ID: 1073446712

View in Genome Browser
Species Human (GRCh38)
Location 10:103585262-103585284
Sequence CCCGGATCGTCCCCGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073446712_1073446715 -10 Left 1073446712 10:103585262-103585284 CCTGGAGGCGGGGACGATCCGGG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1073446715 10:103585275-103585297 ACGATCCGGGTAGGAGACAAAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1073446712_1073446721 21 Left 1073446712 10:103585262-103585284 CCTGGAGGCGGGGACGATCCGGG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1073446721 10:103585306-103585328 CCCTTCCTCCAGGCTCATGATGG 0: 1
1: 0
2: 0
3: 26
4: 283
1073446712_1073446718 11 Left 1073446712 10:103585262-103585284 CCTGGAGGCGGGGACGATCCGGG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1073446718 10:103585296-103585318 GGGCGAGCTCCCCTTCCTCCAGG 0: 1
1: 0
2: 1
3: 16
4: 212
1073446712_1073446716 -9 Left 1073446712 10:103585262-103585284 CCTGGAGGCGGGGACGATCCGGG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1073446716 10:103585276-103585298 CGATCCGGGTAGGAGACAAAGGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073446712 Original CRISPR CCCGGATCGTCCCCGCCTCC AGG (reversed) Intronic
900586163 1:3433292-3433314 CCCGGATTCTCCCCGCAGCCTGG - Intronic
900642911 1:3695826-3695848 CCTGGATCGTCCCAGCCTGCAGG - Intronic
903263622 1:22143670-22143692 CCCGGCCCCTCCCTGCCTCCTGG + Intronic
903703405 1:25267509-25267531 GCCGGGAAGTCCCCGCCTCCTGG + Intronic
903712672 1:25337838-25337860 GCCGGGAAGTCCCCGCCTCCTGG + Intronic
903925214 1:26826883-26826905 CCCGCCGCGTCCCCGACTCCGGG + Exonic
904104171 1:28063555-28063577 CCAGGATGGTCCCAGACTCCTGG + Intronic
914942734 1:152037065-152037087 CCCCGCCCCTCCCCGCCTCCCGG + Intronic
1065390170 10:25174966-25174988 CGCAGGTCGTTCCCGCCTCCCGG - Intergenic
1065415914 10:25486061-25486083 CCTTGATCTTCCCAGCCTCCAGG + Intronic
1065744927 10:28831869-28831891 CCTGCAACCTCCCCGCCTCCCGG + Intergenic
1065844783 10:29735754-29735776 CCCGGCTCTTCCACACCTCCCGG + Intronic
1068673257 10:59744438-59744460 CGCGGCTGCTCCCCGCCTCCCGG - Intergenic
1069155536 10:65025611-65025633 CCTTGATCGTCCCTGCCTTCTGG + Intergenic
1073446712 10:103585262-103585284 CCCGGATCGTCCCCGCCTCCAGG - Intronic
1076869415 10:133186083-133186105 CCCGGCTCGTCTCAGACTCCGGG - Exonic
1077582078 11:3423117-3423139 CCGGACTCGGCCCCGCCTCCCGG - Intergenic
1079251677 11:18791837-18791859 CCCGGCTCCGCCCCGCCCCCGGG + Exonic
1081720703 11:45286255-45286277 CCCGGGCCGGGCCCGCCTCCAGG + Exonic
1083758426 11:64803265-64803287 CCCGGCGCGGCCCCGCCCCCGGG - Intergenic
1084239120 11:67806294-67806316 CCCTAACCGGCCCCGCCTCCCGG - Intergenic
1084833437 11:71786906-71786928 CCGGACTCGGCCCCGCCTCCCGG + Intergenic
1084944457 11:72631228-72631250 CACGGATGGCCCCCTCCTCCAGG + Intronic
1088314925 11:108498101-108498123 CCCCGCGCGTCCCCGCCGCCCGG - Intronic
1089479311 11:118791865-118791887 CCCGGAGCCTACCCGCCGCCAGG - Intergenic
1089500442 11:118928813-118928835 CCCGGATCGGCTCTTCCTCCAGG - Intronic
1091237697 11:134032980-134033002 CCCGCCTCGTCCCAGCCTCTTGG - Intergenic
1092056528 12:5512355-5512377 CCCGCACCGTCCCTGCCCCCTGG - Intronic
1093685257 12:22046840-22046862 CCCCAACCGTCCCCTCCTCCCGG + Intronic
1096678937 12:53242123-53242145 CCCCGCTTGTCCCAGCCTCCCGG + Intergenic
1097155099 12:57006544-57006566 CCCGGGCCGCCCCCGCCGCCCGG + Intergenic
1097264590 12:57738062-57738084 CCCGGCTCCTCCGCGCCTCGGGG + Exonic
1098105998 12:67069400-67069422 CCCGGCCCGGCCCGGCCTCCCGG - Intergenic
1103520989 12:121537083-121537105 CCCGGAGAGGCCCCTCCTCCCGG + Intronic
1105005389 12:132718006-132718028 CCCGGATCGAGGCCGCCTTCCGG + Exonic
1105424364 13:20282461-20282483 CCCGGATCCTGCCTGCTTCCTGG - Intergenic
1107014249 13:35695862-35695884 CTCTGATCATCCCGGCCTCCTGG - Intergenic
1107768715 13:43766502-43766524 CCACAATCGTCCCAGCCTCCGGG + Intronic
1111331333 13:86763958-86763980 CCCGCATTGACCCCACCTCCTGG - Intergenic
1113378961 13:109786187-109786209 CCCGGACCTTCCCCACCGCCTGG - Exonic
1117647255 14:57865568-57865590 CCCGGGGGGTCCCCGCCGCCAGG + Intronic
1121876522 14:97458126-97458148 CCAGGGTCTTCCCCGCTTCCTGG + Intergenic
1122055423 14:99094986-99095008 CCTGGCTCGCCCCAGCCTCCCGG - Intergenic
1122937926 14:104968396-104968418 CTCGGCCCCTCCCCGCCTCCCGG - Intronic
1125700987 15:41683439-41683461 CCAGGTTGGTCCCTGCCTCCTGG + Intronic
1128524451 15:68402971-68402993 CCCGGGTCATCCCTGGCTCCAGG - Exonic
1128944558 15:71811844-71811866 CCTGGTTCATCCCCGCCTGCAGG - Exonic
1131825947 15:96322659-96322681 CCCGGACCGTGCGCACCTCCCGG - Intergenic
1132028474 15:98421741-98421763 CCCGGGGCGCGCCCGCCTCCTGG - Intergenic
1133350656 16:5098346-5098368 CCGGACTCGGCCCCGCCTCCCGG - Intergenic
1133350783 16:5098706-5098728 CCCTAACCGGCCCCGCCTCCCGG - Intergenic
1137300247 16:47142962-47142984 CCCGGCTTGTCCCGGCCCCCGGG - Intronic
1141557007 16:84842915-84842937 CCCAGATGCTTCCCGCCTCCCGG + Intronic
1142638140 17:1270458-1270480 CGCGGACGGTCCCCGGCTCCTGG - Intergenic
1143148251 17:4790143-4790165 CCCGGGTCGCCGCCGCCTGCTGG + Exonic
1143524709 17:7465521-7465543 CCAGGCTCGTCCCAGACTCCTGG + Intronic
1146054388 17:29573931-29573953 CCCGGACAGTCCCTGGCTCCAGG + Exonic
1150373653 17:64662350-64662372 CCCGTCTCCTCCCCGCCCCCCGG - Intergenic
1150562126 17:66303050-66303072 CCCCGCTCCTCCCCGCCTCCGGG + Intronic
1151954392 17:77373271-77373293 CCCGCCCCGCCCCCGCCTCCCGG - Intronic
1152703906 17:81833198-81833220 CCCGCCCCGTCCCCGCCGCCCGG + Intronic
1156350412 18:36297606-36297628 TCCGGCTCCTCCCCTCCTCCGGG - Intergenic
1160706622 19:532847-532869 CCCGGCTCGGGCCCGCGTCCCGG + Intronic
1162101878 19:8343623-8343645 CCCGGATCTTCCCCACCGCAGGG + Intronic
1162296674 19:9818709-9818731 CCAGGTGCGGCCCCGCCTCCGGG - Exonic
1163551873 19:17969844-17969866 CCCAGATCCTGCCCTCCTCCAGG - Intronic
1166731032 19:45059178-45059200 GCCCCATCATCCCCGCCTCCTGG + Intronic
1168586737 19:57600062-57600084 CCCGGATCGTCCACCGCTCCCGG + Exonic
927714169 2:25341767-25341789 CCCGGCTCCCCGCCGCCTCCGGG + Intronic
933076893 2:77940116-77940138 CCCAGATAATCCCTGCCTCCAGG - Intergenic
942314186 2:174682888-174682910 CCCGGATGGTCGCAGCCTCCCGG - Intronic
944766653 2:202871508-202871530 CCCGCCGCGCCCCCGCCTCCCGG + Intronic
945241633 2:207681709-207681731 CCCTCATCGTCCGCGCCGCCCGG - Intergenic
946202176 2:218076761-218076783 CCAGGAAAGGCCCCGCCTCCTGG + Intronic
1170821383 20:19758281-19758303 CACCGGTCGCCCCCGCCTCCGGG + Intergenic
1174287681 20:49483974-49483996 CGCGCATCGTCCCGGCCGCCCGG + Intergenic
1174556134 20:51396979-51397001 CTCGGCTCATCTCCGCCTCCAGG + Intronic
1175303741 20:57961443-57961465 TCCAGAGCGTCCCCGCTTCCTGG + Intergenic
1176239004 20:64067368-64067390 CCCGGCACTTCCCAGCCTCCTGG - Intronic
1178416947 21:32412286-32412308 CCCCGATCGGCCCCGCCCCGGGG + Intronic
1178460378 21:32797080-32797102 TCAGGATGGTCCCTGCCTCCTGG + Intronic
1179641340 21:42749401-42749423 CCCAGATCGGCCCAGCCCCCTGG + Intronic
1181520567 22:23447058-23447080 TCCTGATGGTCCCCACCTCCAGG - Intergenic
951786100 3:26420963-26420985 CCCTAATCATCCCTGCCTCCTGG + Intergenic
957054923 3:75435693-75435715 CCGGACTCGGCCCCGCCTCCTGG - Intergenic
968997861 4:3956359-3956381 CCCTAACCGGCCCCGCCTCCCGG - Intergenic
969756267 4:9152653-9152675 CCGGACTCGGCCCCGCCTCCCGG + Intergenic
969816462 4:9691461-9691483 CCCTAACCGGCCCCGCCTCCCGG + Intergenic
980923860 4:139115231-139115253 CCCTCATCGTCCGCGCCGCCCGG + Intronic
982198242 4:152936675-152936697 ACCGGCGCGTCCTCGCCTCCAGG - Intronic
983198759 4:164838017-164838039 CCCTAATGGTCCCTGCCTCCTGG + Intergenic
986091434 5:4512238-4512260 CCCGGAGCCGCCTCGCCTCCCGG - Intergenic
986723523 5:10577462-10577484 CCAGGATGGGCCCCGACTCCAGG - Intronic
990576787 5:57130989-57131011 CCAGGCTCGTCTCCACCTCCTGG + Intergenic
996698398 5:126423534-126423556 CCCGGCTCGTCCCGGCTTCTAGG - Intronic
997125602 5:131223970-131223992 CACGGATCATTCCCTCCTCCTGG + Intergenic
1001422701 5:171599567-171599589 GCCGGATCCTCCCCACCTCTCGG + Intergenic
1002046449 5:176543988-176544010 GCCCCACCGTCCCCGCCTCCTGG + Intronic
1002563964 5:180099846-180099868 CGGGGATCGTCCCTGCCTCCTGG - Intergenic
1006025224 6:31142542-31142564 CCAGGATCCTCCCAGCCCCCAGG + Exonic
1006103760 6:31703375-31703397 CCCGTACCGGCTCCGCCTCCGGG + Exonic
1006811112 6:36821219-36821241 CACGGCCCGCCCCCGCCTCCAGG - Intronic
1007807629 6:44462450-44462472 CCCGGGTCATCCCCTACTCCAGG + Intergenic
1011734469 6:90297155-90297177 CCCGGAGAGCCCCCTCCTCCCGG + Intergenic
1013517350 6:110900550-110900572 CCAGGCTGGTCCCCACCTCCTGG + Intergenic
1014766445 6:125411971-125411993 CCCGGCTCCTCCCTTCCTCCTGG - Intergenic
1017532960 6:155314728-155314750 CCCGCCTCGTCCCGCCCTCCTGG - Intergenic
1018613237 6:165662741-165662763 CCCGGCTCGTCCCCGGCCGCTGG + Intronic
1019354553 7:571857-571879 GCTGGACCGTCCCCGCCTCCGGG + Intronic
1019590673 7:1829184-1829206 TCCTGATGGTCCCCACCTCCAGG + Intronic
1020133072 7:5570341-5570363 CGCGGCTCATCCGCGCCTCCAGG - Intergenic
1026968410 7:74454240-74454262 CCCCGATCCCCTCCGCCTCCGGG + Intronic
1032283379 7:130523885-130523907 CCCGGCTCCTCCGCTCCTCCTGG - Intronic
1032284121 7:130528110-130528132 CCCGGCTCCTCCGCTCCTCCTGG - Intronic
1033707018 7:143900198-143900220 CCCCGATAATCCCTGCCTCCAGG + Intronic
1034063764 7:148117427-148117449 CCCGGCTCCTCACCTCCTCCAGG + Intronic
1034428687 7:151028831-151028853 CCCCGAGCGTCCCCTCCTTCTGG - Intronic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1036294978 8:7528352-7528374 CCCGCATCTCCCCTGCCTCCAGG - Intergenic
1036327586 8:7792639-7792661 CCCGCATCTCCCCTGCCTCCAGG + Intergenic
1036379507 8:8227961-8227983 CCGGACTCGGCCCCGCCTCCCGG + Intergenic
1036567102 8:9946994-9947016 CCCCAAATGTCCCCGCCTCCTGG - Intergenic
1036850051 8:12194654-12194676 CCGGACTCGGCCCCGCCTCCCGG - Intergenic
1036871415 8:12436927-12436949 CCGGACTCGGCCCCGCCTCCCGG - Intergenic
1038543978 8:28411895-28411917 CGCGGGTTGTCCCCGCCTCGAGG - Intronic
1041798774 8:61775239-61775261 GCCAGATCCTCCCTGCCTCCTGG + Intergenic
1048208003 8:132431114-132431136 CCCAGCTCATCCCAGCCTCCTGG + Intronic
1049346022 8:142139097-142139119 CCCGGTTCCACCCCTCCTCCTGG - Intergenic
1049720719 8:144114283-144114305 CCTCGATCGTGCCCGCCTCCGGG - Exonic
1055091141 9:72365361-72365383 CCCGTCTCGGCCCCGCCTCCTGG - Intergenic
1057618885 9:96618612-96618634 CCCCGAACGCCTCCGCCTCCCGG - Intronic
1060695650 9:125707031-125707053 CCCGGCTCCCCCACGCCTCCCGG + Exonic
1061008866 9:127943630-127943652 CCCCGAGAGTCCCCGACTCCAGG - Intronic
1062282777 9:135759387-135759409 CCCGGAGCCTCCCTGCCTGCCGG - Intronic
1185731841 X:2467884-2467906 CCTGCAACCTCCCCGCCTCCTGG - Intronic
1187798408 X:23030908-23030930 CCCCCAGTGTCCCCGCCTCCTGG + Intergenic
1190776838 X:53559447-53559469 CCGGGGTCGGGCCCGCCTCCTGG - Exonic