ID: 1073457693

View in Genome Browser
Species Human (GRCh38)
Location 10:103647481-103647503
Sequence GTGGAGCTAGAGCATCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073457693_1073457696 5 Left 1073457693 10:103647481-103647503 CCAACAAGATGCTCTAGCTCCAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1073457696 10:103647509-103647531 GTAGAGGCCCTTTAAATCCAAGG No data
1073457693_1073457697 8 Left 1073457693 10:103647481-103647503 CCAACAAGATGCTCTAGCTCCAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1073457697 10:103647512-103647534 GAGGCCCTTTAAATCCAAGGAGG No data
1073457693_1073457701 23 Left 1073457693 10:103647481-103647503 CCAACAAGATGCTCTAGCTCCAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1073457701 10:103647527-103647549 CAAGGAGGCAAGTTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073457693 Original CRISPR GTGGAGCTAGAGCATCTTGT TGG (reversed) Intronic
900010701 1:104461-104483 GTGAAGGTAGAGAATCTGGTGGG + Intergenic
900026804 1:281025-281047 GTGAAGGTAGAGAATCTGGTGGG + Intergenic
900036601 1:414940-414962 GTGAAGGTAGAGAATCTGGTGGG + Intergenic
900058230 1:650688-650710 GTGAAGGTAGAGAATCTGGTGGG + Intergenic
907044643 1:51293021-51293043 GTGGAGCAGGAGGATATTGTAGG - Intronic
912976692 1:114337376-114337398 GGGGAGCTTGAGCAGCCTGTCGG + Intergenic
914904162 1:151730167-151730189 GTGGAGCCAGTGCATCGTGCAGG - Intergenic
916257502 1:162804668-162804690 GTGGAGAAAGAGCATTTTGTGGG + Intronic
918360338 1:183751074-183751096 GTGGAGCTTGAGCATTGTGCTGG + Intronic
919852713 1:201684139-201684161 ATGAACCTAGAGCATCTTGTAGG - Intronic
919992290 1:202716657-202716679 GTGGAGCTAGAGTATAGGGTAGG + Intergenic
920813245 1:209306713-209306735 GTGGATCTTGAGGATCTTGAAGG - Intergenic
922259141 1:223920470-223920492 GTGAAGGTAGAGAATCTGGTGGG + Intergenic
924340332 1:243023218-243023240 GTGAAGGTAGAGAATCTGGTGGG + Intergenic
1066723951 10:38370354-38370376 GTGGAGAAAGAGCATTTTGTGGG + Intergenic
1066736168 10:38482394-38482416 GTGAAGGTAGAGAATCTTGTGGG - Intergenic
1068009295 10:51427718-51427740 GTGAAGCTGGAGCTTCTTGTAGG - Intronic
1068952453 10:62790794-62790816 CAGGAGCTAGAGCATTTTGAGGG + Intergenic
1069147846 10:64917860-64917882 GTGGAGGTAGAGCACCATGTGGG + Intergenic
1070404621 10:76083851-76083873 GGGGCTCTAGTGCATCTTGTGGG + Intronic
1071507425 10:86241135-86241157 TGGGAGCTGGTGCATCTTGTGGG - Intronic
1073457693 10:103647481-103647503 GTGGAGCTAGAGCATCTTGTTGG - Intronic
1074893789 10:117757404-117757426 GTGGAACTACAGCAGCTTGAAGG + Intergenic
1077175800 11:1189816-1189838 GTGGAGCTTGTGCTGCTTGTAGG - Intronic
1079307218 11:19333952-19333974 CTGGAGCTATAGGACCTTGTAGG + Intergenic
1079709759 11:23666535-23666557 CTGGGGCTAGAGCTTCTTGGAGG + Intergenic
1081103847 11:39039446-39039468 GTGGAGCTACACGATTTTGTTGG + Intergenic
1082927230 11:58562793-58562815 GTGGAAATAGAGCGACTTGTGGG + Intronic
1087823358 11:102736689-102736711 GAGGAGCTAGAACATCTGGAAGG - Intergenic
1090074624 11:123572589-123572611 GTGGAGGTAGAGCACCGGGTGGG + Intronic
1091675137 12:2483792-2483814 GTGGAGTGAAAGCAGCTTGTGGG - Intronic
1091999856 12:5023099-5023121 GTGGGGCAAGAGCATAATGTTGG + Intergenic
1099519920 12:83648118-83648140 GTGGAGGTAGAGCATCATAAAGG - Intergenic
1108151576 13:47541418-47541440 GTGAAGCAAAGGCATCTTGTCGG + Intergenic
1111975534 13:94962996-94963018 GTGGAGCTCAAGCATCTGATGGG + Intergenic
1113277171 13:108743716-108743738 GTGGAACTAGATCATCTTAATGG + Intronic
1113625092 13:111789179-111789201 GTGCAGCTGGAGCATCTTAGTGG + Intergenic
1116635413 14:47388452-47388474 GTGGAGGTAGAACAGATTGTGGG - Intronic
1117384857 14:55201363-55201385 GTGGAGCTGGTGCCTTTTGTGGG - Intergenic
1120034547 14:79681423-79681445 ATGGAGCTAGATGATCTTGATGG + Intronic
1124435792 15:29648165-29648187 GTTGAGCTAAAGCCTCTTTTTGG - Intergenic
1124879241 15:33626280-33626302 ATGGAGATAGAGGAACTTGTTGG + Intronic
1142453645 16:90202455-90202477 GTGAAGGTAGAGAATCTGGTGGG - Intergenic
1142847555 17:2689653-2689675 GTGGAGCGGGAGCAGCGTGTGGG + Exonic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1151713031 17:75817570-75817592 GTGGGGCAAGAGAATCTTGGAGG + Intronic
1152389484 17:79994188-79994210 GCGGAGCCAGTGCATCTGGTGGG - Intronic
1156084645 18:33383342-33383364 GTGGAGCTGGTGCATTATGTTGG - Intronic
1156632347 18:38985222-38985244 GTGGAGCTGGAGCAGCTGGGAGG - Intergenic
1157952538 18:52055813-52055835 GAAGAACTAGAGCATATTGTGGG + Intergenic
1160584564 18:79905137-79905159 TCGGCTCTAGAGCATCTTGTTGG + Intronic
1163902485 19:20117114-20117136 GTGGAGGTAGAGAATGTGGTGGG - Intronic
1167120093 19:47511720-47511742 GTGGAGGTAGAGAAACTTGGGGG - Intronic
929010814 2:37442290-37442312 GTGCAGCTACAGCATCTAGATGG + Intergenic
930339905 2:50099058-50099080 AAGGAGCTACAGCATCCTGTAGG - Intronic
931430249 2:62203445-62203467 GTGGAGCAAGTCCATTTTGTGGG + Intronic
938218596 2:129545650-129545672 GTGGAACTAGAGCACTATGTGGG - Intergenic
938928410 2:136065029-136065051 TTGGAGCTACAGCAGCTGGTAGG + Intergenic
940910767 2:159207877-159207899 GAGGACCAAGAGCATCGTGTAGG + Intronic
949085090 2:242147113-242147135 GTGAAGGTAGAGAATCTGGTGGG - Intergenic
1172440705 20:34964449-34964471 GTGGAGCTAGAGAATGTTGGGGG + Intergenic
1182774795 22:32823160-32823182 TTGGGTCTAGAGCATCATGTAGG + Intronic
1183193849 22:36339665-36339687 GTGGTGGTAATGCATCTTGTTGG - Intronic
1184741653 22:46432053-46432075 GTGGAGCTTGAGCCTCATTTGGG - Intronic
951987009 3:28632281-28632303 CTGAAGCTATAGCATCTTTTTGG - Intergenic
952418636 3:33111815-33111837 GGGGAGCTTGCGCATGTTGTAGG - Intergenic
960089710 3:113626886-113626908 GTGGAGCCCGGGCATCTAGTAGG - Intronic
961029044 3:123585877-123585899 GGGAAGCTGGAGCAGCTTGTGGG + Intergenic
962526332 3:136241124-136241146 GTGGAATTGGAGCATATTGTAGG + Intergenic
965967753 3:174515633-174515655 GTTGAACTAGAGAATCTTTTAGG + Intronic
975421301 4:74167258-74167280 GTGGATCTAGAGATTCTTGATGG - Intronic
981832988 4:149023376-149023398 GTGGTGCCAGAAAATCTTGTAGG - Intergenic
986321618 5:6636527-6636549 GGGGAACTAGAGCCTCTTTTGGG + Intronic
990037739 5:51342615-51342637 TGGGAGCCAGAGCATCTTGTGGG - Intergenic
995194478 5:109348322-109348344 TAGGAGCAAGAGCATCTTTTAGG - Intronic
996071464 5:119136645-119136667 CTGGAGCTAGAGCAGCTGGGAGG - Intronic
999813908 5:155156270-155156292 GTGGGGCTGGAGAATATTGTAGG + Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1002737220 5:181403922-181403944 GTGAAGGTAGAGAATCTGGTGGG - Intergenic
1005343014 6:24860996-24861018 GTGGAGCTAGAGAATCTGCTGGG - Exonic
1005646670 6:27845972-27845994 GTGGAGCAAGAACATATTCTGGG + Intronic
1006351997 6:33527724-33527746 GTAGAGCTACAGGATCTTGGAGG + Intergenic
1007008254 6:38388280-38388302 CTGGAGCCAGACCATGTTGTTGG + Intronic
1007594598 6:43043706-43043728 GTGGAGATAGAGCAACTGGACGG + Intronic
1007851509 6:44807129-44807151 GGGGAGCTACAACATCATGTGGG - Intergenic
1009821623 6:68809975-68809997 TTGGAGTAAGAGCATTTTGTGGG + Intronic
1013883581 6:114934156-114934178 CTGGAGCTAGAGCTTCTTGGAGG + Intergenic
1019242316 6:170679488-170679510 GTGAAGGTAGAGAATCTGGTGGG - Intergenic
1022805085 7:33813572-33813594 GTGTAGCTAGTGGAGCTTGTTGG + Intergenic
1023298270 7:38739645-38739667 CTGGAGCTCAGGCATCTTGTTGG - Intronic
1025020220 7:55474724-55474746 CTGGAGCTGGAGCCTCCTGTGGG + Intronic
1028208307 7:88042299-88042321 TGTTAGCTAGAGCATCTTGTAGG + Intronic
1030031338 7:105372621-105372643 GTGAAGGTAGAGCAACTTGATGG - Intronic
1030199807 7:106891166-106891188 GTGGAGGGACAGCACCTTGTAGG + Intronic
1030793835 7:113762420-113762442 GCAGAGCTGGAGCATCTTGAAGG + Intergenic
1031267058 7:119594316-119594338 GTGGTGCTTCAGCATCTTTTTGG + Intergenic
1031967941 7:128041480-128041502 GTGGAGCAAGAGCAGATTGGAGG - Intronic
1035505802 8:128662-128684 GTGAAGGTAGAGAATCTGGTGGG + Intergenic
1041612186 8:59863816-59863838 GAGGAGCTAGAGAATGTTCTGGG + Intergenic
1041909345 8:63071941-63071963 GTGTAGCTAGTGTTTCTTGTAGG - Intronic
1048377278 8:133833746-133833768 GTGGAGCTAAGGTATCTTTTAGG - Intergenic
1056985920 9:91363690-91363712 GTGGAGCTAAAGCCTCTGTTGGG + Intergenic
1057247168 9:93466471-93466493 GTGCACCTAAAGCATCTCGTAGG - Intronic
1058597692 9:106632388-106632410 GTGGGGCCAGACCATATTGTGGG + Intergenic
1059341706 9:113601100-113601122 GTGAAGCTGGAGAATCTGGTGGG - Intergenic
1060105908 9:120873421-120873443 ATGGAGCTAGACCAGCTTTTAGG - Intronic
1061242154 9:129381016-129381038 GTGGAGCTGGAGTCTTTTGTGGG - Intergenic
1203602507 Un_KI270748v1:28710-28732 GTGAAGGTAGAGAATCTGGTGGG - Intergenic
1186539096 X:10382051-10382073 GTGGAGGTAGAAGATGTTGTGGG - Intergenic
1186644057 X:11487374-11487396 GTGAGGCTACAGCATTTTGTTGG + Intronic
1189580840 X:42404599-42404621 GTGGAATTAGAGCATGATGTTGG + Intergenic
1192694305 X:73398588-73398610 TTGGGGCTAGAGCAACTTGGAGG + Intergenic
1193690415 X:84634693-84634715 GTAGAGATAGAGCATCAGGTAGG - Intergenic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1197015997 X:121626912-121626934 GTGGGGATAGAGCATCAGGTTGG + Intergenic
1197944736 X:131826982-131827004 GTGGAGCTATAACATCTACTAGG - Intergenic
1198284007 X:135171754-135171776 GTGGAGAGAGGGCATCATGTGGG + Intergenic
1198286370 X:135195260-135195282 GTGGAGAGAGGGCATCATGTGGG + Intergenic
1199255540 X:145715021-145715043 CTGGAACTAGAGCAACCTGTTGG + Intergenic