ID: 1073448625

View in Genome Browser
Species Human (GRCh38)
Location 10:103596010-103596032
Sequence ATTTAGCCAGAAACTCAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073448620_1073448625 14 Left 1073448620 10:103595973-103595995 CCACAGAGACATGAGACTGCACC 0: 1
1: 0
2: 0
3: 16
4: 215
Right 1073448625 10:103596010-103596032 ATTTAGCCAGAAACTCAGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 231
1073448623_1073448625 -7 Left 1073448623 10:103595994-103596016 CCAAACAGGGCTGATGATTTAGC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1073448625 10:103596010-103596032 ATTTAGCCAGAAACTCAGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073448625 Original CRISPR ATTTAGCCAGAAACTCAGGA AGG Exonic