ID: 1073453963

View in Genome Browser
Species Human (GRCh38)
Location 10:103625507-103625529
Sequence GGTGGGGGCAAGGGCATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073453946_1073453963 24 Left 1073453946 10:103625460-103625482 CCACAGCTGGAAGGATGGGGATG 0: 1
1: 0
2: 3
3: 39
4: 365
Right 1073453963 10:103625507-103625529 GGTGGGGGCAAGGGCATTTCAGG No data
1073453954_1073453963 -6 Left 1073453954 10:103625490-103625512 CCACAGGGTCCTCCCAGGGTGGG 0: 1
1: 0
2: 5
3: 52
4: 398
Right 1073453963 10:103625507-103625529 GGTGGGGGCAAGGGCATTTCAGG No data
1073453950_1073453963 0 Left 1073453950 10:103625484-103625506 CCATAGCCACAGGGTCCTCCCAG 0: 1
1: 0
2: 0
3: 13
4: 237
Right 1073453963 10:103625507-103625529 GGTGGGGGCAAGGGCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073453963 Original CRISPR GGTGGGGGCAAGGGCATTTC AGG Intronic
No off target data available for this crispr