ID: 1073454228

View in Genome Browser
Species Human (GRCh38)
Location 10:103626938-103626960
Sequence TGGGCCAACCTTACTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073454214_1073454228 26 Left 1073454214 10:103626889-103626911 CCCCTGAGACAGAGCAGCAGGGG 0: 1
1: 1
2: 4
3: 56
4: 416
Right 1073454228 10:103626938-103626960 TGGGCCAACCTTACTGAGATGGG 0: 1
1: 0
2: 0
3: 9
4: 71
1073454216_1073454228 25 Left 1073454216 10:103626890-103626912 CCCTGAGACAGAGCAGCAGGGGT 0: 1
1: 0
2: 5
3: 95
4: 995
Right 1073454228 10:103626938-103626960 TGGGCCAACCTTACTGAGATGGG 0: 1
1: 0
2: 0
3: 9
4: 71
1073454217_1073454228 24 Left 1073454217 10:103626891-103626913 CCTGAGACAGAGCAGCAGGGGTC 0: 1
1: 0
2: 3
3: 38
4: 356
Right 1073454228 10:103626938-103626960 TGGGCCAACCTTACTGAGATGGG 0: 1
1: 0
2: 0
3: 9
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073454228 Original CRISPR TGGGCCAACCTTACTGAGAT GGG Intronic
912176037 1:107158295-107158317 TGGAAAAAACTTACTGAGATCGG + Intronic
913592959 1:120346935-120346957 TGGTCTAAGCTGACTGAGATTGG - Intergenic
913650390 1:120908181-120908203 TGGTCTAAGCTGACTGAGATTGG + Intergenic
914170727 1:145220889-145220911 TGGTCTAAGCTGACTGAGATTGG - Intergenic
914525844 1:148464852-148464874 TGGTCTAAGCTGACTGAGATTGG - Intergenic
914597828 1:149170973-149170995 TGGTCTAAGCTGACTGAGATTGG + Intergenic
914640557 1:149602275-149602297 TGGTCTAAGCTGACTGAGATTGG + Intergenic
916752335 1:167734470-167734492 TAGGCCAAATTTACTGATATGGG - Intronic
917617591 1:176761866-176761888 TGGACAAACCTTACTGAAAGTGG - Intronic
920815763 1:209330203-209330225 TGGGCCACTCTTTCTGGGATTGG - Intergenic
1064106341 10:12503738-12503760 TGGGCCAACCTTTCAGGGTTAGG + Intronic
1065056139 10:21844402-21844424 TGGCCCAATCTTACTGTCATTGG + Intronic
1066030751 10:31421176-31421198 TGGGAGAACCTTACTTAGATGGG + Intronic
1073454228 10:103626938-103626960 TGGGCCAACCTTACTGAGATGGG + Intronic
1074698275 10:116070720-116070742 TGGGCCACCGTTACTTAGCTTGG - Intronic
1078731974 11:13983121-13983143 ATGGCCAACCTTGCTCAGATAGG - Intronic
1079090071 11:17474726-17474748 TGTGCCAACCTCTCTGAGCTGGG - Intronic
1084202269 11:67568318-67568340 TGGTCAAAGCTGACTGAGATTGG + Intergenic
1085845405 11:80059211-80059233 TAGGGCAACCTTACTCAAATTGG + Intergenic
1089113334 11:116074116-116074138 TGAGCCAAGCCAACTGAGATGGG + Intergenic
1089173817 11:116534373-116534395 TGGGCCCACCTGTGTGAGATAGG - Intergenic
1091144473 11:133265643-133265665 TGAGCCAACCCCACTGTGATGGG - Intronic
1102622096 12:114204240-114204262 AGGGCCAACCTGACTGGGATTGG - Intergenic
1102680243 12:114686001-114686023 TGGGCCAACCACGCTGAGATAGG + Intergenic
1114957598 14:27843887-27843909 TGAAACAACCTCACTGAGATGGG - Intergenic
1118311441 14:64696452-64696474 TGTGCCAACCCTCCTGAGAGAGG - Intergenic
1119013501 14:71022495-71022517 TGGGCCAAGCTCACTGAGTTTGG - Intronic
1121801957 14:96782098-96782120 TGGTCAAAGCTTACTGAGATTGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1143642985 17:8210217-8210239 TGGGCCATCCTTAGAGAGAAAGG + Exonic
1143835245 17:9686801-9686823 TGGGCCACCCTTCCTGATAAGGG + Exonic
1150458651 17:65328641-65328663 TGGGCCAGCCTTATTCAGGTTGG - Intergenic
1153842324 18:9017846-9017868 TGCGCCCACCTCACTGAGATAGG - Intergenic
1160026861 18:75225473-75225495 TGGGGCAAGCGTACAGAGATGGG - Intronic
1162042264 19:7978061-7978083 TGGGACCACCTTACAGAGAATGG + Intronic
1166537177 19:43581568-43581590 TTGACCAATCTTACTGAGAATGG + Exonic
1166639606 19:44484348-44484370 TTGCCCAACCTACCTGAGATGGG + Exonic
1167748294 19:51365684-51365706 GGAGCCAACCTGACTGAGCTGGG - Intronic
1168679894 19:58307167-58307189 TGGGCCACCATTCCTGAGAAAGG + Intronic
932734146 2:74242579-74242601 TGGGCCAGCCTTTCTGGGATGGG - Intronic
934479678 2:94624014-94624036 TGAAACAACCTCACTGAGATGGG + Intergenic
937967966 2:127528499-127528521 TGGGCCAACTGTACTGGGGTGGG - Intergenic
938378749 2:130825117-130825139 TGGGCCAGCCTTTGTGGGATGGG - Intergenic
942103667 2:172611716-172611738 TGAACCATCCTTACTTAGATGGG - Intergenic
942802556 2:179892413-179892435 GTGCCCATCCTTACTGAGATTGG - Intergenic
944637266 2:201686628-201686650 TCTGCCACCCTGACTGAGATTGG + Intronic
1175675800 20:60945710-60945732 TGCCCCAACTTTTCTGAGATTGG - Intergenic
1178807800 21:35854076-35854098 TGGGCCTTCCTTAGTGAGAGAGG + Intronic
1180199265 21:46214977-46214999 TGGGGCAACTTCACTGAGCTGGG + Intronic
951889782 3:27557611-27557633 TTGGCCTTCCTTGCTGAGATTGG - Intergenic
954101706 3:48378495-48378517 TGGGCCATCCTTTGTAAGATAGG - Exonic
957484180 3:80836016-80836038 TGGACCAACCTTAATGTGCTGGG - Intergenic
959461182 3:106627981-106628003 TGGGCCTAACCTACTCAGATAGG + Intergenic
973536372 4:51886640-51886662 TGAGTCAAACTTACTGAGTTGGG + Intronic
975254323 4:72216055-72216077 TGGGACAACCTGACTAAGAGAGG - Intergenic
976032890 4:80778837-80778859 TGGGGCAATCTCAGTGAGATTGG - Intronic
980474161 4:133289834-133289856 TGGCCCACCCTTTCTGAGACTGG + Intergenic
982568810 4:157022237-157022259 AAGGCCAACCTCAGTGAGATGGG - Intergenic
987854292 5:23398702-23398724 TTGGCAAAGCTGACTGAGATTGG + Intergenic
989981495 5:50650717-50650739 TGGTCTAAGCTGACTGAGATTGG + Intergenic
998225186 5:140321503-140321525 TGGTGCCATCTTACTGAGATGGG - Intergenic
999405526 5:151303584-151303606 AGGACCATCCTGACTGAGATGGG - Intronic
1003476771 6:6490978-6491000 TGGAACAATCTGACTGAGATTGG + Intergenic
1004758989 6:18645190-18645212 TGGGCCATGCTTCCTGAGATTGG - Intergenic
1005003815 6:21268740-21268762 TGGTCCTAGCATACTGAGATAGG + Intergenic
1005576374 6:27193420-27193442 TGGGCCAGCCATACTAAAATTGG - Intergenic
1005976660 6:30805267-30805289 TGGGGCATCCTTTCTGAAATGGG + Intergenic
1013077344 6:106783057-106783079 TGGGCCAGCCACACAGAGATTGG + Intergenic
1014526345 6:122506477-122506499 TGGGCCAGCCATACTAAAATTGG + Intronic
1018611775 6:165654294-165654316 TGGCCCAGCCTTGCTGAGACTGG - Intronic
1024013057 7:45287031-45287053 TGGACCAACCTTACTGACAAAGG + Intergenic
1046232541 8:111375979-111376001 TGGGCCTATTTTACTGATATGGG - Intergenic
1051528783 9:18077036-18077058 TTGGCCACATTTACTGAGATGGG + Intergenic
1053678148 9:40459570-40459592 TGAAACAACCTCACTGAGATGGG - Intergenic
1053928076 9:43087606-43087628 TGAAACAACCTCACTGAGATGGG - Intergenic
1054285579 9:63165374-63165396 TGAAACAACCTCACTGAGATGGG + Intergenic
1054291223 9:63295107-63295129 TGAAACAACCTCACTGAGATGGG - Intergenic
1054389244 9:64599646-64599668 TGAAACAACCTCACTGAGATGGG - Intergenic
1054506474 9:65916726-65916748 TGAAACAACCTCACTGAGATGGG + Intergenic
1185940688 X:4315634-4315656 TGGACCAAACTATCTGAGATAGG + Intergenic
1201386828 Y:13450383-13450405 TGGTCCTATCTTACTGAGCTGGG - Intronic