ID: 1073447146

View in Genome Browser
Species Human (GRCh38)
Location 10:103588520-103588542
Sequence AGCCCCTGACTTCAAAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073447146_1073447151 19 Left 1073447146 10:103588520-103588542 CCAGCTCTTTGAAGTCAGGGGCT 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1073447151 10:103588562-103588584 CACGGGGCCTGATGCCTGGTAGG No data
1073447146_1073447153 26 Left 1073447146 10:103588520-103588542 CCAGCTCTTTGAAGTCAGGGGCT 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1073447153 10:103588569-103588591 CCTGATGCCTGGTAGGTCCTTGG No data
1073447146_1073447147 1 Left 1073447146 10:103588520-103588542 CCAGCTCTTTGAAGTCAGGGGCT 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1073447147 10:103588544-103588566 TCTCTAGCTTTCTGTCTGCACGG No data
1073447146_1073447148 2 Left 1073447146 10:103588520-103588542 CCAGCTCTTTGAAGTCAGGGGCT 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1073447148 10:103588545-103588567 CTCTAGCTTTCTGTCTGCACGGG No data
1073447146_1073447149 3 Left 1073447146 10:103588520-103588542 CCAGCTCTTTGAAGTCAGGGGCT 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1073447149 10:103588546-103588568 TCTAGCTTTCTGTCTGCACGGGG No data
1073447146_1073447150 15 Left 1073447146 10:103588520-103588542 CCAGCTCTTTGAAGTCAGGGGCT 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1073447150 10:103588558-103588580 TCTGCACGGGGCCTGATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073447146 Original CRISPR AGCCCCTGACTTCAAAGAGC TGG (reversed) Intronic
900782229 1:4625733-4625755 AGGGCCTGACTCCAAGGAGCTGG + Intergenic
901047187 1:6404123-6404145 AGCACTTGACTTTAAAGATCAGG - Intergenic
901128112 1:6943382-6943404 GGCACCTGATTTCAGAGAGCGGG + Intronic
902032931 1:13436043-13436065 AGCCCCTGCCTTCCTAGAGCTGG - Intergenic
903403895 1:23080270-23080292 AGCCTCTAACTTCACAGAGGGGG + Intronic
903424499 1:23243921-23243943 AGCCTCTGCCCTCAAGGAGCTGG + Intergenic
904852208 1:33467707-33467729 AGATCCTGACTTTAAAGGGCTGG + Intergenic
905676704 1:39830980-39831002 AGTTCCTGTCTTCAGAGAGCTGG - Intergenic
907018747 1:51044143-51044165 TGCCTCAGCCTTCAAAGAGCTGG + Intergenic
907238495 1:53067471-53067493 AGGCCCTTACTTCAGAGAACTGG + Intronic
908331470 1:63074853-63074875 AGACCAAGACCTCAAAGAGCTGG + Intergenic
910165369 1:84322185-84322207 AGTCCCTGCCCTCAAGGAGCCGG - Intronic
913191580 1:116417762-116417784 AGCTCCTGACTTTAGAGACCAGG + Intergenic
915622437 1:157093979-157094001 AGCCCCTGCCCCCAAAGAGTTGG - Intronic
918798876 1:188944871-188944893 AGCCCCTGACATTCAGGAGCTGG - Intergenic
918952004 1:191151536-191151558 AGCCCCTCACTGCCCAGAGCCGG - Intergenic
922001008 1:221478188-221478210 AGCCCCAGCCTTCAGAGAGCAGG - Intergenic
922309974 1:224379219-224379241 AGCTCTTAACTTCAAAGACCAGG - Exonic
922317876 1:224458457-224458479 AGCTCCTGACATCAGAGAGAAGG + Intronic
923183060 1:231541744-231541766 ATCCCCTTAGTTCACAGAGCCGG - Intronic
1064310713 10:14209494-14209516 ATCTCCTGACCTCAAAGTGCTGG - Intronic
1064751040 10:18529369-18529391 AGCCCCTTCCCTCAAGGAGCTGG + Intronic
1067948079 10:50703601-50703623 AGGCCCTTACCTCAAGGAGCTGG - Intergenic
1069589820 10:69634815-69634837 TGCGCCTGACTAGAAAGAGCGGG + Intergenic
1069841937 10:71345462-71345484 AGCACATGACTTCCAAGACCAGG - Intronic
1070883391 10:79868599-79868621 AGGCCCTGACCTCAAGGAGCTGG - Intergenic
1071417542 10:85455243-85455265 AGCCCCTAGCCTCACAGAGCAGG + Intergenic
1073447146 10:103588520-103588542 AGCCCCTGACTTCAAAGAGCTGG - Intronic
1074326536 10:112456091-112456113 AGTCTCTGCCTTCAAGGAGCCGG + Intronic
1074752134 10:116596694-116596716 TGCCCTTGATTTCAAAGAGAAGG - Intronic
1075076650 10:119356138-119356160 AGTCCCTGGTTTCATAGAGCTGG - Intronic
1076587171 10:131557061-131557083 AGCCACTGACATCCAGGAGCTGG - Intergenic
1077459518 11:2701791-2701813 TGCCCCTGACCAAAAAGAGCAGG + Intronic
1077715537 11:4576350-4576372 AGCCCCTGACTGAAATGAGGTGG - Intronic
1078266708 11:9760305-9760327 AGACCCTGACTTCACTGGGCCGG + Intergenic
1079063741 11:17272228-17272250 AGCCTCAGCCTTCAAAGTGCTGG + Intronic
1079224193 11:18590793-18590815 AGGCCCTGACATCTGAGAGCTGG - Intergenic
1083608074 11:63990926-63990948 AGCTCCTGACTTCTAACAGTTGG + Intronic
1084050564 11:66596720-66596742 AGCTCCTGCCCTCACAGAGCTGG + Intronic
1084574146 11:69977772-69977794 TGCCCCTGTCTTCAGAGCGCTGG - Intergenic
1084691997 11:70732862-70732884 AGTCCCTGCCCTCACAGAGCCGG - Intronic
1088480353 11:110291245-110291267 AGCCCCGGAGTTCAAAGCCCTGG + Intronic
1088792238 11:113236049-113236071 GGCCCCTGGCTTCAAAAAGAAGG - Intronic
1089080103 11:115768517-115768539 AACCCTTGACTTCAGGGAGCAGG - Intergenic
1091820129 12:3470160-3470182 AACCCCTGGTTTCAAATAGCAGG + Intronic
1091919012 12:4289696-4289718 AGCCTCTGAATTCAATCAGCAGG + Intronic
1093949075 12:25143471-25143493 AACTCCTGACCTCAAAGTGCTGG + Intronic
1094095019 12:26694099-26694121 AGCCCCTGACATCCAATAGGTGG + Intronic
1094777301 12:33745639-33745661 AGCCCCTGCCATCACAGACCTGG + Intergenic
1096446266 12:51695304-51695326 AGCCCCAGACTTCAAAGCTGAGG + Intronic
1097722634 12:63039906-63039928 AGCTCCTTGCTTCAAAAAGCAGG + Intergenic
1098529005 12:71519442-71519464 AGCCCCTGACCTCATGGAGCTGG - Intronic
1100663983 12:96730242-96730264 AGGTCCTGACATCATAGAGCTGG + Intronic
1101272232 12:103159797-103159819 GGTCCCTGTCTTCAAAGAGTTGG - Intronic
1102530568 12:113543491-113543513 ATCCCCCGATTTCAGAGAGCTGG - Intergenic
1104164151 12:126210385-126210407 AGCCCCTGATTGCATAAAGCTGG - Intergenic
1104292168 12:127480905-127480927 ATCCCCTGTCTCCAAAGAGAAGG + Intergenic
1104595162 12:130115758-130115780 AGGCTGTGGCTTCAAAGAGCAGG + Intergenic
1110516958 13:76425016-76425038 AGTCCCTGACTTAGAATAGCTGG + Intergenic
1111925336 13:94457883-94457905 AGCCCCTGACATTCAAGAGCTGG + Intronic
1111925543 13:94459607-94459629 AGCACCTGACATCCAAGAGCTGG - Intronic
1112713025 13:102152027-102152049 AGCCCCTGACTGCCAAGTGGTGG + Intronic
1112803036 13:103133225-103133247 AGCCCTTGACTTCAAACAGTTGG + Intergenic
1112928434 13:104705652-104705674 AACCCCTGACCGCAAAGTGCTGG - Intergenic
1114383197 14:22230773-22230795 AGCTCCTGAGTTCATAGACCAGG + Intergenic
1114942007 14:27624038-27624060 AGCCCCTGACATCACAGGCCTGG - Intergenic
1118396879 14:65345172-65345194 AGGCCCTGCCCTCAAGGAGCTGG - Intergenic
1118474915 14:66107732-66107754 AGATCCTCACTACAAAGAGCAGG + Intergenic
1119128986 14:72154514-72154536 GGTCCCTGACTTCCAACAGCTGG + Intronic
1119964183 14:78895122-78895144 AATACCTGACTTCAAAGGGCGGG - Intronic
1121558166 14:94854285-94854307 GGCCTCTGGCCTCAAAGAGCAGG - Intergenic
1122818028 14:104323622-104323644 AGCACCTGACCCCAAAGAGGTGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124206198 15:27723223-27723245 GCCCCCCCACTTCAAAGAGCAGG + Intergenic
1127130727 15:55859756-55859778 AGTCCCTAACATCCAAGAGCTGG + Intronic
1127677041 15:61249557-61249579 GGCTCCTGACTTCATGGAGCTGG - Intergenic
1128235030 15:66061242-66061264 CCACCCTGACTTCACAGAGCAGG + Intronic
1128315829 15:66658631-66658653 AACTCCTGACCTCAAAGTGCTGG + Intronic
1129276317 15:74448050-74448072 AGGCCCTTACTTCAAGCAGCTGG + Intronic
1130931193 15:88429277-88429299 AGCCTCTGCCTTGAAAGGGCTGG - Intergenic
1131425402 15:92341693-92341715 AGACCCTGCCCTAAAAGAGCAGG + Intergenic
1132752413 16:1464908-1464930 TGCCTCTGACTTCAGAGGGCAGG - Intronic
1132879790 16:2157006-2157028 AGCCCCTCACCCCCAAGAGCAGG - Intronic
1135615706 16:23909002-23909024 AACCCCTGCCTTCACAAAGCTGG - Intronic
1139304264 16:65969727-65969749 AGCCCCAAACATCACAGAGCTGG + Intergenic
1139565442 16:67772690-67772712 AGCCCCACTCTTCAAAGAGTGGG - Intronic
1140444270 16:75012168-75012190 AAGCCCTGAATTCAAAGTGCAGG + Intronic
1141365576 16:83439789-83439811 AGCCACTGACCTCCAGGAGCTGG - Intronic
1142191050 16:88717881-88717903 AACTCCTGACCTCAAAGTGCTGG - Intronic
1144944133 17:18961190-18961212 AGCCCCTGACTTTACAGAGAGGG + Intronic
1146314970 17:31799693-31799715 AACTCCTGACCTCAAAGTGCTGG - Intergenic
1150230113 17:63545168-63545190 AGCCCCTGCCTCCAATGACCTGG + Exonic
1150379243 17:64707752-64707774 AGCCCCCTACTTCATTGAGCTGG + Intergenic
1152754345 17:82080917-82080939 TGCCCCTGTCTTCACAGAGCTGG - Exonic
1157385046 18:47253342-47253364 AGCCCCTGACCCCAGAGAGGAGG - Intergenic
1157582031 18:48779222-48779244 AGCCAGTGACTGCAGAGAGCTGG - Intronic
1158568632 18:58577231-58577253 TGCCCCAAATTTCAAAGAGCTGG - Intronic
1158791363 18:60784354-60784376 AGCCCCTTACATCACAGAGCTGG + Intergenic
1160155849 18:76433374-76433396 GGCCCCTGTCTTCAATGAGATGG + Intronic
1161043682 19:2123296-2123318 GACCCCTAACTTCACAGAGCTGG + Intronic
1161197579 19:2995513-2995535 AACCCCCGACCTCAAAGTGCTGG - Intergenic
1163745318 19:19043336-19043358 AGACCCTGACTGCAGGGAGCAGG + Intronic
1166067889 19:40370714-40370736 AGCCCCAGGCTTCCAGGAGCAGG - Intronic
1166378984 19:42344653-42344675 ACCCCCTGTCTTCTCAGAGCAGG + Exonic
925026150 2:608836-608858 AGCCCCTGTTCTGAAAGAGCTGG - Intergenic
926258140 2:11228567-11228589 AGTGCCTGACTTCAAAAGGCAGG + Intronic
927004544 2:18834351-18834373 TGTCCCTGACTTCACAGACCAGG + Intergenic
927243725 2:20940409-20940431 TGGCCTTGACTTTAAAGAGCAGG + Intergenic
927633314 2:24793152-24793174 AGCCGCTTACCTCCAAGAGCTGG - Exonic
928323373 2:30301467-30301489 AGCTCCAGAAGTCAAAGAGCTGG - Intronic
930420892 2:51151868-51151890 AGCCCCTCACTGCCCAGAGCTGG + Intergenic
931182029 2:59911988-59912010 AGACCATGACTTTAAAGTGCTGG - Intergenic
933631939 2:84668937-84668959 AGCCTCTGTCTTCAATGACCTGG - Intronic
933787442 2:85854756-85854778 AGCCCCTGTCTCCCAAGACCTGG + Intronic
935451888 2:103219505-103219527 AGCCCCTGACCTCCAGAAGCTGG + Intergenic
937228159 2:120381660-120381682 AGCCCCTGCCTTCATTAAGCTGG + Intergenic
937427596 2:121813244-121813266 AGCCCCTGCCGTCACAGACCCGG + Intergenic
938323601 2:130382311-130382333 AGCCCCTGACATGCAGGAGCTGG + Intergenic
939754159 2:146088996-146089018 AGCCCCTGACCTACAGGAGCTGG + Intergenic
940295426 2:152117683-152117705 AGCCCCTGAGTTCTAGGAGAGGG - Exonic
943861429 2:192869068-192869090 AGCCCTTAATTTCAAATAGCTGG + Intergenic
947665315 2:231901591-231901613 AACTTCTGACTTCAAAGATCTGG - Intergenic
947837299 2:233184870-233184892 AGGTCCAGACCTCAAAGAGCCGG + Intronic
948696830 2:239736988-239737010 AGCTCCTGCCTTGAAAGACCCGG - Intergenic
948991044 2:241554174-241554196 AGCCCCTGACGGCACAGAACGGG - Intergenic
1169352316 20:4879034-4879056 AGTTCCTGACTTCAAAAGGCAGG + Intronic
1169658243 20:7950522-7950544 AGCATCTGACTTCAGAGACCTGG - Intergenic
1169903164 20:10573180-10573202 AGGCCCTGTTTTCAAAGGGCTGG - Intronic
1171182387 20:23100336-23100358 AGCCCCTGGCTTCAAGAAGCTGG - Intergenic
1174578448 20:51554035-51554057 ACTCCCTGACTTCAAAGATTAGG - Intronic
1178671283 21:34593813-34593835 AGTCCCTGCCCTCAAAGAGCAGG + Intronic
1178796661 21:35751309-35751331 ATCCACTGACTTCATAGAGTAGG + Intronic
1179317847 21:40260885-40260907 AGCCCCCGACATCCAGGAGCTGG + Intronic
1182514271 22:30844278-30844300 AACGCCTGACTTCAAAGGACAGG - Intronic
1182560890 22:31158260-31158282 AGCCCCTGACATCCAGGAGATGG - Intergenic
1182675357 22:32035002-32035024 GGGCCCTGACCTCACAGAGCAGG - Intergenic
1184265000 22:43342222-43342244 AGCCCCTGAAGACAGAGAGCAGG + Intronic
1184521829 22:44999100-44999122 AGTCCCTGACTGCCAACAGCGGG - Intronic
951571852 3:24072475-24072497 AGCCCATGAGTTCAAAGATCTGG - Intergenic
952076696 3:29705417-29705439 AGCCCCTGGCTTCAAAGAAAAGG - Intronic
952379575 3:32794360-32794382 AGCTCCTGCCTCCAAGGAGCTGG + Intergenic
952907815 3:38154541-38154563 AGCTCCTGAGTTCAGAGAGTGGG + Intergenic
952924311 3:38310000-38310022 AGCCCCTGAGTTCAAATCCCAGG - Intronic
953003802 3:38958927-38958949 AGCCTCTGACCTTAAAGAGAAGG - Intergenic
955990314 3:64620121-64620143 AGGCTCTGACTTCAAAGCCCAGG - Intronic
956608145 3:71094061-71094083 GGCCCCTGGCTTCAAAGTTCAGG - Intronic
956840922 3:73139166-73139188 AGCCCCTGAGGTCAAAGTGAAGG + Intergenic
961365016 3:126394252-126394274 TGCCCCTGGCTTCAAGCAGCTGG + Intergenic
962359775 3:134728591-134728613 AGCCCCTATCCTCAAGGAGCTGG + Intronic
965092241 3:164179359-164179381 AGCCCCTCACTGCACAGGGCCGG - Intergenic
965440688 3:168709802-168709824 ACCCCCTGACTGGAAAGAACTGG + Intergenic
967818120 3:193815977-193815999 GGCACCTGACATCAAAGAGCTGG - Intergenic
968383296 4:112892-112914 AGTCCCTGTCTTCCAGGAGCTGG - Intergenic
968929614 4:3571848-3571870 TGCCTCTGCCTTCAAAGTGCTGG + Intergenic
970020801 4:11566151-11566173 AGCCCCTGCCTTCTAGGAGCAGG - Intergenic
970573521 4:17405585-17405607 ACCCCCAGAATTCAATGAGCAGG + Intergenic
972619655 4:40734567-40734589 AGCCCCTGACATCTAAGGACTGG + Intergenic
973863669 4:55090576-55090598 TTCCCCTGATTTCAAAGTGCTGG + Intronic
977421530 4:96806722-96806744 AGCCCTCGACTGTAAAGAGCAGG - Intergenic
978207200 4:106092650-106092672 AGCCCCTCACTGCCCAGAGCCGG + Intronic
980407087 4:132366858-132366880 AGCCCCTGCCATCAAAGGCCTGG - Intergenic
986979017 5:13424880-13424902 AGTCCCTGCTTTCAAAGAACCGG - Intergenic
987352284 5:17032641-17032663 AGCCCCTCACTTCCAGGGGCCGG + Intergenic
987765546 5:22224171-22224193 AGGGTTTGACTTCAAAGAGCAGG - Intronic
988636505 5:32990001-32990023 AGCCCCTGACTGCACGCAGCAGG - Intergenic
992508104 5:77407475-77407497 GGCCCCTGACTGCAGAGTGCAGG - Intronic
992623093 5:78612753-78612775 AGGCGCAGTCTTCAAAGAGCTGG + Intronic
993407388 5:87528452-87528474 AGCTCCTGACATCCAAGAACTGG - Intergenic
997831340 5:137153135-137153157 GGCCCCTGGCCTCACAGAGCAGG - Intronic
998117409 5:139548821-139548843 ACCCACTGACTTCAAAGCCCTGG + Intronic
999809575 5:155114943-155114965 AGCCCCTCACTGCCCAGAGCCGG - Intergenic
1000610114 5:163364919-163364941 GGCACCTGACTTCAGAGAGGAGG + Intergenic
1001798983 5:174527008-174527030 TGCACCAGACTTCCAAGAGCTGG + Intergenic
1001860715 5:175052396-175052418 AGCCACTGACATCCAGGAGCTGG + Intergenic
1002102918 5:176866236-176866258 AGCCCCTCACATCAAAGATGGGG + Intronic
1002208466 5:177580722-177580744 GGCCTCTGTCTTTAAAGAGCTGG - Intergenic
1002835831 6:864470-864492 AGACCCTGACTGCACAGAACAGG + Intergenic
1003603322 6:7538769-7538791 AGCCACTGTCTTCCTAGAGCAGG + Intergenic
1004110158 6:12709811-12709833 AGCCCTTGATTTAAAAAAGCTGG - Intergenic
1007103533 6:39267965-39267987 TGCTCCTGTCTGCAAAGAGCTGG + Intergenic
1007201287 6:40111598-40111620 AGCCACTGACTCCCAATAGCAGG - Intergenic
1007275029 6:40667048-40667070 AGCCCCTGACATCCACGAGCTGG - Intergenic
1007732009 6:43953111-43953133 AGTCCCTGACTTCATGGAGCTGG - Intergenic
1010396315 6:75396443-75396465 AGTCCCTGACCTCACATAGCTGG - Intronic
1011883373 6:92059715-92059737 AGCCCCTCCCATCAAAGACCTGG + Intergenic
1012549040 6:100451091-100451113 AGACCCTGCTTTCAAGGAGCAGG + Intronic
1015128515 6:129783355-129783377 AGCCCTAGAATTCAAAGAGATGG + Intergenic
1018481054 6:164190716-164190738 AACCCCTGACATCAGAGAGGTGG + Intergenic
1018870546 6:167779095-167779117 GGTCCCTGGCTTAAAAGAGCTGG + Intergenic
1018881148 6:167882414-167882436 AACCCCTGACCTCAAAGTGCTGG - Intronic
1019532678 7:1511520-1511542 ACCCTTTGGCTTCAAAGAGCGGG + Intergenic
1019587253 7:1812365-1812387 AGCCCCTCACTTCTCAGAGTGGG - Intergenic
1020244323 7:6419243-6419265 AACTCCTGACCTCAAAGTGCTGG + Intronic
1023354806 7:39355988-39356010 AGCCCCTGACTTCTCTGACCAGG - Intronic
1023481356 7:40638151-40638173 AGCCACTGCCTTCAAATATCCGG + Intronic
1024115940 7:46193144-46193166 AGCCACTGTTTTCAAAGTGCTGG + Intergenic
1024557420 7:50615484-50615506 AGCTGCTGACTTCCCAGAGCCGG + Intronic
1029268084 7:99358188-99358210 AGCCCCTGACCTCAACTTGCAGG - Intronic
1032406376 7:131658879-131658901 AACTCCTGACCTCAAAGTGCTGG + Intergenic
1032576328 7:133059062-133059084 GTCCCTAGACTTCAAAGAGCAGG + Intronic
1032731094 7:134643798-134643820 AGCCCCTGAGTTCCCAGTGCTGG + Intergenic
1034150684 7:148912947-148912969 AGCCCCTAACTTTACAGATCAGG + Intergenic
1034481076 7:151320842-151320864 AGCCCCAGGATTCAAGGAGCTGG + Intergenic
1035152215 7:156884178-156884200 AGCCCCTGACATCTGGGAGCTGG + Intronic
1035395246 7:158530719-158530741 AGACCCAGACCACAAAGAGCTGG + Intronic
1036753549 8:11457543-11457565 AGCCCCTGCCTGCTAGGAGCTGG - Intronic
1038684276 8:29702274-29702296 AGCCCCTCACATCATAGACCTGG + Intergenic
1040289213 8:46115802-46115824 AGCCCCAGGCTTTAAAGAGGAGG - Intergenic
1041415151 8:57599797-57599819 AGCCCCTTAATCCAAAGAACTGG - Intergenic
1042071214 8:64936761-64936783 AGCTTCTGACTTTGAAGAGCTGG + Intergenic
1043871531 8:85438708-85438730 AGCCAATGAATTCCAAGAGCGGG - Intronic
1044248680 8:89981410-89981432 ATCCCCCGACTTCAAAGTTCGGG + Exonic
1045422203 8:102027099-102027121 AGCCCCTGCCATCAAAGGCCTGG - Intronic
1047514218 8:125539510-125539532 AGCCTCTGCCATCAAGGAGCTGG - Intergenic
1052831837 9:33221971-33221993 AGGCGCTGACTTAAAATAGCGGG - Intronic
1053225193 9:36348936-36348958 AGTGCCTGGCTTCAAAGAACAGG + Intronic
1054460666 9:65460623-65460645 TGCCTCTGCCTTCAAAGTGCTGG - Intergenic
1054768517 9:69063078-69063100 AGTCCCTGCCTCCAGAGAGCTGG - Intronic
1056574953 9:87849087-87849109 AGGTCTTGACCTCAAAGAGCTGG + Intergenic
1059039794 9:110800334-110800356 AGGCCATGTATTCAAAGAGCAGG - Exonic
1059385557 9:113961521-113961543 AGACCCTGGCCTGAAAGAGCTGG - Intronic
1060144006 9:121235416-121235438 AGCCACTGTCTTCCAAGGGCTGG + Intronic
1060537210 9:124399924-124399946 ATTCCCTGGCTTGAAAGAGCAGG + Intronic
1060557684 9:124517510-124517532 AGCCCTTGTCTCCAAAGGGCCGG - Exonic
1061079475 9:128361378-128361400 AGCCCCTGCCTCCAATGTGCTGG + Exonic
1186669254 X:11753555-11753577 AGCCTCTGACATCCAGGAGCTGG + Intergenic
1189759109 X:44303088-44303110 AGCCCCTGACATCCAGGAGCCGG + Intronic
1190219599 X:48503166-48503188 AGCCCCTGACATCCCAGAGCTGG + Intergenic
1190271074 X:48864157-48864179 AGTCCCTGACATCCAAGAACTGG + Intergenic
1190457400 X:50639603-50639625 GGCCCCTGCCTTCAACAAGCTGG + Intronic
1190911258 X:54774605-54774627 AGCCCCTGGCAGCAAAGAGCTGG - Intronic
1190919958 X:54841605-54841627 AGCCCCTGGCAGCAAAGAGCTGG + Intergenic
1195616896 X:106919893-106919915 AGACTCTGAGTTCAAAGAGCAGG - Intronic
1196062479 X:111425886-111425908 AGGCCATCTCTTCAAAGAGCAGG - Intergenic
1196842133 X:119868691-119868713 AGCCCCTGCCCTCATGGAGCTGG - Intergenic
1197201827 X:123754963-123754985 AACTCCTGACCTCAAAGTGCTGG + Intergenic
1199072805 X:143498262-143498284 AGCCCCTCCCATCAAAGGGCTGG - Intergenic
1200884220 Y:8252688-8252710 AGCCTCTGCCAACAAAGAGCGGG - Intergenic
1200986006 Y:9304039-9304061 AGCCCCTGCCAACAAGGAGCGGG - Intergenic