81598294-81598316 ATGAGTGGGTTCTGGGGGACAGG - Intergenic
1193840946 X:86407371-86407393 TTGACTGAGTATTGAGGGATAGG - Intronic
1197706224 X:129636511-129636533 CTGAGTGAGCTCAGAGGGATGGG - Intergenic
1201063863 Y:10070536-10070558 TTGGGGGGGTTGTGCGGGATGGG + Intergenic