ID: 1073453046

View in Genome Browser
Species Human (GRCh38)
Location 10:103620590-103620612
Sequence CTGCAAACAGCAGAGCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073453046_1073453051 24 Left 1073453046 10:103620590-103620612 CCGACCAGCTCTGCTGTTTGCAG 0: 1
1: 0
2: 0
3: 25
4: 377
Right 1073453051 10:103620637-103620659 GCAAGTTTTTCTTGGCTGCCTGG No data
1073453046_1073453050 16 Left 1073453046 10:103620590-103620612 CCGACCAGCTCTGCTGTTTGCAG 0: 1
1: 0
2: 0
3: 25
4: 377
Right 1073453050 10:103620629-103620651 AACTCTCTGCAAGTTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073453046 Original CRISPR CTGCAAACAGCAGAGCTGGT CGG (reversed) Intronic
900001776 1:18437-18459 CTTCTAACAGCAGAGCTGCCAGG + Intergenic
900021496 1:188960-188982 CTTCTAACAGCAGAGCTGCCAGG + Intergenic
900168740 1:1255848-1255870 CTGCGGACAGCTGTGCTGGTGGG - Intronic
901190731 1:7408363-7408385 CTGCGAGCAGCGGGGCTGGTGGG + Intronic
901666394 1:10828544-10828566 CTGCTTACAGCAGAACGGGTGGG + Intergenic
901929952 1:12590804-12590826 CTGGAAGCAGAAGGGCTGGTAGG - Intronic
902696426 1:18143718-18143740 CTGCACACAGGTGACCTGGTAGG + Intronic
902754074 1:18537618-18537640 CTGGGAACAGCAGCCCTGGTGGG + Intergenic
904535949 1:31199510-31199532 CCGCAGACAACAGAGCTGGAAGG + Intronic
906660420 1:47577901-47577923 CCTCACACAGGAGAGCTGGTAGG + Intergenic
907262990 1:53235851-53235873 CTGCAAAAAGCAGCTCAGGTGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907661844 1:56400472-56400494 CTGCAAATAGCAGATGTGATTGG + Intergenic
907716967 1:56934914-56934936 CAGCAAACCCCAGTGCTGGTAGG - Intronic
907911942 1:58834574-58834596 CTGAAAACACAAGAGCTGGTTGG - Intergenic
908349396 1:63269755-63269777 CAGCTAACAGCAGAGCTATTTGG + Intergenic
908685296 1:66711684-66711706 CTGCCTGCAGCAGATCTGGTAGG + Intronic
910595052 1:88972122-88972144 CTGAAATCTGCAGAGCAGGTTGG + Intronic
911743079 1:101408860-101408882 CTGGAAACTGCAAAGCTGGAAGG - Intergenic
913190471 1:116408950-116408972 CGGCACACAGCGTAGCTGGTGGG - Intronic
914844642 1:151275390-151275412 CTGCAACAAGGAGAGGTGGTGGG + Intergenic
915264889 1:154709669-154709691 CTGGCAACAGCAGAGCTCATGGG - Intronic
917259169 1:173148542-173148564 CATCAAACAGCAAAGATGGTGGG + Intergenic
919430027 1:197481174-197481196 CTGCAAACAGCTGCGCTAGAAGG - Intergenic
919851608 1:201676635-201676657 CTTTTAAAAGCAGAGCTGGTTGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922226065 1:223646794-223646816 AGGCAGAGAGCAGAGCTGGTAGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923291551 1:232551131-232551153 AAGCAAACAGTAGGGCTGGTGGG + Intronic
924410147 1:243795964-243795986 CTGAAAACAGGGGAGCTGGTCGG - Intronic
924772092 1:247087731-247087753 GTGCAACCAGCCCAGCTGGTAGG - Intergenic
1064047831 10:12034079-12034101 CAGCAAATAGTAGAGCTGTTGGG - Intronic
1064352530 10:14589434-14589456 CTGCAATAATTAGAGCTGGTAGG + Intronic
1064744103 10:18462235-18462257 CAGCAAATAGGAGCGCTGGTTGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065220391 10:23490641-23490663 CTTCAAACAACAGAACTGATAGG - Intergenic
1065251540 10:23820285-23820307 CTGTAAACCACAGAGCTAGTAGG - Intronic
1065868636 10:29936044-29936066 CTGGAAACTAAAGAGCTGGTAGG - Intergenic
1066950568 10:42112407-42112429 CTGCAAAAAGCAGCGGCGGTGGG + Intergenic
1067110349 10:43396195-43396217 CTGCAGATAGCCGAACTGGTAGG - Intronic
1067333117 10:45340068-45340090 GCCCAAACAGCAGAGCAGGTTGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070604896 10:77891839-77891861 CAGCAAGCAGCAGAGCCGGATGG - Intronic
1071201045 10:83220960-83220982 CTGCAAACAGCAGAGAGATTTGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1073453046 10:103620590-103620612 CTGCAAACAGCAGAGCTGGTCGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076515169 10:131041506-131041528 ATGCAAATAGCAGAGCTGCTCGG + Intergenic
1076684256 10:132189967-132189989 CTGCCATCAGCAGACCTGGGAGG - Intronic
1077113014 11:870187-870209 CTGGAACCAGCAGAGCGGATGGG - Intronic
1077627981 11:3790357-3790379 CTTCATAGGGCAGAGCTGGTGGG - Intronic
1078630337 11:12997302-12997324 CAGCAAACAATAGAGCTGGAGGG - Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081090500 11:38860140-38860162 CTGCAAACAGCATTCTTGGTTGG + Intergenic
1083840139 11:65299561-65299583 CTGCAGAAGGCAGAGCTGGATGG - Intronic
1083996466 11:66275529-66275551 CTGCAGGGAGCAGAGCTGGCAGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085266220 11:75239698-75239720 CGGGTATCAGCAGAGCTGGTTGG - Intergenic
1086573823 11:88315214-88315236 CCTCAAACAGCAGAGGTGGGAGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1089171819 11:116517303-116517325 GTGTACACAGCACAGCTGGTTGG - Intergenic
1090844611 11:130520322-130520344 CTGCTTCCAGCGGAGCTGGTTGG + Intergenic
1091374856 12:18542-18564 CTTCTAACAGCAGAGCTGCCAGG + Intergenic
1091719129 12:2799842-2799864 CTGCCAAAAGCATAGCTGGAGGG - Exonic
1093727886 12:22536239-22536261 CTACAAACAGCAGAAGAGGTTGG + Intronic
1095680855 12:44973890-44973912 CTGCAAACATCAGAGGGTGTTGG - Intergenic
1095927320 12:47591956-47591978 CTGGAAATAGCAGCACTGGTGGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096382690 12:51172562-51172584 GTGCACAGAGCAGTGCTGGTCGG - Exonic
1097102993 12:56602544-56602566 CTGGAAATGGCAGAGCAGGTGGG + Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097680515 12:62644960-62644982 CTGAAAACAGCGGAGCTGCTGGG + Exonic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099467587 12:83006045-83006067 CTACAGACAGTTGAGCTGGTAGG - Intronic
1100452543 12:94721440-94721462 CTGCAGACTGCAGAGCTGAGCGG - Intergenic
1100721172 12:97360261-97360283 CTGCAAATAGCAGAGCTAAATGG + Intergenic
1101446172 12:104738258-104738280 CTGCGAACCTCAAAGCTGGTCGG - Intronic
1101572185 12:105963881-105963903 CTGCAAATAGCGGAGTTGGCTGG - Intergenic
1102577840 12:113867801-113867823 CTGTAAACAGCCCAGCTAGTGGG + Intronic
1104017535 12:124970951-124970973 CTGGGATCAGCAGAGCAGGTGGG - Intronic
1104833313 12:131769877-131769899 CTGCAAACAGGAGAGGTGAGAGG - Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110282360 13:73709781-73709803 CTGGAAACAGGAGAGCTAGGTGG + Intronic
1110288660 13:73778954-73778976 CTGCAAACAGCACCACTGTTTGG - Intronic
1110301236 13:73929773-73929795 CTGCACACAGAACAGCTGTTTGG - Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113723075 13:112575427-112575449 CTCTAAACAGCAGAGCTGTAAGG + Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1118444455 14:65838820-65838842 CTGCAAAGAGCAGAGCAAGGAGG - Intergenic
1118622752 14:67629039-67629061 CTTCAAAAAGCAGGGCTGGGTGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1122964637 14:105116768-105116790 CTGCAAACACTAGACCTGGGAGG - Intergenic
1122989189 14:105228899-105228921 CTGCAACCAGGAGCGCTGGAAGG + Exonic
1125686657 15:41567545-41567567 ATGCATAGAGCAGAGCGGGTGGG + Intronic
1125817168 15:42595862-42595884 CTGCCAGCAGCACAGCTGTTTGG + Intronic
1127725276 15:61743660-61743682 CTGCAAACAGCCAGGCTGGCTGG + Intergenic
1129207677 15:74046681-74046703 CTGAAAACAGCACACATGGTGGG - Exonic
1129760225 15:78124947-78124969 CTGAAAAGGGGAGAGCTGGTGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131373278 15:91902460-91902482 CTGCAACCAGTAGTGCTGGTTGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132451733 15:101972503-101972525 CTTCTAACAGCAGAGCTGCCAGG - Intergenic
1132455159 16:18126-18148 CTTCTAACAGCAGAGCTGCCAGG + Intronic
1132974867 16:2706174-2706196 CTGGGAACGGCAGAGCTGTTGGG + Intronic
1133576484 16:7096445-7096467 CTGTTAACAGCAGCCCTGGTGGG + Intronic
1136378808 16:29881341-29881363 CTGGAAACAGCAGAGATAGCGGG + Intronic
1136938754 16:34500463-34500485 CTGCAAAAAGCAGCGGTGGTGGG + Intergenic
1136961065 16:34848093-34848115 CTGCAAAAAGCAGCGGTGGTGGG - Intergenic
1137218806 16:46427340-46427362 CTGCAAAAAGCCAAGGTGGTGGG + Intergenic
1138241058 16:55427383-55427405 CTAGAAGCAGCAGAGCTGGGTGG + Intronic
1138524568 16:57594940-57594962 ATGCCAGCAGCAGAGTTGGTGGG - Intergenic
1139354848 16:66361320-66361342 CTGCAGACAGCAGAATTGGCAGG - Intergenic
1139962031 16:70723697-70723719 AGGCAACCAGCAGGGCTGGTAGG - Intronic
1140213282 16:72987506-72987528 CTGCAACCAGCAGCTCTGGGAGG + Intronic
1140229894 16:73108910-73108932 CTGGAAACAGCAGCCCTTGTTGG + Intergenic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1143218494 17:5242220-5242242 CTGCAAACAGCGTGCCTGGTCGG + Intergenic
1143840540 17:9728236-9728258 CTGCTAACAGCGAAGATGGTGGG + Exonic
1143884258 17:10054309-10054331 CTGGTAACAGCAGAGATGGGTGG + Intronic
1143917460 17:10304399-10304421 GTGCACAGAGCATAGCTGGTGGG + Intronic
1144574008 17:16417678-16417700 CTGAAAACTGGAGAGCTGGAGGG - Exonic
1146974238 17:37097337-37097359 CTGCAGACAGCAGGGCATGTGGG - Intronic
1149183611 17:53971292-53971314 CAGAAAACTGGAGAGCTGGTAGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149435152 17:56627709-56627731 CTGTAAACAGCAGAGCATGTTGG + Intergenic
1149537100 17:57441406-57441428 CTGCAACCAGCTGGGCTGGCTGG + Intronic
1150930686 17:69581496-69581518 CTGCAAACAGGTGTGCTGGAGGG - Intergenic
1152020607 17:77778506-77778528 CAGCAAACAGCAGAGAGGCTGGG - Intergenic
1152063474 17:78096522-78096544 CTGCAAACAGCTGTGCAGGTTGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1156027028 18:32666969-32666991 CTGCAAACTGCAGGGCTGACTGG - Intergenic
1156917597 18:42480105-42480127 CAACCAACAGCAGAGCAGGTAGG - Intergenic
1157125212 18:44950244-44950266 TTGCACTCAGCAGAGCTGCTGGG - Exonic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157534871 18:48450836-48450858 CTCCATGCAGCAGAGCTGGGAGG + Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158466780 18:57697618-57697640 GTGGAAACAGCAGAACTGGATGG - Exonic
1158686977 18:59623466-59623488 GTGCAAACAGCACAGTGGGTGGG - Intronic
1160243756 18:77141174-77141196 ATGAAAGCAGCAGAGCTGGAGGG - Intergenic
1160327707 18:77966358-77966380 CTGCTCACAGCAGAGGGGGTGGG + Intergenic
1160434361 18:78834157-78834179 CTGAAACCTGCAGTGCTGGTGGG - Intergenic
1160633528 19:60045-60067 CTTCTAACAGCAGAGCTGCCAGG + Intergenic
1160757601 19:765716-765738 CTTAAAACAGCAGACATGGTTGG + Intergenic
1161770951 19:6230424-6230446 CAGCACCCAGCAGAGCTGGAGGG - Intronic
1163302530 19:16457028-16457050 CTGCAAGGAGCAGGGCTGGAAGG + Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164537412 19:29096211-29096233 CTGCAAACAGCAGAACCAGGAGG - Intergenic
1165327112 19:35120642-35120664 GTGCAAACACCAGACCAGGTGGG + Intronic
1166741933 19:45119769-45119791 CTGCACACATGAGAGGTGGTGGG + Intronic
1166864204 19:45826241-45826263 CTCCAAACAGCACAGACGGTGGG + Exonic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168623093 19:57894531-57894553 CTGCAAAAAGCATAGCCGGCTGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925449904 2:3960176-3960198 CTGCTAACATCTGAGCTGATGGG + Intergenic
926006726 2:9378555-9378577 CTGCATCCAGCACAGCTGGCCGG + Intronic
926614825 2:14985433-14985455 CTGCGAACAGCAGAGACGATAGG + Intergenic
926971686 2:18473235-18473257 CTGCAAAGAGCAGAGCATTTTGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932195703 2:69781282-69781304 CTCCAAACAGAAGAACAGGTGGG + Intronic
932848495 2:75158870-75158892 CTGGAAGCTGCACAGCTGGTTGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934165032 2:89286610-89286632 CTGCACAAAGAAGAGCAGGTGGG + Intergenic
934202241 2:89895852-89895874 CTGCACAAAGAAGAGCAGGTGGG - Intergenic
934331661 2:92074448-92074470 CCGCAAAAAGCAGCGGTGGTGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936567944 2:113594970-113594992 CTTCTAACAGCAGAGCTGCCAGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937342653 2:121101129-121101151 CTCCACACTGCAGTGCTGGTAGG - Intergenic
937439049 2:121901639-121901661 ATGCAGACAGCAGATCTGCTAGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940984255 2:160037009-160037031 CTGGAGACAGCAGAGCTGTCAGG - Intronic
942320537 2:174732151-174732173 CTCCAAGCTGCAGAGCTAGTGGG + Intergenic
946670163 2:222094451-222094473 CTGCAAACTGTAGATCTGATTGG + Intergenic
946881730 2:224183198-224183220 CTTCTAACAGCCGAGCTGTTTGG - Intergenic
947966977 2:234290024-234290046 CTGCAAACAGCAGCCCTGCTAGG + Intergenic
948481416 2:238252854-238252876 CAGCAAACAGCACACCTGGCAGG - Intronic
1168906024 20:1404520-1404542 GAGCAAACAGCAGAGCTACTGGG + Intergenic
1168906420 20:1407604-1407626 GAGCAAACAGCAGAGCTACTGGG - Intergenic
1169347268 20:4838787-4838809 ATGCAAGCTGCAGAGCTGGAAGG + Intergenic
1171355681 20:24543829-24543851 CTGCAGATGGCAGTGCTGGTGGG + Intronic
1171439785 20:25150698-25150720 CTGCCAACATCAGAGCTCATGGG + Intergenic
1171457098 20:25278296-25278318 CTGCACACAGCAGAGCAAGCTGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172168537 20:32914135-32914157 CTGCACTCAGCAGAGCTGGGAGG - Intronic
1172230121 20:33330762-33330784 CTGTAAACAGCAGAGCAGGAGGG + Intergenic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173818958 20:46008622-46008644 TTGCAAACTGCAGAGCTTGTGGG - Intergenic
1174917933 20:54672663-54672685 CTGCATTCAGCAGAGGAGGTGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178071388 21:28971890-28971912 CTGGAAAAAGCAGAGCAGATCGG + Intronic
1178190249 21:30271767-30271789 CTGAAAACAGCAGAACTTCTGGG + Intergenic
1179813329 21:43886056-43886078 CTGCAAAGGGCACAGCTGGGTGG + Intronic
1181449656 22:23011037-23011059 CTACAAACTGCAGAGATGTTAGG - Intergenic
1181449943 22:23013030-23013052 CTACAAACTGCAGAGATGTTAGG - Intergenic
1182143576 22:27983047-27983069 CTGAAGACAGCAGTGCTGCTGGG + Exonic
1182855274 22:33511570-33511592 CTGCAAACATCACAGCTGCTGGG - Intronic
1183499206 22:38168392-38168414 GGGCCAACGGCAGAGCTGGTTGG - Intronic
1183586681 22:38756752-38756774 CTTAAAACAGAAGAGCTGGCCGG - Intronic
1184220223 22:43095138-43095160 CTTCAATCCCCAGAGCTGGTGGG + Intergenic
949182245 3:1146421-1146443 ATGAAAACAGCAGAGCTGTAGGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949943573 3:9172999-9173021 AGGCAAACAGGAGAGGTGGTGGG + Intronic
950348023 3:12316828-12316850 CAGGAAACAGTAGAGCTGGGTGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951300762 3:20993958-20993980 CTGCAAACAACAGAGTTCCTAGG - Intergenic
952729042 3:36619821-36619843 CTTGAAACAGCAAATCTGGTTGG + Intergenic
952933166 3:38375422-38375444 TTGCTGACAGCAGAGCTGGGTGG + Intronic
953556415 3:43949959-43949981 CTCCAAACAGCAAAGGTGCTTGG + Intergenic
954130958 3:48560771-48560793 CAGCAAAGAGCAGAGCAGGAGGG + Intronic
954806736 3:53224977-53224999 CTAGGAACAGCAGAGCAGGTCGG + Intronic
956413775 3:69005687-69005709 CTGCAAACCGTAAAGCTTGTGGG + Intronic
956907329 3:73780309-73780331 CTGAAATCATCAGAGTTGGTGGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
960001888 3:112740816-112740838 TTGCAAACAACAGAGGAGGTGGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960501583 3:118444858-118444880 CTGCAGACAGCAGAGCTGAAAGG - Intergenic
961165370 3:124759958-124759980 GTGCAAACATAAGAGCTGGAGGG - Intergenic
961356220 3:126341618-126341640 CAGCACACAGCACAGCTGATAGG - Intergenic
961616149 3:128182797-128182819 CTGCTAGCAGCAGGGCTGGTGGG - Intronic
961646984 3:128397935-128397957 CTGCCATCAGCCCAGCTGGTAGG + Intronic
962843924 3:139259009-139259031 CAGGGAACAGCAGAGCTGGAAGG - Intronic
963069065 3:141287486-141287508 ATGCAAGCAGAAGAGCGGGTGGG - Intronic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963857266 3:150267592-150267614 CTGCAAAGCACAGAGCAGGTTGG + Intergenic
965310799 3:167125787-167125809 CAGAAAGCAGCAGTGCTGGTAGG + Intergenic
965708153 3:171530397-171530419 CTGCAAGCAGGGAAGCTGGTGGG + Intergenic
966051028 3:175618048-175618070 CTGCAAGCAGCAGAGAAGTTTGG - Intronic
967559895 3:190905534-190905556 CTGCACACAGCAGAGATCCTTGG - Intergenic
968148689 3:196320446-196320468 GTCCAACCAGCAGAGCTCGTAGG - Intronic
968381950 4:103975-103997 CTGGAAATAGCAGAGCAGCTGGG + Intergenic
968391813 4:198987-199009 CTGGAAATAGCAGAGCAGCTGGG + Intergenic
968405351 4:336124-336146 CTGGAAATAGCAGAGCAGCTGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969172728 4:5376895-5376917 CATCAAACAGGAGAGCAGGTGGG - Intronic
969285822 4:6201074-6201096 CAGCAAGCGGCAGAGCTGGGCGG + Intergenic
969316548 4:6384852-6384874 TTGCAGACAGAAGTGCTGGTTGG + Intronic
969468167 4:7370071-7370093 CCGCAAACAGCTAAGCTGGGGGG - Intronic
969578909 4:8052570-8052592 CTGCCAAAAGCAGAGCTGCTAGG + Intronic
970280875 4:14453395-14453417 CTGCAAAAAGCAGAGCTCCAGGG + Intergenic
971233316 4:24818521-24818543 CTGAAAACAGTTGAGCTGGGTGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973278797 4:48337923-48337945 CTACAAGGAGCAGAGCTAGTAGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975852479 4:78586915-78586937 CTGAAAACACCTGAGCTTGTGGG - Intronic
976471324 4:85432208-85432230 ATGCACACAGCAGAGTTAGTAGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
979489519 4:121309102-121309124 CAGCAGACAGCAGATCTGGCAGG - Intergenic
980072259 4:128256045-128256067 CTGAAATCTGTAGAGCTGGTTGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981077087 4:140602845-140602867 CTGTAATCAGCTGAGTTGGTTGG + Intergenic
981956630 4:150482240-150482262 CTGGAAAAAGCATAGCTGTTAGG - Intronic
982215241 4:153077062-153077084 CAGCAAAGTGCACAGCTGGTGGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985363574 4:189201857-189201879 CTGAACACAGCAGAGCTACTTGG + Intergenic
985766143 5:1780488-1780510 ATGCCAACAGCAGACCTGTTTGG - Intergenic
985916491 5:2922805-2922827 CTGCAATAAGCAGTGCTGGAGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989133873 5:38134150-38134172 CTGCCAACACCAGAGCAGCTCGG - Intergenic
989204879 5:38800471-38800493 CTGTAAACATTAGAGCTGGGAGG + Intergenic
992198422 5:74362093-74362115 CTGAAAACAGCAAAGGTGGCTGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992748973 5:79844662-79844684 GTGCAACCATCAGAGCTGGTGGG - Intergenic
993552091 5:89285909-89285931 CTGAAAATAGCAGAGCTAGGTGG - Intergenic
995833756 5:116380553-116380575 CTGAAAAAAGAAGACCTGGTGGG - Intronic
997658425 5:135572412-135572434 CTGGAGACAGAAGAGGTGGTTGG + Intronic
997831850 5:137157141-137157163 GTGCAAACACCAGTGCCGGTGGG - Intronic
999505358 5:152189108-152189130 ATGTAAACATCAGAGCTGGGAGG - Intergenic
1001079466 5:168656519-168656541 TAGCAAACTGCAGAGCTGGGTGG - Intergenic
1001500323 5:172227226-172227248 CTGCAAACAGCTGAGGTGAGAGG - Intronic
1002316613 5:178348216-178348238 CTGCAAGAGGCAGAGCTGCTGGG - Intronic
1002568907 5:180129068-180129090 CAGACAACAGCACAGCTGGTCGG - Intronic
1003464256 6:6363325-6363347 CTGACCACAGCAGTGCTGGTTGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004354636 6:14920427-14920449 CAGCAGACACCAGAGCTGGAAGG + Intergenic
1004918780 6:20357032-20357054 CTGCAAACAGCTCAGCTAGCTGG - Intergenic
1005031399 6:21512297-21512319 CTGGAAACAAAGGAGCTGGTTGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006557781 6:34883438-34883460 CTGGAAGCAGAAGAGCTGGCTGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008629021 6:53346563-53346585 TTGATAACAGAAGAGCTGGTAGG + Intronic
1009054377 6:58317072-58317094 CTGCACTCTTCAGAGCTGGTAGG - Intergenic
1009236760 6:61133507-61133529 CTGCACTCTTCAGAGCTGGTAGG + Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010551814 6:77232554-77232576 CTTCAAACAGCACACATGGTAGG + Intergenic
1012051471 6:94350510-94350532 CTGGAAGCAGTAGAGCTGATTGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013343340 6:109236614-109236636 CTGCAGACAGCAAAGCTGAAAGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014436433 6:121425970-121425992 TTGCAAACAGCAGAGACAGTTGG - Intergenic
1014859620 6:126448957-126448979 TGGCAAACAGCAGAGCTTCTTGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1018210531 6:161476902-161476924 CTGCTAACAGAAAAACTGGTGGG + Intronic
1018889737 6:167975305-167975327 CTGCATACAGCAAGGCTGGAGGG + Intergenic
1019165969 6:170097770-170097792 CTGCAAACAGCAGCTCCCGTGGG + Intergenic
1019572851 7:1721245-1721267 CTGAAAACATCAGGCCTGGTTGG - Intronic
1019882568 7:3875736-3875758 CTGGAACTAGCAGAGGTGGTTGG + Intronic
1019926951 7:4199318-4199340 CCGCAAGCCGCAGAGCCGGTTGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021888528 7:25164554-25164576 CAGCAAATACCTGAGCTGGTAGG - Intronic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022445365 7:30466034-30466056 TTGCAGAGAGCAGAGCTGTTTGG - Intronic
1022496027 7:30853713-30853735 CTACTGACAGCAGAGCTGGACGG + Intronic
1022904036 7:34838494-34838516 CTGCCAACTCCAGAGCTGCTTGG - Intronic
1022908033 7:34874910-34874932 CTGAAAAAAGCAGAGGTAGTTGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024473807 7:49790077-49790099 TTGCAAACAGCAGAACAGCTAGG - Intronic
1025306993 7:57869190-57869212 CTGCAAAAAGCAGCGGTGGCGGG + Intergenic
1026035156 7:66825232-66825254 CTGCAAACAGGGCAGCTGGAGGG + Intergenic
1026256688 7:68718328-68718350 CTGCACACAGGAGAGCAGGAGGG + Intergenic
1027050563 7:75018911-75018933 CTGAAAGCAGCAGCTCTGGTGGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028216375 7:88138941-88138963 CTGCCCACTGCAGAGCTGGGAGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028830030 7:95317647-95317669 CTTCAAATAACAAAGCTGGTTGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030018279 7:105246040-105246062 CTGCAAAAAGAAAAGCTGGAAGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031702726 7:124945141-124945163 CTGGTGGCAGCAGAGCTGGTGGG - Intergenic
1032002064 7:128271906-128271928 CTGGAAACCGCTGAGCTGCTCGG + Intergenic
1032803583 7:135335526-135335548 CTGCAAACATCTGAGCGGGGCGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034524386 7:151647802-151647824 CTGCATACAGTAGAGAGGGTTGG + Intronic
1034559201 7:151869188-151869210 CAGCAGCCAGCAGAGTTGGTGGG - Intronic
1034624853 7:152484782-152484804 CTGCAAAAAGCAGAGTAGGCCGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034709203 7:153176093-153176115 CAGCAAGCAGCAGAGCTCCTGGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1037324483 8:17674575-17674597 CTGGAAACTGCAGGGCTGGGTGG + Intronic
1037797605 8:22009891-22009913 CTCCAAACAGAAGAGTAGGTGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039673695 8:39634461-39634483 CTGCACACAGCAAAGCTATTAGG + Intronic
1040640368 8:49327274-49327296 CTGCCATCAGCAGAGCCTGTTGG - Intergenic
1041090592 8:54297747-54297769 AGGGAAGCAGCAGAGCTGGTGGG - Intergenic
1041375782 8:57208491-57208513 CTGCCCACAGCACAGCTGGAAGG - Intergenic
1041376544 8:57212870-57212892 CTGCCCACAGCACAGCTGGAAGG - Intergenic
1041377493 8:57218262-57218284 CTGCCCACAGCACAGCTGGAAGG - Intergenic
1041503113 8:58560555-58560577 CTGAAAACAAGAGAGCTGGGTGG + Intronic
1041869278 8:62615190-62615212 CTGCTAACTGAAGAGCTGTTGGG - Intronic
1045036414 8:98179855-98179877 CTGCAGACAGCAGCGCAGGTGGG + Intergenic
1045397620 8:101776578-101776600 CAACAAGCAGCAGAGCTTGTTGG + Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048517038 8:135120604-135120626 CTCCAAATCACAGAGCTGGTTGG + Intergenic
1048865979 8:138762218-138762240 CTGCGAACCCCAGAGCTGGAGGG - Intronic
1049020912 8:139957211-139957233 ATGGAAACAGCAGACCTGGGAGG + Intronic
1049375834 8:142288657-142288679 CCGCAGACAGAGGAGCTGGTGGG + Intronic
1049884584 9:18550-18572 CTTCTAACAGCAGAGCTGCCAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1058132378 9:101267395-101267417 CTTCAAACAGCAGAGAAGGCTGG + Intronic
1059504655 9:114787387-114787409 CTGCAGACAGTAGAGGTGCTGGG + Exonic
1060602558 9:124887968-124887990 CTGGGGACAGCAGAGCTGGCAGG + Intronic
1061268941 9:129525355-129525377 CTCCAAACAGCAGGACTGCTTGG + Intergenic
1061973610 9:134057471-134057493 CCACAAACAGCACAGGTGGTCGG + Intronic
1062386009 9:136311823-136311845 CTGCCCACAGCAGGGCTGGGGGG - Intergenic
1062439799 9:136564591-136564613 CTGCAGGCAGCTGGGCTGGTCGG - Intergenic
1203782810 EBV:110313-110335 TTGCAAAAAGTAGAGCGGGTCGG + Intergenic
1186463627 X:9767434-9767456 CTTAAAACCGCAAAGCTGGTGGG - Intronic
1189208649 X:39264022-39264044 CTGAAAACATATGAGCTGGTTGG - Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1191057221 X:56254457-56254479 CTGCAAACAGCAAAGCTAAAAGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191604243 X:63044076-63044098 CTAGAAACAGCAGAGCTGGAAGG + Intergenic
1192073156 X:67962252-67962274 CTGCAAACTGAAGAGCTCTTGGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193211200 X:78809126-78809148 CTGCAAGCAGAAGTGGTGGTGGG - Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196717413 X:118824485-118824507 CTGGCAACAGCGGAGGTGGTGGG + Intronic
1197772103 X:130095737-130095759 CTGGAAACAGCAGAGCTTATAGG - Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199942231 X:152637961-152637983 CTGCGTCCAGCAGAGCTGCTGGG + Intergenic
1200401220 X:156021601-156021623 CTTCTAACAGCAGAGCTGCCAGG - Intergenic
1201262500 Y:12173975-12173997 CTGCATACAGCGAAGCAGGTTGG - Intergenic