ID: 1073457615

View in Genome Browser
Species Human (GRCh38)
Location 10:103647102-103647124
Sequence TATCTTGGCCTGCCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073457615_1073457621 9 Left 1073457615 10:103647102-103647124 CCTGGCTGTGGCAGGCCAAGATA 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1073457621 10:103647134-103647156 AGTCCCAGCTGTCACCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073457615 Original CRISPR TATCTTGGCCTGCCACAGCC AGG (reversed) Intronic
900973085 1:6002181-6002203 TCTCTCTGCCTGCCACGGCCAGG - Intronic
901300965 1:8199983-8200005 GATCTTGGCCTTCCCCAGACTGG + Intergenic
904480002 1:30787676-30787698 TATTTGGTCCTGCCACAGGCAGG - Intergenic
905063446 1:35159443-35159465 TGCCTTGGCCTCCCACAGGCTGG + Intergenic
905825255 1:41021812-41021834 CTTCTTGGCCAGCCACAGGCAGG + Exonic
908333101 1:63090901-63090923 TACCTTGGCCTCCCAAAGCATGG + Intergenic
908489296 1:64626983-64627005 GTTCTTGGCCTACCACAGGCAGG - Intronic
908757430 1:67481729-67481751 TATCTTTGCCTGGCACATCGAGG - Intergenic
915913921 1:159930218-159930240 TTTCTGTGCCTGCCACAGCCGGG + Exonic
916664163 1:166950383-166950405 TCTCTTTGCCAGCCCCAGCCTGG - Intronic
918613808 1:186521818-186521840 CATCTTGTCCTGCAAAAGCCAGG - Intergenic
920302792 1:204999322-204999344 CATCTTGGCTTCCCACTGCCTGG + Intronic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
922887115 1:229028595-229028617 TATCTGGGCCCAGCACAGCCCGG - Intergenic
923141989 1:231168215-231168237 TACCTTGGCCTCCCAAAGCCTGG + Intronic
924673673 1:246153718-246153740 TGCCTTGGCCTCCCAAAGCCTGG + Intronic
1062816778 10:506713-506735 TCTATTTGCCGGCCACAGCCTGG + Intronic
1063944644 10:11165098-11165120 TTTCTTTCCCAGCCACAGCCAGG + Intronic
1072574192 10:96685380-96685402 TTTCTTGCCCAACCACAGCCTGG - Intronic
1073343553 10:102764521-102764543 TATAATGGCCGCCCACAGCCAGG - Intronic
1073457615 10:103647102-103647124 TATCTTGGCCTGCCACAGCCAGG - Intronic
1075728214 10:124621345-124621367 CATCTTGGCCTGTCCCTGCCTGG - Exonic
1077898283 11:6470515-6470537 TGCCTTGGCCTGCCAAAGCGTGG + Intronic
1081988873 11:47326968-47326990 TATCTTTCCCTTCCACATCCCGG - Intronic
1081997985 11:47377117-47377139 TCACTTGGCCAGCCACAGGCAGG - Intronic
1083485490 11:62980972-62980994 TTTCTGGGCCTACCACAGCATGG + Exonic
1083688787 11:64393663-64393685 TATCCTGGCTGGGCACAGCCAGG - Intergenic
1083960672 11:66013215-66013237 TCTCTTGGCCTGGAGCAGCCTGG + Intronic
1085405704 11:76260475-76260497 CATCCTGGCCTGGCACGGCCTGG - Intergenic
1085445503 11:76598229-76598251 CATCTTGCCCTGTCACAGACTGG - Intergenic
1085937098 11:81159883-81159905 TACCTAGGCCTCCCACAGGCGGG + Intergenic
1092470062 12:8770084-8770106 TATCTTGGCCTCCCACATGCAGG + Intronic
1093116130 12:15213437-15213459 TATCTTTTCTTGCCCCAGCCGGG - Intronic
1094635871 12:32226935-32226957 GATGTTGGCCTCCCACAGCTTGG + Intronic
1095888711 12:47215638-47215660 TATCTTGCTCTGCCACATACTGG + Intronic
1095942759 12:47737497-47737519 TATCTTGGCCCGGCACACCCTGG + Exonic
1106755018 13:32813863-32813885 TGTCTTGGCCTCCCAAAGCACGG - Intergenic
1107965953 13:45598480-45598502 TATCTTGGCCTGCCTCTTTCTGG + Intronic
1112308510 13:98296931-98296953 TACCTTGGCCTCCCAAAGCTGGG + Intronic
1119486315 14:74989957-74989979 CATCTTGGCCTCCCAAAGCACGG - Intergenic
1121639488 14:95475675-95475697 TACCTCGGTCTCCCACAGCCTGG + Exonic
1122043518 14:99007356-99007378 GATCTTGGCTGGCCACACCCTGG - Intergenic
1123893719 15:24807360-24807382 CAGCTTTGCCTGCCACAGCCAGG - Intergenic
1123919496 15:25060442-25060464 TCTCTTGGCCCGCCATTGCCAGG + Intergenic
1123920413 15:25065954-25065976 TCTCTTGGCCCGCCATTGCCAGG + Intergenic
1125530678 15:40411500-40411522 CATCTTGGCCTGTCTCAGCCAGG - Intronic
1126822143 15:52514862-52514884 TATCTGAGCATGCCACTGCCTGG - Intronic
1128740185 15:70078586-70078608 GATCTGGGCCTGCCCCAGCATGG + Intronic
1130361246 15:83188496-83188518 TACCTTGGCCTCCCAAAACCTGG + Intronic
1133774836 16:8888164-8888186 GATTGTCGCCTGCCACAGCCTGG - Intergenic
1134689061 16:16179025-16179047 TGCCCTGACCTGCCACAGCCTGG - Intronic
1136066605 16:27763065-27763087 TATCTTGGCCTCCCAATGCTGGG - Intronic
1136750775 16:32633846-32633868 TATCTTGGCCTCCCAAAGTGTGG - Intergenic
1137028528 16:35501267-35501289 TATCTTGGCGATCCCCAGCCAGG + Intergenic
1138523811 16:57590153-57590175 TGTCTTGCCCTGTCACACCCAGG + Intronic
1139878262 16:70163723-70163745 CAGCGTGGCCTGCCACACCCTGG - Intergenic
1140359301 16:74331091-74331113 CAGCGTGGCCTGCCACACCCTGG + Intergenic
1142411662 16:89920146-89920168 CATCTACGCCTTCCACAGCCAGG + Exonic
1142790441 17:2260187-2260209 CAACATGGCCTGCTACAGCCTGG + Intronic
1143042997 17:4053233-4053255 TATCTTGGGGTCCCACAGTCGGG + Intronic
1148317754 17:46718245-46718267 TTTCTTGTCATGCCACAGACTGG + Intronic
1151538484 17:74751829-74751851 TAACTTGGCTTCGCACAGCCTGG - Intronic
1152836200 17:82533827-82533849 TAGCTGGGCCTGGCACAGCTAGG + Intronic
1156003312 18:32410596-32410618 CATCTTGGCCTCCCAAAGCATGG + Intronic
1156302390 18:35846954-35846976 TATCATTGCCTGCTACAGCATGG + Intergenic
1161576796 19:5058857-5058879 TCGCCTGGCATGCCACAGCCTGG - Intronic
1163164643 19:15487541-15487563 TCTCCTGCCCTGCCTCAGCCTGG + Intronic
1164571527 19:29378237-29378259 GAACTAGGCCTGCCACACCCAGG + Intergenic
1165075047 19:33275901-33275923 CATGTTTGCCTCCCACAGCCCGG - Intergenic
1166215612 19:41332569-41332591 AATCATGGCATGCCACACCCTGG + Intronic
1167424185 19:49421456-49421478 TCTCTTCTCCTGCCCCAGCCTGG + Intergenic
925756640 2:7139275-7139297 CATCTTGGCCTCCCAAAGCCAGG + Intergenic
926951922 2:18252442-18252464 AGGCTTGGCCTGCCACAGTCAGG + Intronic
930209299 2:48617871-48617893 TGTCATGGCCTGCCTCAACCCGG + Exonic
933463427 2:82619464-82619486 TTTCTGGCCCTGCCACTGCCAGG + Intergenic
935549699 2:104439587-104439609 TTTCTTCTCCTTCCACAGCCTGG + Intergenic
936622675 2:114116840-114116862 GAGCTTGCCCAGCCACAGCCTGG - Intergenic
938558662 2:132450117-132450139 TTCCTTGACCTGCCAGAGCCTGG - Intronic
944870004 2:203900670-203900692 GAACTGGGCCTGCCACAGGCAGG - Intergenic
945090864 2:206174368-206174390 TATCTTGGCCTCCCAAAGTGCGG + Intergenic
945990773 2:216393647-216393669 TATCTAGGCCAGACACACCCTGG + Intergenic
946571595 2:221029746-221029768 TACCTTTGCCTGACACAGTCAGG - Intergenic
946890099 2:224266334-224266356 TATCCTGTCCTGCCTTAGCCTGG - Intergenic
947526238 2:230878360-230878382 AAGCTGGGCCTGCCAAAGCCTGG + Exonic
1176962456 21:15174905-15174927 TGCCTTGGCCTCCCAAAGCCAGG - Intergenic
1178386228 21:32152597-32152619 TATCTTGGCCACCCTTAGCCAGG + Intergenic
1179134733 21:38669494-38669516 TATCTGGGTCTGCCACAATCTGG + Intergenic
1179481673 21:41682388-41682410 TTTCTGGGCCTGCCAGAGCGGGG - Intergenic
1180558151 22:16593861-16593883 TGTCTTGCCCTGCCTCTGCCAGG - Intergenic
1181864713 22:25846151-25846173 CCTCCAGGCCTGCCACAGCCCGG - Exonic
1183412958 22:37666091-37666113 CATCTTGGCCTGACCCAGCCAGG + Exonic
1183479071 22:38052953-38052975 TCCCTTTGCCTGCCTCAGCCTGG + Intergenic
1183509933 22:38228766-38228788 TATCTCTCCCTGCCACCGCCAGG + Intronic
1183714526 22:39525945-39525967 TGCCTTGGCCTCCCAAAGCCAGG - Intergenic
950076326 3:10189775-10189797 TGTCTGGACCTGGCACAGCCCGG - Intronic
952306408 3:32150694-32150716 TCTGTTGGCCAGCTACAGCCTGG - Intronic
953597963 3:44336095-44336117 TATTTTGGTCTGGAACAGCCTGG + Intergenic
959063081 3:101633422-101633444 TATACTGGCCTGCCAATGCCAGG + Intergenic
959364764 3:105443072-105443094 TATCTTGGCCTCCCAAAGCCTGG + Intronic
961636720 3:128337644-128337666 TATCTGGACCTGTCACAACCAGG + Intronic
963404019 3:144839742-144839764 TATTTTGGCTTGCTACAGCAAGG - Intergenic
966235853 3:177700868-177700890 GATATTGGCCTCCTACAGCCTGG + Intergenic
966844894 3:184120890-184120912 CATCTTGGCCTCCCATAGCGTGG - Intergenic
972635178 4:40877863-40877885 TATCATGACCTGCCACACCCCGG + Intronic
976619457 4:87113517-87113539 TGTCTTGGCCTCCCAAAGCTGGG + Intronic
976644119 4:87369681-87369703 TGCCTTGGCCTCCCAAAGCCTGG + Intronic
977453376 4:97226483-97226505 TAGCTTGGCCTGACAGAGACAGG + Intronic
978738926 4:112115593-112115615 TACCTTGGCCTCCCAAAGGCTGG + Intergenic
983649015 4:170020348-170020370 AATATTGGGCTGCCACATCCTGG + Intronic
984972379 4:185203084-185203106 TGTCTTGGCCTCCCAAAGTCCGG - Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985635358 5:1033185-1033207 TATCCCGGCCAGCCACAGCCGGG - Intronic
987107668 5:14656483-14656505 TATCTTGGTCTGCTAGGGCCAGG - Intergenic
987584939 5:19842829-19842851 TATCTGAGACTGCCTCAGCCTGG - Intronic
989117198 5:37966246-37966268 TGTCTTGCCCTTCCATAGCCTGG - Intergenic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
995662265 5:114498599-114498621 CATCTCAGCCTGCCACACCCTGG + Intergenic
999445057 5:151632629-151632651 TTTCAAGGCCTGCCACAACCTGG - Intergenic
1000929014 5:167229762-167229784 CATCTTGGCATACCACAGCCAGG - Intergenic
1001940584 5:175736889-175736911 TGTCCTGGCCTCCCCCAGCCTGG - Intergenic
1004680787 6:17892459-17892481 CATCAAGGCCTGCCACAGCTGGG + Intronic
1007620443 6:43210223-43210245 CACCTTGGCCTGCCAAAGTCTGG + Intronic
1007760448 6:44130233-44130255 TATCTGGGTCTACCACAGACTGG + Intronic
1008516984 6:52327603-52327625 TGGCTTGTCCTGCTACAGCCCGG - Intergenic
1015882237 6:137881115-137881137 CATCCTGGCCTGCCGCAGCGAGG + Exonic
1018818851 6:167357544-167357566 TATCGTGGCCTCTCGCAGCCCGG - Intronic
1019434113 7:1012938-1012960 TATCTTGGGATGACACAGGCGGG + Intronic
1024240693 7:47433151-47433173 TAGCTGGGCCTGTCTCAGCCTGG - Intronic
1027187926 7:75982782-75982804 TCTGTAGGCCTGCCCCAGCCTGG + Intronic
1030654949 7:112157239-112157261 TGTTTTGGCCTCCAACAGCCTGG + Intronic
1031100141 7:117469907-117469929 TGTCTTGGCCTCCCAAAGCTAGG + Intronic
1031501628 7:122525072-122525094 TATCATGGCTCACCACAGCCTGG - Intronic
1031549596 7:123091908-123091930 CATCTTGGCCTCCCAAATCCTGG - Intergenic
1032395294 7:131585085-131585107 GATCTTGGCTCACCACAGCCTGG - Intergenic
1034619162 7:152444136-152444158 TGTCTTGCCCTGCCTCTGCCAGG + Intergenic
1036547865 8:9789557-9789579 TGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1037626859 8:20615705-20615727 CAGCTTGGCCTCCCAAAGCCTGG + Intergenic
1040402917 8:47070804-47070826 TGTCTTGGCCTCCCAAAGCTGGG + Intergenic
1040417192 8:47205984-47206006 TATTTTCAGCTGCCACAGCCAGG + Intergenic
1042310926 8:67378933-67378955 TGTCTTGGCCTCCCACAGCCAGG + Intergenic
1044510080 8:93066403-93066425 TGTCTTGGCCTCCCAAAGGCTGG - Intergenic
1046310457 8:112429534-112429556 TATGTTGTCCTGCCACACTCTGG - Intronic
1047548207 8:125839899-125839921 GATCTTGGCTTGCCACTCCCAGG - Intergenic
1049458175 8:142705518-142705540 CATCCTGGCCAGCCACTGCCTGG + Intergenic
1049981156 9:905033-905055 CCTCTTGGCATGCCACAGCAAGG - Intronic
1051472211 9:17457148-17457170 TATCTTGTCCTGCTCCAGCTTGG + Intronic
1052918002 9:33938940-33938962 TCTCTTCCCCTTCCACAGCCTGG - Intronic
1055528031 9:77155029-77155051 TGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1056803662 9:89711652-89711674 ATCCCTGGCCTGCCACAGCCTGG - Intergenic
1057818257 9:98311631-98311653 TATACTGGCCTGCCCAAGCCTGG + Intronic
1058834589 9:108849684-108849706 CATCTGAGCCTGCCTCAGCCTGG + Intergenic
1060535332 9:124382008-124382030 TACCTTGGCCTCCCAAAGGCTGG - Intronic
1186223534 X:7374582-7374604 CATCTTGTCCAGCCACAGCCTGG - Intergenic
1186792931 X:13016474-13016496 TATCCTGGCCTTTCACAGCCTGG + Intergenic
1187770202 X:22687057-22687079 TATCTAGGCCTGCTAGAGCAAGG + Intergenic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1189392943 X:40592402-40592424 CATCTTGGCCTCCCAAAGCTGGG - Intronic
1189523923 X:41799943-41799965 TATATAGGCCTTCCACAGCATGG - Intronic
1191104459 X:56764028-56764050 TCTCTTGTCCTGCTTCAGCCTGG - Intergenic
1192503018 X:71665588-71665610 TATCTTCTCTCGCCACAGCCTGG + Intergenic
1193486387 X:82089440-82089462 TAACCTTGCTTGCCACAGCCTGG - Intergenic
1193930006 X:87541922-87541944 TATCTGGGACTACCTCAGCCTGG - Intronic
1194868261 X:99096383-99096405 TCTCTTTGCCTGCAACATCCTGG - Intergenic
1196941446 X:120780396-120780418 TATTTTGGTGTGCTACAGCCTGG + Intergenic
1198455499 X:136813449-136813471 TAACTTGGCCTTCCAAAGCATGG + Intergenic
1201255469 Y:12103805-12103827 CATCTTGGCCTCCCAAAGCACGG + Intergenic
1201312474 Y:12609417-12609439 AACCTTGGCCTCCCAAAGCCTGG - Intergenic