ID: 1073448625

View in Genome Browser
Species Human (GRCh38)
Location 10:103596010-103596032
Sequence ATTTAGCCAGAAACTCAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073448620_1073448625 14 Left 1073448620 10:103595973-103595995 CCACAGAGACATGAGACTGCACC 0: 1
1: 0
2: 0
3: 16
4: 215
Right 1073448625 10:103596010-103596032 ATTTAGCCAGAAACTCAGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 231
1073448623_1073448625 -7 Left 1073448623 10:103595994-103596016 CCAAACAGGGCTGATGATTTAGC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1073448625 10:103596010-103596032 ATTTAGCCAGAAACTCAGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073448625 Original CRISPR ATTTAGCCAGAAACTCAGGA AGG Exonic
900478760 1:2888313-2888335 ATTTAGGGAGAACCTGAGGAGGG + Intergenic
901347578 1:8559968-8559990 ATTTAGCCAAGAACTTAAGAGGG + Intronic
901609347 1:10484828-10484850 ATTTGGCAAGAAACTGAGGGCGG - Intronic
901767107 1:11509442-11509464 AATTAGACAGAAAATCAGTAAGG - Intronic
902142526 1:14368634-14368656 ATTGAGCCAGAGGCTTAGGAGGG - Intergenic
903083651 1:20834825-20834847 ATCTAGACAGAAAATCAGTAAGG + Intronic
904083013 1:27883833-27883855 TTTCAGCCAGAGACTCAGGTAGG - Intronic
905523458 1:38618193-38618215 AGTTAGCCAGAAACAGTGGAGGG + Intergenic
907116615 1:51974382-51974404 ATTGAGTCAGAAACTCTGGTGGG - Intronic
909541230 1:76793839-76793861 AGTTAGTCAGAAATACAGGAGGG - Intergenic
911779554 1:101858982-101859004 ATTTCCCAAGAAAATCAGGAAGG + Intronic
911924046 1:103804290-103804312 ATTTAGTCAGAGATTCAAGAAGG + Intergenic
912586891 1:110775185-110775207 AATTAGCCAGAAACTGTGGCGGG + Intergenic
912717709 1:111993682-111993704 CTCCAGCGAGAAACTCAGGAGGG + Intergenic
915000285 1:152583193-152583215 ATGGAGACAGAAACTCAGAAAGG + Intronic
918336911 1:183524951-183524973 ATTTAGCTACAAGCTCATGAAGG + Intronic
918404887 1:184201976-184201998 ATTTAGGCACAAAGTTAGGAAGG + Intergenic
918406801 1:184219502-184219524 ATTTGGGCAGAATCTCTGGAGGG + Intergenic
919734965 1:200942281-200942303 ATGTAGACAGAAATTCAGCAAGG - Intergenic
924632651 1:245755432-245755454 AACTAGACAGAAACTGAGGAGGG - Intronic
924920144 1:248620421-248620443 ATTTAGCCGGAATTTTAGGAAGG - Intergenic
1064319151 10:14285939-14285961 ATTTAGTCAAAAACGCAAGATGG + Intronic
1066493469 10:35917773-35917795 ATTTATCCAGAATATCAGGAGGG - Intergenic
1072146318 10:92642501-92642523 AAATAGGCAGAAACTCAGTAAGG - Intronic
1072298927 10:94040332-94040354 ATTTAGGCAGAAAGGGAGGAGGG - Intronic
1073448625 10:103596010-103596032 ATTTAGCCAGAAACTCAGGAAGG + Exonic
1074191954 10:111145939-111145961 AATTAGCCAGTAACACAGGCAGG + Intergenic
1076225489 10:128771569-128771591 ATTTGGCCAGGAACTCAGGAAGG + Intergenic
1076331231 10:129670064-129670086 ATTTAGTCAGAAACTGAAGCTGG - Intronic
1078504298 11:11920177-11920199 ATTCAGCCAGAGATTCTGGATGG + Exonic
1078905083 11:15677299-15677321 ATGTAGACAGAAAATCAGCAAGG + Intergenic
1084234378 11:67777318-67777340 ATTTAGCCATAAAATCAGCAGGG + Intergenic
1084276044 11:68051452-68051474 ATTCTGCCAGCAACGCAGGAAGG - Intergenic
1084704651 11:70809132-70809154 AGTTGGCCAGAAATTCAGGACGG + Intronic
1086226405 11:84515677-84515699 ATTCAGACAGAAAATCAGCACGG + Intronic
1086829373 11:91540762-91540784 ATCTAGCCAGGAATTCTGGATGG - Intergenic
1088516073 11:110635321-110635343 ATTGAATCAGAAACTCTGGAGGG + Intronic
1089054741 11:115576478-115576500 GGATAGCCAGATACTCAGGAAGG - Intergenic
1089644251 11:119867911-119867933 ATTTTCCCAGAAACTCTGCAGGG - Intergenic
1090664268 11:128904632-128904654 TTTTAGCCAGATCCCCAGGAAGG + Intronic
1091223694 11:133945652-133945674 ATTCATCCATACACTCAGGACGG + Intronic
1092255053 12:6922364-6922386 ATTTAGCCAGACGTTCAGAACGG - Exonic
1093640050 12:21516421-21516443 ATATAGACAGATACTTAGGAGGG - Exonic
1093940190 12:25044856-25044878 ATTTAGACAGAAAATCAATAAGG + Intronic
1098098677 12:66988777-66988799 ATTTATCCAGTTACTCAAGAGGG + Intergenic
1098579079 12:72077386-72077408 ATTTAGCCAGAAACACAGCATGG + Intronic
1098744683 12:74220725-74220747 ATTTACCAAGTAACTCAGAATGG - Intergenic
1098881893 12:75925814-75925836 ATTTAGCCAGTACCCCAAGATGG + Intergenic
1101964086 12:109270223-109270245 AATTAGCCAGGAAGTCAGGGAGG - Intergenic
1103717337 12:122952586-122952608 ACTGAGGCAGAAACTCAGGCTGG - Intronic
1104061357 12:125271069-125271091 ATAGTCCCAGAAACTCAGGAGGG - Intronic
1104540430 12:129659223-129659245 GTTGTGTCAGAAACTCAGGAAGG - Intronic
1105255428 13:18741326-18741348 ATTTAGGCAGAAAATCAAGCGGG + Intergenic
1106345633 13:28874425-28874447 TGTTAGCCAGGAATTCAGGAAGG + Intronic
1106392532 13:29348606-29348628 ATGTAGACAGAAAATCAGTAAGG - Intronic
1109054113 13:57525482-57525504 AATTAGCATAAAACTCAGGAAGG - Intergenic
1109134461 13:58629103-58629125 AACTAGCCAGAAACTTAGTAGGG - Intergenic
1110501521 13:76233660-76233682 ATCTAGACAGAAAATCAAGAAGG + Intergenic
1113291903 13:108916368-108916390 ATTTAGGCATAAATTCAGCAGGG - Intronic
1114704248 14:24709383-24709405 ATTTAGCCATCAAGTTAGGAAGG + Intergenic
1115109200 14:29801152-29801174 AGCTAGCTAGAAACTCAGGCAGG + Intronic
1115281822 14:31671703-31671725 GTTTAGCCAGAAATTAAAGAAGG + Intronic
1116629155 14:47307196-47307218 ATTAAACCAGAAACTCAGATAGG - Intronic
1116664416 14:47756930-47756952 ATTTAGCTTGAAACTAAGAATGG + Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117987126 14:61397482-61397504 ATTTAGCAAGAAAACCAGCAAGG + Intronic
1118090698 14:62473826-62473848 AATTAGCCAGAAACTAGAGAAGG - Intergenic
1118367038 14:65104606-65104628 ATTAAGCCAGAACCTCTGAAGGG + Intergenic
1118675578 14:68181215-68181237 ATTTATCCAGTGACTCTGGAAGG + Intronic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1119413743 14:74455863-74455885 ATTCAGCCACCAACCCAGGAGGG - Intergenic
1120138968 14:80906013-80906035 GTTTATTGAGAAACTCAGGAGGG - Exonic
1121476529 14:94212512-94212534 ATTTAGCTAGAAATTTAGAAAGG + Intronic
1125198223 15:37072979-37073001 ATTTAGTAAGCAACTCAGAAAGG - Intronic
1125243245 15:37601343-37601365 ATTCAGCCTGATACTTAGGATGG - Intergenic
1125460823 15:39905075-39905097 ACTTGGCCAGAAGCTCAGAATGG + Intronic
1126370913 15:47946201-47946223 ATTTAGCCAGAAACATGGTATGG + Intergenic
1128542504 15:68545686-68545708 ATTCTGCCAGGAACTAAGGAAGG - Intergenic
1130780809 15:87038376-87038398 ATTTAGCCGGAGACTCAAAAGGG - Intergenic
1131451478 15:92543936-92543958 ATTCAGCCTGAATCTCAGGTGGG - Intergenic
1134365765 16:13577269-13577291 ATGTAGACAGAAAATCAGCAAGG + Intergenic
1134754648 16:16655931-16655953 ATTTAGGCAGAGACTCAGCTGGG - Intergenic
1134991413 16:18703111-18703133 ATTTAGGCAGAGACTCAGCTGGG + Intergenic
1135834724 16:25814854-25814876 ATGGAGCCACAAATTCAGGAAGG + Intronic
1136677412 16:31923926-31923948 ATTCAGCCAGAAGATAAGGAAGG + Intergenic
1139157250 16:64458335-64458357 ATTTAGCCATCAACACAAGAAGG - Intergenic
1139646545 16:68335369-68335391 ATTGAGGCAGAAACCCTGGAGGG + Intronic
1140995995 16:80259996-80260018 ATTCAGTGATAAACTCAGGAAGG + Intergenic
1141412737 16:83846504-83846526 ATTTAGGCAGATACTAAGGAAGG - Intergenic
1142204918 16:88778332-88778354 CTTTAGCCTGAACCTGAGGAAGG + Intronic
1144952472 17:19001717-19001739 CTGTAGCCAGAGACTCAGGGAGG + Intronic
1145025121 17:19462532-19462554 ATTAAGTCAGAAACTCAGTAGGG - Intergenic
1147411837 17:40258704-40258726 GTTTAGCCAGAAAGAGAGGAGGG + Intronic
1150571961 17:66394340-66394362 AGTTAGGGAGAAAGTCAGGATGG + Intronic
1151362982 17:73599738-73599760 TTTTAGCCTGAGTCTCAGGATGG - Intronic
1153663503 18:7347168-7347190 AATTAGACAGAAAATCAGTAGGG + Intergenic
1154435587 18:14339278-14339300 ATTTAGGCAGAAAATCAAGGGGG - Intergenic
1156123446 18:33873877-33873899 ATTTAGCCAGAAAATTAGTGAGG + Intronic
1160376052 18:78413344-78413366 TTTTAGCCAGAAACAAAGCAAGG - Intergenic
1164821178 19:31252257-31252279 ATGCAGCCACAACCTCAGGAAGG - Intergenic
1167376047 19:49112636-49112658 ATGTAGGCAGAAACCCAGGTGGG - Intergenic
925801128 2:7601629-7601651 ATTTAGCCAGTTGCTCAAGATGG - Intergenic
926635109 2:15170264-15170286 ATCCAGCCAGAAACACGGGAAGG - Intronic
926668645 2:15553093-15553115 AGCTAAACAGAAACTCAGGAAGG - Intronic
927005943 2:18848830-18848852 ATTTAACAAGAAAATGAGGATGG + Intergenic
927248981 2:20981342-20981364 GTGTAGCCAGAAACAGAGGAGGG - Intergenic
928111238 2:28510522-28510544 ATTTAAACAGAAGCTGAGGAGGG - Intronic
928410994 2:31053623-31053645 TTTTAGCCTGAATCCCAGGATGG + Intronic
928444091 2:31317809-31317831 ATTTAACCAGAATCTCTGCAAGG + Intergenic
928448572 2:31356214-31356236 AAATAGACAGAAAATCAGGAAGG + Intronic
930153144 2:48078459-48078481 ATGAAGCCAGAAACTCAAGCAGG - Intergenic
930285120 2:49418087-49418109 AACTAGGCAGAAACTCAGGTAGG + Intergenic
931025025 2:58102693-58102715 ATTGAGACAGAAAATCAGCAAGG + Intronic
931033731 2:58213251-58213273 ATTTAGCCAGCTCCTCAGGCGGG + Intronic
931237889 2:60427123-60427145 ATTTAACCAGCCAGTCAGGAAGG - Intergenic
933004044 2:76967241-76967263 ATTGAGCATGAAACTCAGGGAGG - Intronic
933720006 2:85391672-85391694 ATTAGGCCAGAAACTCATCATGG - Exonic
935091150 2:99896167-99896189 ATTTATCCAGAAACTTAAGGTGG - Intronic
935455862 2:103267219-103267241 ATTTTTCTTGAAACTCAGGAAGG + Intergenic
936714218 2:115165316-115165338 ACTTAGCCAGGAACTCATGGAGG + Intronic
937303015 2:120854798-120854820 ACTGAGTCAGAAACTCAGGATGG - Intronic
938734756 2:134176026-134176048 TTTTGGCCAGATCCTCAGGATGG + Intronic
942329646 2:174808828-174808850 AGTTAGCCAGAAAACCAGGAAGG + Intronic
942358497 2:175145772-175145794 ATTTGGCCAGAAAGTAAGAAAGG + Intronic
943507029 2:188773927-188773949 ATTTAGACAGAAAAACAGCAAGG + Intronic
943576488 2:189637119-189637141 TTTGAGCAAGAATCTCAGGAAGG + Intergenic
945291440 2:208131521-208131543 ATTTAGCCAAAAGATCAAGATGG - Intergenic
945440054 2:209867606-209867628 ATAAAGCCAGGATCTCAGGAAGG - Intronic
946336966 2:219044235-219044257 ATGGAGTCAGAATCTCAGGATGG - Intergenic
947517241 2:230816596-230816618 ACATAGCCAGAAACCCAGAAAGG + Intronic
1169759424 20:9075172-9075194 ATTGAGACTGAAACTCAGGTAGG + Intronic
1169925763 20:10782477-10782499 ATTTATCCAAATACACAGGAAGG - Intergenic
1170540856 20:17386447-17386469 ATTTATTCAGAATTTCAGGAAGG + Intronic
1170819659 20:19745830-19745852 ATTCAGCTAGAAACTCAGCTAGG + Intergenic
1172520864 20:35564700-35564722 GTTTGGCCAGAAACTCAGAATGG + Intergenic
1173341788 20:42159309-42159331 AATTAGCAAGAAAGTGAGGAAGG - Intronic
1174749585 20:53098655-53098677 AATTAGCTAGAAATTCAGGGGGG + Intronic
1175967396 20:62666341-62666363 ATTCAGCCAGGGACTCAGGCAGG - Intronic
1176841445 21:13846355-13846377 ATTTAGGCAGAAAATCAAGGGGG + Intergenic
1177407958 21:20694666-20694688 ACTTGGACAGAAACTCAGTAAGG + Intergenic
1178420001 21:32435634-32435656 ATTTAGCCATAAAATCAGCAGGG - Intronic
1178820560 21:35971360-35971382 AGTTGGCCAGAAAATCAGAAAGG + Intronic
1179546774 21:42117869-42117891 ATTAATCAAGAAACTCGGGAAGG - Intronic
1179944515 21:44662560-44662582 AAGTAGACAGAAAATCAGGAAGG + Intronic
1182061444 22:27401127-27401149 ATATAAACAGAAAATCAGGAAGG - Intergenic
949506274 3:4730967-4730989 ATCCAGTCAGAGACTCAGGATGG + Intronic
950323840 3:12085515-12085537 ATCTAGACAGAAAATCAGTAAGG + Intronic
952827750 3:37538180-37538202 GGTTAGCCTGAAACTCGGGAAGG + Intronic
953704039 3:45218001-45218023 AGTTATCTAGAAACACAGGAGGG + Intergenic
955543454 3:60002331-60002353 ATTAATCCAAAACCTCAGGAGGG - Intronic
955813351 3:62815684-62815706 ATTTAGTTAGAAACTCAAAAAGG - Intronic
956252483 3:67249338-67249360 ATTTAGAAAGAAAATCATGAAGG + Intergenic
956298588 3:67742992-67743014 ACCTAGACAGAAACTCAGCAAGG - Intergenic
956829523 3:73031846-73031868 ATTCCTCAAGAAACTCAGGATGG - Intronic
957308112 3:78485145-78485167 ATTAAGACAGAAAATCAGGAAGG + Intergenic
959751508 3:109841995-109842017 ATTAAGGCAGAAACTCTGGAAGG + Intergenic
959807805 3:110578430-110578452 ATTCAGAGAGAAAATCAGGAAGG - Intergenic
961430290 3:126877115-126877137 TTTCAGAAAGAAACTCAGGAAGG + Intronic
961590736 3:127978850-127978872 CTTTAGCCAGAAGGCCAGGAAGG + Intronic
961812244 3:129528578-129528600 ATTCAGCCAGGAGCTTAGGAGGG + Intergenic
961884002 3:130083863-130083885 ATTTAGCCATAAAATCAGCAAGG + Intronic
963702713 3:148645910-148645932 ATTTATCTTGAAACTTAGGATGG + Intergenic
964738987 3:159945728-159945750 ATTTAGCCACAAGTACAGGATGG - Intergenic
966026233 3:175286434-175286456 ATTTACCCAGAAAGTGAGAAAGG + Intronic
967322063 3:188204403-188204425 ATCTTGGCAGTAACTCAGGAGGG + Intronic
968329967 3:197859836-197859858 ATTTAGGAAGAAGCTAAGGATGG - Intronic
969820775 4:9718428-9718450 ATTTAGCCATTAAATCAGCAGGG - Intergenic
969894439 4:10290348-10290370 GTTTGGCCAGAAACTCAAAATGG + Intergenic
972680359 4:41300461-41300483 ATATATACAAAAACTCAGGATGG - Intergenic
973039631 4:45454143-45454165 AAGTAGGAAGAAACTCAGGAAGG + Intergenic
973110993 4:46397673-46397695 CTTTACCCAGAAACACAGGCAGG - Intronic
975990005 4:80249096-80249118 CTCTGGCCAGAAACTCATGAAGG - Intergenic
976067235 4:81201942-81201964 ATTTAGCCATAAATTCAGCCAGG + Intronic
976383781 4:84432087-84432109 ATTTAGCCAGGAATTTAGAAAGG + Intergenic
977431841 4:96939927-96939949 ATTCAGCCAGATGCTCAGAAAGG + Intergenic
977514914 4:98009628-98009650 ATTCAGTCAGAAATTCAGTAAGG - Intronic
978315582 4:107432894-107432916 ATTTAGCCTGAACATCTGGAAGG - Intergenic
980448023 4:132937614-132937636 ATGAACACAGAAACTCAGGATGG + Intergenic
981762662 4:148210650-148210672 CCTCAGACAGAAACTCAGGATGG - Intronic
984434287 4:179688761-179688783 CTTTAGCCAGAAAATCAGGAGGG + Intergenic
986456137 5:7921584-7921606 ATGTAGACAGAAAGTCAGCAAGG - Intergenic
988214202 5:28250245-28250267 ATTGAGCCAGAAAGTCAAGTGGG + Intergenic
990809737 5:59709495-59709517 AGATAGCCAGAAACACAGCAGGG + Intronic
992388708 5:76310881-76310903 AGTGAGCTAGAAACTCAGGCTGG + Intronic
992492175 5:77255778-77255800 ATTCAGCCAGCAACTCAGTGGGG + Intronic
992696041 5:79288510-79288532 TTTTAGCCAGATACTAAAGATGG - Intronic
993614529 5:90095412-90095434 ATGTAGACAGACTCTCAGGAAGG - Intergenic
994635894 5:102343958-102343980 ATTTAGGCCAAGACTCAGGAGGG + Intergenic
996445836 5:123549390-123549412 AATTAGCCAAAAACTCAGCTGGG + Intronic
996610810 5:125377351-125377373 AGACAGCCAGAAACTCAGCAGGG - Intergenic
998281544 5:140813188-140813210 ATTCAGACAGAAAATCAGCAAGG - Intronic
998842156 5:146266118-146266140 ATCAAACCAGAAACTAAGGAGGG + Intronic
999026821 5:148242852-148242874 ATTTAGCCAGAAAGTGATGGTGG + Intergenic
999224438 5:150009278-150009300 ATTTAGGATGAAACTCAGGGAGG - Intronic
999501641 5:152152420-152152442 AGTTAACCACAAACTCAGGGAGG - Intergenic
1000479126 5:161749620-161749642 ATGTAGGCAGAAAGTCAGTAAGG - Intergenic
1002937597 6:1687057-1687079 ATTTTGCCTAAAACTGAGGATGG - Intronic
1004112636 6:12734522-12734544 ATTTGGACACAAACTCAGGAAGG + Intronic
1004565704 6:16794895-16794917 AATTAGGCAGAAAATCAGCAAGG + Intergenic
1004734194 6:18388507-18388529 AATTAGCCAGCAACTCAGTTAGG - Intronic
1005816140 6:29554189-29554211 ATTAAGCCAGAACCCAAGGATGG + Intergenic
1006315979 6:33291996-33292018 ATTGAGACAGAAATTCAGAAAGG - Exonic
1008857159 6:56103207-56103229 ATTAAGCCAGAATCTCTGGGTGG + Intronic
1009595311 6:65728069-65728091 ATATAGACAGAAACTTAGGCAGG - Intergenic
1009699298 6:67155511-67155533 ATTTAGCCACAATCTAGGGATGG - Intergenic
1009724315 6:67517470-67517492 AATTAGCCAGAAACTCTGAAAGG - Intergenic
1010887582 6:81263373-81263395 ATTTAGCCAGACTCAGAGGATGG - Intergenic
1011236280 6:85221054-85221076 ATTTAGACAGAAAATCAATAAGG + Intergenic
1013763515 6:113546891-113546913 ATTTAGACAGAAAATCAACAAGG + Intergenic
1014240354 6:119010960-119010982 ATTTCAACAGAAACTGAGGATGG - Intronic
1014539476 6:122656618-122656640 CTTCAGCCAGAAACCCAGGCGGG + Intronic
1016028499 6:139313409-139313431 CTTTAGCCAGGAACCTAGGATGG + Intergenic
1016473400 6:144399086-144399108 ATTTTGAAAGAAACTCAGGGAGG + Intronic
1016586444 6:145692309-145692331 AATTAGACAGAAAATCAGCAAGG + Intronic
1017468142 6:154714085-154714107 ATTCAGCCAGAAACTCAAGGTGG + Intergenic
1020050426 7:5077770-5077792 TTGTAGCCACAAACCCAGGATGG + Intergenic
1021194529 7:17660553-17660575 ATTTGGCCAGAAAGTGAGGGTGG + Intergenic
1021839766 7:24713196-24713218 ATTCATCCAGGAACTCAGCAAGG + Intronic
1022203199 7:28137719-28137741 GTGCAGCCAGAAACTCAGGATGG + Intronic
1024822861 7:53353641-53353663 AGTAAGCCAGAAGATCAGGAAGG + Intergenic
1024889966 7:54188774-54188796 TTTGAGTCAGAAACTCAGGAAGG + Intergenic
1025592760 7:62883533-62883555 GTTTAGGCAGAATCCCAGGAAGG + Intergenic
1027880658 7:83831133-83831155 ATGTGGCCAGAAACTGAGGAAGG + Intergenic
1030430624 7:109442894-109442916 ATTTAGCCATCATTTCAGGATGG - Intergenic
1030533096 7:110734624-110734646 ATTTAATTAGAAAATCAGGATGG + Intronic
1031128922 7:117808315-117808337 TTTGAGCCAGTAACCCAGGATGG - Intronic
1031234061 7:119149096-119149118 AATTATCCAGAAACTCTGCATGG + Intergenic
1032216751 7:129963266-129963288 ATTATTCCAGATACTCAGGATGG - Intergenic
1035107836 7:156457032-156457054 ATTTACCCATAAACTTGGGAAGG - Intergenic
1035606271 8:931647-931669 CTTTAATCAGAAACTCAGAATGG - Intergenic
1037385865 8:18340645-18340667 ATTCAGATAGAAAATCAGGAAGG + Intergenic
1038923406 8:32111263-32111285 AATTAGCCAGAAACTCTGGCGGG - Intronic
1039459493 8:37731523-37731545 AAGTAGACAGAAACCCAGGAGGG + Intergenic
1040993954 8:53381699-53381721 TTTAAGCCAGAAAATAAGGAAGG - Intergenic
1041768559 8:61447132-61447154 TTTTAGACAGAAAATCAGCAAGG - Intronic
1042715166 8:71764579-71764601 ATTTAGACAGAAAACCAAGAAGG + Intergenic
1045155117 8:99459274-99459296 AATTAGACAGAAACTCAATAAGG - Intronic
1045372255 8:101536031-101536053 ATTTAGACAGAGAAGCAGGAAGG + Intronic
1046026241 8:108727642-108727664 TATGAGCCAGAAGCTCAGGAGGG + Intronic
1047744915 8:127837624-127837646 ATTTAGCCTGGCACACAGGAGGG - Intergenic
1048456231 8:134580886-134580908 ATTTTGCCCCAAACTGAGGAAGG + Intronic
1052143148 9:25013438-25013460 AAGCAGCCAGAAACTCAAGAAGG + Intergenic
1053566592 9:39258842-39258864 AGTCAGCCAGAAACTCATGATGG - Intronic
1053832371 9:42096702-42096724 AGTCAGCCAGAAACTCATAATGG - Intronic
1054130554 9:61360170-61360192 AGTCAGCCAGAAACTCATGATGG + Intergenic
1054598177 9:67090718-67090740 AGTCAGCCAGAAACTCATGATGG + Intergenic
1054826459 9:69578484-69578506 TTTTATCCAGAAATTCAGGGTGG - Intronic
1054840716 9:69736208-69736230 ACTGAGTCAGAAACTCAGGTGGG + Intronic
1055740471 9:79382846-79382868 AAAAACCCAGAAACTCAGGAAGG + Intergenic
1059318400 9:113446848-113446870 AGTTGGGCAGAGACTCAGGAAGG + Intronic
1062084998 9:134643803-134643825 TTTTCCCCAGAAACTCAGGAGGG + Intronic
1186347646 X:8710694-8710716 ATTTCGCTAGGAATTCAGGATGG - Intronic
1186837453 X:13451894-13451916 CTTTATCCAGAAGCTCAGGCTGG + Intergenic
1189426132 X:40902302-40902324 AACTAGCCAGAAAATCAGCAAGG + Intergenic
1190574398 X:51818431-51818453 ATTTAGCAAGGAACTAAAGACGG - Intronic
1192193963 X:69016457-69016479 CTTTAACCTCAAACTCAGGAGGG + Intergenic
1193856869 X:86613015-86613037 ATTTAGCCAGAAAAACAACATGG - Intronic
1195993141 X:110703160-110703182 ACTAAGTCAGAAACTCAGGATGG + Intronic
1199986326 X:152954457-152954479 CTTAAGCCAGAAACCCAGAATGG - Intronic