ID: 1073453891

View in Genome Browser
Species Human (GRCh38)
Location 10:103625123-103625145
Sequence CAGAACAAGTAGTAGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073453891_1073453896 14 Left 1073453891 10:103625123-103625145 CCAACCCACTACTACTTGTTCTG 0: 1
1: 0
2: 2
3: 6
4: 125
Right 1073453896 10:103625160-103625182 GCCTTCTGTTCCAACCAGGCTGG No data
1073453891_1073453894 10 Left 1073453891 10:103625123-103625145 CCAACCCACTACTACTTGTTCTG 0: 1
1: 0
2: 2
3: 6
4: 125
Right 1073453894 10:103625156-103625178 ACCTGCCTTCTGTTCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073453891 Original CRISPR CAGAACAAGTAGTAGTGGGT TGG (reversed) Intronic
903649119 1:24912338-24912360 AGGAAGAAGTGGTAGTGGGTGGG - Intronic
906564443 1:46788517-46788539 CAGAACAACTTGAAGTGGGGAGG + Intronic
908781636 1:67696077-67696099 AAGAACAAGTAGGAGTTTGTTGG - Intergenic
909576318 1:77180692-77180714 CAGGACAACTAGAAGTGGGTGGG + Intronic
923479023 1:234365427-234365449 CAGAACATGTTGTACTGGCTAGG + Intergenic
924475122 1:244376087-244376109 AAGAACAAGCAGAGGTGGGTGGG + Intronic
1064330531 10:14389924-14389946 CTGAAGAAGTGGTAGTTGGTAGG - Intronic
1066718520 10:38312751-38312773 CAAAATAAGTAGAAGGGGGTCGG - Intergenic
1068523078 10:58098942-58098964 CAAAACAAGTAGTCATGGGAGGG - Intergenic
1069131351 10:64708070-64708092 CAGAACAAGGACTAGCAGGTTGG + Intergenic
1070514637 10:77193221-77193243 GAAAACAAGCATTAGTGGGTAGG - Intronic
1071789951 10:88942849-88942871 GAGAACAAGTGCTAGTGGGTTGG + Intronic
1072407662 10:95169907-95169929 CAGCACCAGGAGTAATGGGTGGG + Intergenic
1073453891 10:103625123-103625145 CAGAACAAGTAGTAGTGGGTTGG - Intronic
1082866326 11:57903033-57903055 CAGAACAACTTGAAGTGGGGTGG + Intergenic
1085109796 11:73877293-73877315 CAGAACTAGTATCAGTGAGTTGG + Intronic
1088294785 11:108280857-108280879 CAGAACTAGGATTAGTGAGTAGG + Intronic
1093015593 12:14151417-14151439 CAGAAGAAGTAGTTTTGAGTGGG + Intergenic
1099985018 12:89652094-89652116 CAAGACAACTAGTAGTGTGTTGG - Intronic
1103851954 12:123939115-123939137 CAGAACAAGAGGTGGTGGCTTGG - Intronic
1105463705 13:20617260-20617282 CTGAATAAGTAGGAGTGGGTTGG + Intronic
1107902766 13:45034399-45034421 TAGAACAAGTAGTTGAGGATGGG + Intronic
1110995235 13:82099559-82099581 AAGAAAAAGTAGCAGTAGGTGGG + Intergenic
1111378962 13:87420535-87420557 CAGAACAAGGTGTATTGGGATGG + Intergenic
1112190769 13:97175279-97175301 GGGAAGAAGTAGGAGTGGGTAGG - Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1120616568 14:86713181-86713203 CAAAACAATTAGTAGTTGCTCGG + Intergenic
1131145434 15:90008477-90008499 AAGAACTATTAGAAGTGGGTTGG + Intronic
1131423733 15:92328606-92328628 CAAAACAATCAGTAGTAGGTAGG - Intergenic
1135959354 16:26982940-26982962 CTGAACAAGCAGTGGTGGTTTGG - Intergenic
1140968391 16:79989448-79989470 AAGAAAAAGTAGGTGTGGGTAGG - Intergenic
1142016465 16:87750821-87750843 AAGAACAACTGGAAGTGGGTGGG - Intronic
1144013458 17:11171876-11171898 CGGAAAAAGCAGTACTGGGTAGG + Intergenic
1145230991 17:21173028-21173050 CAGAAGATGTAGCAGCGGGTGGG - Intronic
1145781600 17:27567430-27567452 TAAAAAAAGTTGTAGTGGGTAGG + Intronic
1145965390 17:28913084-28913106 CAGGACAAGGGGTAGTGGGAAGG + Exonic
1150180066 17:63109847-63109869 CAGAACTAGGACTAATGGGTAGG - Intronic
1151703778 17:75756494-75756516 CGGAACACGTAGGAGTGGTTGGG - Exonic
1152926289 17:83089225-83089247 AAGAACAGGGAGCAGTGGGTAGG - Intronic
1153370759 18:4313270-4313292 AAGAAAAAGTAGATGTGGGTTGG + Intronic
1153635685 18:7110892-7110914 GAGAACAATTAGAAGTGGGGGGG - Intronic
1153663434 18:7346598-7346620 CAAAGAAAGTTGTAGTGGGTAGG + Intergenic
1159787115 18:72727322-72727344 GAGAAGAACTGGTAGTGGGTGGG - Intergenic
1162015058 19:7841157-7841179 CAGAACATGGAATGGTGGGTGGG + Intronic
1167882413 19:52471029-52471051 CAGAACAGGAGGAAGTGGGTGGG - Intronic
927009223 2:18884801-18884823 TAGAAGAAGTTGTGGTGGGTAGG + Intergenic
930072611 2:47380015-47380037 AAGAAAAAGTAATAGTGGCTGGG + Intronic
932837889 2:75054365-75054387 TAGAACTAGAATTAGTGGGTGGG + Intronic
933917761 2:87013582-87013604 CTGAAGAAATAGAAGTGGGTTGG - Exonic
934005235 2:87756332-87756354 CTGAAGAAATAGAAGTGGGTTGG + Exonic
935768192 2:106390426-106390448 CTGAAGAAATAGAAGTGGGTTGG + Intergenic
937767597 2:125680019-125680041 GAGAACAACTGGCAGTGGGTGGG + Intergenic
939248745 2:139659944-139659966 CAGAATAAGAAGTAGTTGGTAGG - Intergenic
944320684 2:198338347-198338369 CATAACTAGTAGTAGGTGGTTGG + Intronic
947611701 2:231528719-231528741 CTGAAGAGGTAGTAGTTGGTAGG + Exonic
948022467 2:234747060-234747082 TTGAAGAAGTAGTAGTTGGTTGG - Intergenic
948074467 2:235155252-235155274 AAGAACACGCAGTAGTAGGTAGG - Intergenic
1168952177 20:1810071-1810093 CAGAACAAGTTGTAGAAGGCAGG - Intergenic
1171093053 20:22304300-22304322 CACAAAATGTAGTAGTGGGGAGG - Intergenic
1173034194 20:39393081-39393103 CTGATCAAGTAGGAATGGGTGGG + Intergenic
1174934690 20:54854637-54854659 TAGAAGAATTAGAAGTGGGTAGG + Intergenic
1179164900 21:38927683-38927705 CACAACAAGGAGTGATGGGTTGG - Intergenic
1182227282 22:28808736-28808758 CAGGACAATTAGAAGTAGGTGGG + Intergenic
1183976306 22:41514491-41514513 CACAACAACTAGTAGATGGTGGG + Intronic
949263730 3:2133077-2133099 CAGAGCAATCAGTAGTAGGTTGG + Intronic
950825535 3:15815594-15815616 CAGAACAATAAGAAGTGTGTGGG - Intronic
951207771 3:19942491-19942513 CAGACCAAGTTGCAGGGGGTAGG + Intronic
953243554 3:41170491-41170513 CAGAACCAGTACTTGTGGGCTGG - Intergenic
953485860 3:43294913-43294935 CACAATAAGTAATTGTGGGTTGG + Intronic
953596869 3:44324037-44324059 CAGCTCAGGTAGTAGTGGCTAGG - Intronic
953805629 3:46065242-46065264 CAAAACAAGTAATATTGGTTAGG + Intergenic
953810108 3:46104863-46104885 CAGAACAAGAAGCAGTGGGTTGG - Intergenic
955348299 3:58176902-58176924 CAGTATCAGTAGGAGTGGGTGGG + Intergenic
955907022 3:63817670-63817692 CAGAACTAGAAGGAGTGGGAAGG - Intergenic
959359264 3:105368115-105368137 CAGAACAGGAATTAGTAGGTAGG + Intronic
960574793 3:119218875-119218897 CAGGAGAAGCAGGAGTGGGTGGG - Intronic
961011641 3:123440348-123440370 CAGAGCAAGAGGTAGTGGGCAGG + Intronic
965670475 3:171142590-171142612 CAGGAAAAGTAGGAGTGGGGTGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
970709486 4:18845180-18845202 AAGAACAAGGTGTAGAGGGTAGG - Intergenic
973059000 4:45695798-45695820 CTGAAGAAGTGGTAGTTGGTAGG - Intergenic
975721368 4:77251666-77251688 CAAAACAAGTAGTTGTGGCTGGG - Intronic
975724596 4:77279650-77279672 CAAAACAAGTAGTTGTGGCTGGG - Intronic
979479873 4:121204357-121204379 CAGGACAACTTGAAGTGGGTAGG - Intronic
981784759 4:148464743-148464765 GAGAACAAGCAGTATTTGGTAGG + Intergenic
983235233 4:165171780-165171802 CAGTCAAAGCAGTAGTGGGTGGG + Intronic
984999226 4:185468517-185468539 CAGAACAAGTAGGGAAGGGTAGG - Intronic
987011787 5:13773854-13773876 CAGACAAAGGAGGAGTGGGTGGG + Intronic
990421085 5:55634027-55634049 CTTAACAAGTAGTTGTGGATGGG - Intronic
992221792 5:74580648-74580670 CAGCTCAAGTAGCAGTGGATTGG + Intergenic
994931364 5:106189930-106189952 CAGAACAGGTACTCCTGGGTGGG - Intergenic
995877894 5:116810348-116810370 CAAAACACTTAGAAGTGGGTAGG + Intergenic
996447140 5:123568009-123568031 TTGAAGAAGTAGTAGTTGGTTGG + Intronic
998007192 5:138664909-138664931 CTGAGCAAGAGGTAGTGGGTGGG + Intronic
998189495 5:140011006-140011028 CAGGACAAACAGTAGTGGGAGGG - Intronic
998205499 5:140154335-140154357 CAGAGCAAGCAGGAGTGGGGAGG - Intergenic
999525844 5:152404857-152404879 CTGAAGAGGTAGTAGTTGGTGGG + Exonic
1001735366 5:173994058-173994080 CTGAAGAAGTGGTAGTTGGTTGG + Intronic
1002276677 5:178108500-178108522 CAGAAGCAGTAGCAGTGGCTTGG + Intergenic
1003674893 6:8193854-8193876 TAGAACAAATAGAAGTGGGGAGG - Intergenic
1003904836 6:10689608-10689630 CAGAACTAGTAGAAGGGGATAGG + Intronic
1007292651 6:40798937-40798959 CAGAACAGGTAGGTGTGGGGAGG - Intergenic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1010575922 6:77531104-77531126 CAGAACAATTGAGAGTGGGTAGG - Intergenic
1010977358 6:82330842-82330864 CAGAACAAGTGTTTGTGGATAGG - Intergenic
1012622469 6:101362970-101362992 CTGATGAAGTAGTATTGGGTAGG - Intergenic
1015546930 6:134370910-134370932 CTGGACATGTAGTGGTGGGTGGG + Intergenic
1016962443 6:149687004-149687026 CAGAAGAAGTAGTTGTGGTCTGG - Intronic
1018129035 6:160710601-160710623 CTGAAGAAATAGAAGTGGGTTGG + Intronic
1021017940 7:15558927-15558949 CAGGACAAGAAGAAATGGGTGGG + Intronic
1022620403 7:31978122-31978144 CAGAAGAGGTAGTAGTGGGTGGG - Intronic
1027263455 7:76480893-76480915 CAGCACACGTGGTGGTGGGTGGG + Intronic
1027314828 7:76978992-76979014 CAGCACACGTGGTGGTGGGTGGG + Intergenic
1030060752 7:105618964-105618986 AAGTACAAGTAGAGGTGGGTGGG + Intronic
1031810403 7:126360887-126360909 CAGGACACCTAGAAGTGGGTGGG + Intergenic
1034319072 7:150162853-150162875 CATCAGAAGTACTAGTGGGTGGG + Intergenic
1035027598 7:155836118-155836140 CAGAGCAAGCAGTTGTGGGGCGG - Intergenic
1045899513 8:107260540-107260562 GAGAATAAGTAGTAGTGGTGGGG + Intronic
1046566366 8:115906120-115906142 CAGAACATGTAATAGTTTGTCGG + Intergenic
1047404955 8:124577741-124577763 AAGAACAAGGAGCAGAGGGTGGG - Intronic
1048761301 8:137798487-137798509 AAGAACAAGTTGGGGTGGGTTGG + Intergenic
1051965331 9:22821576-22821598 CTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1052741569 9:32398039-32398061 CAGAACTATCAGTAGTGGGCTGG - Intronic
1053029320 9:34760659-34760681 CAGGACTAGGAGTATTGGGTGGG - Intergenic
1057387197 9:94614544-94614566 AAGAAATAGTAGTAGTCGGTAGG + Intronic
1060631894 9:125166809-125166831 AAGGAAAAGTAGTTGTGGGTTGG - Intronic
1188247662 X:27854526-27854548 CAGAAGTACTAGTAGTGGATGGG - Intergenic
1188471287 X:30542528-30542550 CTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1190546978 X:51537809-51537831 CAGTACTAGTACTAGTGGGGAGG + Intergenic
1191201739 X:57790560-57790582 CAGAACAACTCGAAGTGGGCAGG - Intergenic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192914491 X:75638108-75638130 GAGAACAACCAGCAGTGGGTGGG + Intergenic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1195649146 X:107266508-107266530 CAGGAAAAGTAGTAGGGGGAGGG - Intergenic