ID: 1073458238

View in Genome Browser
Species Human (GRCh38)
Location 10:103650584-103650606
Sequence CTGGCAAAGCTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 417}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073458238_1073458252 26 Left 1073458238 10:103650584-103650606 CCTTCCTCCTTCAGCTTTGCCAG 0: 1
1: 0
2: 3
3: 58
4: 417
Right 1073458252 10:103650633-103650655 GGCCTACCTTCTCCAGAAGTAGG No data
1073458238_1073458247 5 Left 1073458238 10:103650584-103650606 CCTTCCTCCTTCAGCTTTGCCAG 0: 1
1: 0
2: 3
3: 58
4: 417
Right 1073458247 10:103650612-103650634 TGGGGCCTGCCCCTTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073458238 Original CRISPR CTGGCAAAGCTGAAGGAGGA AGG (reversed) Intronic
900173972 1:1283991-1284013 CTGGCAGCTCTGAAGCAGGATGG - Exonic
901089770 1:6633465-6633487 CTGTCCAGGCTGATGGAGGAGGG - Exonic
901104399 1:6743993-6744015 CTGGCAAACATTAAGGAGGAAGG - Intergenic
901571706 1:10166133-10166155 CTGGCAGAGCTGAAGCTGGCCGG - Intronic
901726582 1:11247725-11247747 CTGGCACACCTGAGAGAGGAAGG + Exonic
902074802 1:13775807-13775829 CTGGCAGAGCAGAATGAGAATGG - Intronic
902645283 1:17793593-17793615 CTGGAAAAGCTGTAGGGGAAGGG - Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903105958 1:21080205-21080227 CTTGGAAAGCTAAGGGAGGAGGG + Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
903984691 1:27218095-27218117 CTGACAAAGATGAGGAAGGATGG - Intergenic
903998475 1:27323045-27323067 CTGTCAAGGTTGAAGCAGGAGGG - Intronic
904274046 1:29368962-29368984 CTGTCAAAGCTGGATGGGGAGGG + Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905142848 1:35862159-35862181 AGGGCAAAGCTGAAGGAAGTTGG + Intergenic
905659969 1:39714325-39714347 ACTGCAAGGCTGAAGGAGGAAGG + Intronic
905918001 1:41699214-41699236 CTGGCACCGCTGCAGGAGGTGGG + Intronic
905975258 1:42169565-42169587 ATGGCAAAGGTGTAGGAGGCTGG - Intergenic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907666235 1:56435978-56436000 CTTGCCAGGCTGGAGGAGGAGGG - Intergenic
908003723 1:59707382-59707404 GAGGCCAAGCTGTAGGAGGAGGG + Intronic
909697693 1:78485382-78485404 CTGGCATACCTGAAGGAGATGGG + Intronic
910366292 1:86468715-86468737 CTGGCACAGCTGAAGGCAGATGG + Exonic
910526457 1:88184348-88184370 CTGGCAAAGCTGCATGGGGGAGG + Intergenic
911860708 1:102944481-102944503 CTGGGATAACTGAAAGAGGATGG + Intronic
912196174 1:107399889-107399911 CAGGCAGAGATGAAGGAAGAGGG - Intronic
912624179 1:111194251-111194273 CTTGCAAGGCTGAGGGAGGGTGG - Intronic
912797640 1:112702558-112702580 CTGGCCAAGATGAAGCAGGTGGG - Exonic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914196779 1:145451871-145451893 CAGGCAAAGTGGGAGGAGGAGGG + Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
915170645 1:153974896-153974918 CTGGCTAGGCTGAAGTAGAAGGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
918218996 1:182418586-182418608 CTGCCAAAGTTGCAGGGGGAAGG + Intergenic
921841685 1:219835333-219835355 CAGGTCAAGCTGAAAGAGGATGG - Intronic
922099866 1:222471401-222471423 CTGGCACAGCTGCAGGGGTAGGG - Intergenic
922323291 1:224506395-224506417 AAGCCAAGGCTGAAGGAGGAAGG - Intronic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
922989511 1:229894440-229894462 CTCACAGAGCTGCAGGAGGAAGG + Intergenic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923441927 1:234028704-234028726 CTGGCAAAGCTACAGGAGGTGGG + Intronic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG + Intronic
1064205378 10:13319593-13319615 CTGGGAAAGCTGAAGTGGGAGGG - Intronic
1064705644 10:18069916-18069938 ATGGCAAAGCTGAAAGAGCATGG + Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065421317 10:25547470-25547492 CAGGCAAAGATGAAAGAGGGAGG - Intronic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1067031284 10:42879909-42879931 CTGGCAAATCTGAAGGACCCTGG - Intergenic
1067188017 10:44046532-44046554 ATGGCAAAGATGAAGTAGCAAGG - Intergenic
1067217604 10:44316029-44316051 GTGGCCATGCTGAAGCAGGAAGG + Intergenic
1067232587 10:44422590-44422612 CTGTCAAAGCTGGAAGATGAAGG - Intergenic
1069240298 10:66130016-66130038 CTGGCAGAGGTGAAGCAGGCAGG - Intronic
1070247032 10:74742531-74742553 CTTGCAAAGCAGAAGGAAAAAGG + Intergenic
1070377875 10:75851827-75851849 CTTAGAAAGCTGAAGGAGTACGG + Intronic
1071030277 10:81171736-81171758 CTGGAAAAGGTGAAAAAGGAAGG + Intergenic
1072435347 10:95409352-95409374 ATGGCACCGCTGAAGGAGAATGG + Intronic
1072460121 10:95611061-95611083 TTGTCACAGCTGGAGGAGGAGGG - Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1072904951 10:99444546-99444568 CTGACTAAGCTGCAGGAGAAGGG + Intergenic
1073045093 10:100632461-100632483 ATGGCACAGCAGAAGGAGCATGG + Intergenic
1073250000 10:102115281-102115303 CTGGCAGAGATGGAGGAGGGCGG + Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073472784 10:103733429-103733451 TGGGCAAAGCTAATGGAGGAGGG - Intronic
1075119542 10:119654564-119654586 CTGTCATTGCTGAAGCAGGACGG + Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1077500051 11:2905253-2905275 CTGGCAGTGGTGATGGAGGAGGG + Intronic
1077967703 11:7153343-7153365 CTGGCAGAGCTGCCAGAGGAAGG - Intergenic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078456839 11:11482249-11482271 CTGGCACAGCTGGGGGAGGATGG - Intronic
1081379324 11:42395117-42395139 CTGGCACATGTGAATGAGGACGG + Intergenic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1083151331 11:60793623-60793645 TTGGCATAGCTGATGTAGGATGG + Intronic
1083635627 11:64119337-64119359 CTGGCCAAGCTGAGCCAGGATGG - Intronic
1084707556 11:70824111-70824133 CTGGCAGAGCTCATGGGGGATGG + Intronic
1084765043 11:71302745-71302767 CTGGAAAGGCTGAAGTGGGAGGG - Intergenic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085502376 11:77035638-77035660 CTGGCAAAGTTTAAGGTGCATGG + Intronic
1085742933 11:79092360-79092382 CTGGGAAAGGTGCATGAGGAGGG - Intronic
1085875265 11:80399604-80399626 GAGGTAAAGCTGACGGAGGAGGG + Intergenic
1087339336 11:96882649-96882671 CTGGCAAGGCTGCAGGGGAAAGG - Intergenic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1088422588 11:109665884-109665906 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088972004 11:114781761-114781783 CTGGTGGAGGTGAAGGAGGAAGG - Intergenic
1089170535 11:116508406-116508428 CAGGTAAAGATGAAGGAGAAAGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1092244526 12:6856223-6856245 CTGACAAAGCTGAAGGCCAAGGG + Intronic
1092836041 12:12489204-12489226 CTGGCATAGCTGAAGGGTGTTGG - Intronic
1093614606 12:21207777-21207799 CTGGCAAGGCTGCAGAAGAAAGG - Intronic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1095394162 12:41743453-41743475 CTTGGGAAGCTGAAGCAGGAGGG - Intergenic
1096487948 12:51996296-51996318 CTGCCAAAGCTTGTGGAGGAGGG + Intronic
1097492160 12:60283438-60283460 CTGCCAAAGCTGAATGAGCAAGG - Intergenic
1098061969 12:66572583-66572605 AGGACAATGCTGAAGGAGGAGGG + Intronic
1098641310 12:72840920-72840942 CTGGCAACCCTGAAAGAGAAAGG + Intergenic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1100341843 12:93686435-93686457 CTGGCATAGTTAAAGCAGGAAGG + Intronic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1102678800 12:114676243-114676265 CTGGAAGAGTTGAAGGGGGATGG - Intronic
1103520695 12:121535821-121535843 GGGGCAGAGCTGAAGGAGGAGGG + Intronic
1105743069 13:23349101-23349123 CTGGAAAACCTGCAGCAGGAGGG + Intronic
1106413217 13:29525252-29525274 CTGGCAAAGGTGTGGGAGTAGGG - Intronic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1107871414 13:44749697-44749719 CTGTCAAGGGTGGAGGAGGATGG + Intergenic
1108360338 13:49663164-49663186 ATGGCAAAGCTGATGCAAGATGG - Exonic
1108588707 13:51893438-51893460 CTGGTGAAGCTAAAGGAAGAGGG - Intergenic
1108596448 13:51954144-51954166 CAGGCAAAGGTTAAGGAAGAAGG + Intronic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1109378508 13:61526510-61526532 ATGGCAAAGCTGAAAGAGCTTGG - Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1114566828 14:23639267-23639289 ATGGCCAAGCTGCAGGGGGAGGG + Exonic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114617025 14:24073711-24073733 GAGGCAAAGCTGATGGAGGTAGG - Intronic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115899319 14:38127273-38127295 CTAGCAATTCTGAAGGAGAATGG + Intergenic
1116216586 14:42024816-42024838 CCAGCAAAGCTGAGGGAGCAGGG - Intergenic
1116430457 14:44840041-44840063 CTGGCTAATATGAATGAGGAGGG + Intergenic
1116968754 14:51042761-51042783 CTGGCAAAGCTCATGAAGAAGGG - Intronic
1117967638 14:61221807-61221829 CTGACAAAGCTGCAGCAGGAAGG - Intronic
1118049702 14:62013628-62013650 CAGGTAAAGTTGAAGGAGGTGGG - Intronic
1118727109 14:68636825-68636847 CTGGCAAAGCAGGAGGACGGCGG + Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1120560618 14:85987921-85987943 CTGGCAAGGCTGAAAGAAGACGG - Intergenic
1121080051 14:91100579-91100601 CTTGCAAAGCTGGATGAGGCTGG + Intronic
1121366271 14:93313986-93314008 TTTGCAAAGCTGAGGCAGGAAGG - Intronic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1122201305 14:100124237-100124259 CTGACAAAGCTGAGTGAGGAAGG - Intronic
1122804732 14:104250604-104250626 CTGGTAAAGGTGGAGGGGGAGGG + Intergenic
1124052903 15:26215444-26215466 ATGGCAGAGCTGCAGGAGCATGG + Intergenic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1124666294 15:31595765-31595787 CTGGCACACCTGAAGGAGGCTGG - Intronic
1126336017 15:47587157-47587179 GGAGCAAAGCTGAAGGAGGCAGG + Intronic
1126396510 15:48224038-48224060 CTGGCCATGCTCAAGGAGAAGGG - Intronic
1127966799 15:63928779-63928801 CAGGCAAAGAGGAAGGAGAAAGG + Intronic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1129291874 15:74574512-74574534 CTGCCAAAGGTAAAGGAGTAGGG - Intronic
1129426737 15:75468935-75468957 CTGGCACAGCTGGAGGAGCTTGG - Exonic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129772491 15:78211734-78211756 CTGGCAAGGTAGAAGGAGTAAGG - Intronic
1129946804 15:79545641-79545663 CTGGGACAGGTGAAGGAGGGGGG - Intergenic
1130956570 15:88631014-88631036 CAGGCACAGCTCAGGGAGGAGGG + Exonic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1133303732 16:4797729-4797751 CTGGCAGAGCTGCAGGGAGACGG + Exonic
1135963652 16:27018354-27018376 CAGGCAAAGCTAAAGGAAGAAGG + Intergenic
1136251865 16:29010652-29010674 CTTGGAAAGCTGAGGCAGGAGGG + Intergenic
1136381475 16:29898066-29898088 CAGGCCCAGCTGATGGAGGAGGG - Intronic
1136631128 16:31489864-31489886 CTGACAAAGCTGGGGGAGCAAGG + Exonic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138583600 16:57956965-57956987 TTGGCCAAGCTGAAGGGAGAGGG - Intronic
1138807127 16:60103339-60103361 CTGGCAAATCTTAGGGATGATGG + Intergenic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139140873 16:64260919-64260941 ATGGCAAAGCTGATGCAAGATGG - Intergenic
1139461100 16:67123178-67123200 GTGGCAAAACTAAAGGAGGAAGG - Intronic
1139522401 16:67491742-67491764 CTAGCAGTGCTGCAGGAGGAAGG - Intergenic
1139665043 16:68449080-68449102 CCAGCAAAGGTGAGGGAGGACGG + Intergenic
1140035041 16:71365263-71365285 CTGGTGCAGCTCAAGGAGGAAGG + Intronic
1140139407 16:72240965-72240987 GTGGCAAAGGTGCAGGTGGAGGG + Intergenic
1141622196 16:85242271-85242293 CTGGCAGAGGGGAAGCAGGAGGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1142984554 17:3688097-3688119 CTGGCAAATCTGAGGGAGACAGG + Exonic
1143593699 17:7901328-7901350 CTGCGAAAGCTGAAGGAGCAAGG + Exonic
1143890196 17:10096960-10096982 CTGGCATAGCTGCAGGGTGAGGG - Intronic
1144203350 17:12961101-12961123 CTGGCAGAGAGGATGGAGGAGGG - Intronic
1146067701 17:29649492-29649514 CTTGGAAAGCTGAGGGAGGTGGG - Intronic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1146724803 17:35148279-35148301 GCGGTACAGCTGAAGGAGGAAGG + Exonic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148988937 17:51648597-51648619 AGTGCAAAGTTGAAGGAGGAAGG - Intronic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1150000505 17:61434130-61434152 ATGTCACAGCTGAAGGGGGATGG + Intergenic
1150008617 17:61485593-61485615 CTGGCAAAGGTGCAGGCGAATGG - Intergenic
1150446652 17:65231787-65231809 CTGGGAAGGCTGAAGGAAGCCGG + Intergenic
1150472125 17:65446352-65446374 CTGGGAAGGCTGCAGGAAGAGGG + Intergenic
1151832907 17:76566110-76566132 CTGGTACAGCTGAAGGATGCCGG + Exonic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156465735 18:37347010-37347032 ATGCCAAGGCTGAAGGGGGAGGG + Intronic
1156955099 18:42952967-42952989 CTGGGAAAGCTGAGAAAGGATGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158491760 18:57916442-57916464 CTCTCAAAGCTGAGGGAGGCAGG + Intergenic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1162424168 19:10583982-10584004 CTGGTACAGCGGGAGGAGGAAGG - Exonic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163025240 19:14507188-14507210 CTGGCATAGGGGAGGGAGGATGG - Intergenic
1163844074 19:19628655-19628677 CTGGCAAAGCCGAAGCTGGGCGG - Exonic
1164714837 19:30383964-30383986 CTGGCAGAGTGGAAGAAGGAAGG - Intronic
1165263003 19:34636851-34636873 CTGACAAAGCTATGGGAGGAGGG - Intronic
1165789441 19:38482838-38482860 CTGGGAAAGTTGGAGGAGGTTGG + Intronic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1167619863 19:50554851-50554873 CTGGCAAGGCTGACCTAGGAGGG - Intronic
1167744936 19:51345221-51345243 GTGGCCAAGCTGAAGGAGATTGG - Exonic
1168075846 19:53980621-53980643 CTGGAAAAGCCAAAGGGGGAGGG + Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
926163296 2:10502790-10502812 CTTGCAGAGCTGTAGGAGGAGGG - Intergenic
927069030 2:19506160-19506182 CTGGGAAAGCTGAACGTGTATGG + Intergenic
927085320 2:19669432-19669454 ATGGCAACACTGAAGGATGATGG + Intergenic
927096282 2:19749944-19749966 CTGGCCCAGCTGCAGGAGGCTGG - Intergenic
927739658 2:25557080-25557102 ATGGCAGAACTGAAGTAGGAAGG + Intronic
929603554 2:43219822-43219844 CTGGCACGGCTGAGGGAGGGAGG - Intergenic
929810797 2:45187970-45187992 CTTGCAAAGCAGCAGGAAGAAGG - Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
929978187 2:46655030-46655052 CTGCCAAAGCTGCAGAAGGTCGG + Intergenic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
931112615 2:59128053-59128075 CTAGCAAAGTTTAGGGAGGATGG - Intergenic
932198115 2:69801760-69801782 CTTGCAAAGCAGAAGTAGGCTGG + Intronic
932216442 2:69969328-69969350 CTGGCAAGGCTGACGGCAGAGGG - Intergenic
932231244 2:70086387-70086409 CTGGCTTAGCCCAAGGAGGAAGG + Intergenic
934157215 2:89214577-89214599 CTGGCCCAGCTGAAAGAGGTAGG - Intergenic
934210099 2:89968167-89968189 CTGGCCCAGCTGAAAGAGGTAGG + Intergenic
935690222 2:105724501-105724523 CTGACAAAGCTTAAGGAAAAAGG - Intergenic
935850823 2:107216985-107217007 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
936054806 2:109254487-109254509 GAGGCAAAGCTGAACGAGGCTGG - Intronic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936595464 2:113843088-113843110 CTGGCAGGGCTGAAAGAGAATGG + Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937413965 2:121699684-121699706 CTTGCAAGGCTGAGGGAGGTGGG - Intergenic
937787114 2:125914086-125914108 TTGGCAAAGCTTTAGGTGGATGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
938752046 2:134341743-134341765 CTGGCTGAGCTCAAGGAGTAAGG + Exonic
939052029 2:137318742-137318764 TTGGAAAAGCTGAAGGACAAAGG - Intronic
940426437 2:153536385-153536407 CTGTCCAATCTGGAGGAGGAGGG + Intergenic
941459426 2:165750941-165750963 CAGGCAAAGCCAAAGAAGGAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942396175 2:175551989-175552011 CTAGCAAAGCAGATGGGGGAGGG + Intergenic
943786454 2:191883032-191883054 TGGGCAAAGGTGAAGGAGGCAGG - Intergenic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
945717475 2:213377702-213377724 CTGGCAAGGTTGAAGGTGCAAGG + Intronic
947074837 2:226331224-226331246 CAAGAAAAGCTGAAGGAGAAAGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
948055404 2:235006608-235006630 CTGGCAAAGCAGAGCGAGGGGGG - Intronic
948355713 2:237375324-237375346 CTGGCAATGAGGATGGAGGATGG + Intronic
1171057513 20:21921486-21921508 CCGTCAAAGCTTAAGGAGAACGG + Intergenic
1171113609 20:22505355-22505377 CTGGGAAAGATGATGGAGAATGG + Intergenic
1171471855 20:25378463-25378485 GTGGCAAAGGTCAAGGATGAAGG + Intronic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1174933129 20:54837453-54837475 CTGGCAAGAGTGAAGGAGAATGG + Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1176115128 20:63428863-63428885 CTGCCAAAGCTGGAGGAGTTGGG + Intronic
1179878109 21:44281715-44281737 CTGGCCAGGCTGCAGGAGCAGGG + Intergenic
1180749124 22:18111928-18111950 CTGACAAAACTGAAGCTGGAAGG - Intronic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1181504002 22:23338540-23338562 CTGGCAAAGCTGAAAGAGAAGGG - Intergenic
1181654843 22:24288074-24288096 CTGGCAGAGCTGAAAGAGAAGGG - Intronic
1181708997 22:24668759-24668781 CTGGCAGAGCTGAAAGAGAAGGG - Intergenic
1182153380 22:28047277-28047299 CTGGCAGGGCAGAAGCAGGATGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183029859 22:35095473-35095495 CTGGCAATGGAGAAGGAGGTTGG + Intergenic
1183300526 22:37056885-37056907 CTGGCCAGTCTGCAGGAGGAGGG + Intronic
1183408054 22:37640017-37640039 CGGGCAGAGCTGGAGGAGCAAGG + Intronic
1183413828 22:37671515-37671537 CTGGCGGTGCTGAAGGAGGGCGG - Intergenic
1183465952 22:37980532-37980554 CCGGCACAGCTGGTGGAGGAGGG - Intronic
1183520833 22:38295251-38295273 CAGGCAAAGCTGGAGCAGAAGGG + Intronic
1183859492 22:40659424-40659446 CTGGCCAAACTGAAGAATGAAGG + Intergenic
1184323357 22:43761134-43761156 CTTGCAGAGTGGAAGGAGGAAGG - Intronic
1184930919 22:47680786-47680808 CTGAGAAAGCTTAAAGAGGAGGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185081675 22:48712845-48712867 CTCTCAGAGCTGGAGGAGGAGGG + Intronic
1185172045 22:49299823-49299845 CGGGCAACTCTGACGGAGGAGGG + Intergenic
949394614 3:3601622-3601644 CTGTCAAAGCTGACAAAGGATGG + Intergenic
949642083 3:6047984-6048006 CTGGCAAAGAGAAAGGAAGAGGG - Intergenic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
950919874 3:16683661-16683683 CGGGAAAACCTGAAGTAGGAAGG - Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952014768 3:28943219-28943241 CTTCCGAAGTTGAAGGAGGAAGG - Intergenic
952070252 3:29625773-29625795 CTGTCAAAGCTGATGGATGGTGG - Intronic
952960193 3:38584192-38584214 CAGGCAATGCTGAAGAGGGAAGG - Intronic
953041453 3:39258163-39258185 CTGGCACAGCTGCAGGAAGATGG + Intergenic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954462179 3:50633636-50633658 ATGGCAAGGCTGGAGGAGGAAGG - Intronic
955799186 3:62668528-62668550 GCTGCAAAGCTGAAGGATGAAGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956181107 3:66518934-66518956 ATGGCAAAGCTGAAAGAGCTTGG - Intergenic
958064725 3:88528778-88528800 CTAGCAAAGCAGTAGGGGGAGGG + Intergenic
958616054 3:96494430-96494452 GAGGCAGGGCTGAAGGAGGAGGG - Intergenic
959421693 3:106136206-106136228 CTGGCACATGTGAACGAGGACGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
961061392 3:123831965-123831987 CTGGCAGGGGTGAGGGAGGAAGG + Intronic
961115463 3:124325417-124325439 TTGGCAGGGCTGAAGGAGGTAGG + Intronic
961479166 3:127168453-127168475 CTGCCAGAGCTGAGGGAGGGAGG + Intergenic
962467473 3:135673833-135673855 CTGACATAGCGGAAGGTGGAAGG + Intergenic
963800350 3:149669958-149669980 CTGTCAATAGTGAAGGAGGAGGG + Intronic
964555717 3:157936020-157936042 CTGCCAGAGGTGAAGGAGGAGGG + Intergenic
966164236 3:176999074-176999096 CTGGCACAGCAGAGAGAGGAGGG + Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967327673 3:188258428-188258450 CTCACAAGGCTGAAGTAGGAGGG - Intronic
967600257 3:191378474-191378496 ATGGCAAAAGTGAAGGAGGTAGG + Intronic
968518583 4:1025010-1025032 CTGGCAAAGCCACAGGAGCAGGG - Exonic
969321703 4:6416780-6416802 CTGGCAGGGCTGGAGGAGGAGGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971154438 4:24066162-24066184 CTGGCAGAGCCGAACGAGGGAGG + Intergenic
972496018 4:39635529-39635551 CTGGCAAAGCTGATGGCAGTAGG + Intronic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
973790616 4:54374708-54374730 CTGGCAAACATGAAGGTGAATGG + Intergenic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
975758239 4:77592660-77592682 CTGGCAAGGCTGAAGGACTGAGG + Intronic
976556117 4:86453173-86453195 CTGGGAAAGCTGCAGGGAGAAGG + Intronic
976813035 4:89117653-89117675 CTAGCCAAGCAGAAGGAGTAGGG + Intergenic
976823176 4:89230374-89230396 CTGACACAGGTGAAGAAGGAAGG - Intergenic
977264149 4:94834423-94834445 TATGCAAAGCTGGAGGAGGAGGG - Intronic
977889231 4:102288797-102288819 GTGACAAAGCTGAAGAAGAAAGG + Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982312728 4:154002729-154002751 CTGGCAAAGGTGAGGAAGCAGGG - Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
984236539 4:177165544-177165566 CTGGGGAAGCTGCAGGAGTATGG + Intergenic
984582071 4:181521682-181521704 ATGGCAGTGCTGAGGGAGGAAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
986555780 5:9008693-9008715 CTGCTAAGGGTGAAGGAGGAGGG + Intergenic
986679437 5:10220169-10220191 TTGGCAAAGGTGATGGATGAAGG - Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988692900 5:33590527-33590549 CTCATAAGGCTGAAGGAGGAAGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990232870 5:53734048-53734070 CTGGAACTGCTGAGGGAGGATGG - Intergenic
990944787 5:61238556-61238578 ATGGCAAAGCAGAAGCAGCATGG - Intergenic
991141622 5:63250755-63250777 CTAGCAGAGTTGAAGGAGCATGG - Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
992229844 5:74653392-74653414 CTGGCCAAGATGAAGTAGCAGGG + Intronic
992268925 5:75046234-75046256 CTGGAAAGGCTAAAGGAAGAAGG + Intergenic
992662455 5:78975016-78975038 CTGGCAAAGGCACAGGAGGAGGG - Intronic
996336029 5:122385067-122385089 CTGGCAAAGCTGAAAGCCGAAGG - Intronic
996929426 5:128868554-128868576 ATGGCTAAGGTGAAGGATGAAGG + Intronic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
997635954 5:135405916-135405938 CTGGCAAAGCTGTAGGAAACAGG + Intergenic
997847749 5:137303678-137303700 CAGGCAAGGCTTCAGGAGGAGGG + Intronic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
1002169391 5:177366877-177366899 CTGAGCTAGCTGAAGGAGGAGGG - Exonic
1002294592 5:178223319-178223341 CAGGCAAATCTGCAGGAGGCAGG - Intronic
1003463545 6:6354448-6354470 CTTGCAAAGCTGAATGTGAATGG - Intergenic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003966524 6:11257279-11257301 CTGTCAAAACTGAAGGTGGTGGG - Intronic
1004878395 6:19979470-19979492 CTGTCAAAGGTGAAGTAGAAAGG - Intergenic
1004904355 6:20222616-20222638 CTTGCAAAGCTGAGGCTGGAGGG + Intergenic
1005359077 6:25013525-25013547 CTGGCAGAGCTGATGAAGGTGGG - Intronic
1005385554 6:25280664-25280686 ATGGCAGAGCTGAAATAGGATGG + Intronic
1005845017 6:29770264-29770286 ATTACAAAGCTGAAGGAGGCGGG + Intergenic
1005900173 6:30210487-30210509 TATGCAAAGCTGCAGGAGGAGGG - Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1010758686 6:79697504-79697526 CTGGCATACCTGTAGGAAGAAGG + Intronic
1011839064 6:91473692-91473714 CTGGAAAAGCTGCAACAGGATGG - Intergenic
1012720901 6:102743146-102743168 GTTGCAAAACTGAAGGTGGATGG + Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1017627084 6:156359629-156359651 CTGGCAAAGAGGAGGGAAGATGG - Intergenic
1017722416 6:157253194-157253216 CTGGCATAGGTGCAGGAGGATGG - Intergenic
1017891692 6:158644572-158644594 CTGGCCTAGCTGAAGGAGGTGGG + Intronic
1018181713 6:161228813-161228835 CTTGGCATGCTGAAGGAGGAAGG - Intronic
1018202352 6:161407309-161407331 TTGGCAAAGCTGAAAAGGGAGGG + Intronic
1018298136 6:162371364-162371386 CTCGCAAAGCTGCATGAGGGCGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018452299 6:163920257-163920279 ATGGCAAAACGGAAGGATGATGG - Intergenic
1018648360 6:165969292-165969314 CTGCCAAAGATAGAGGAGGAGGG + Intronic
1018682702 6:166277165-166277187 GTGGCCAAGCCGAAGGAGGCAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019672787 7:2291190-2291212 CTTCCAAAGCTGAGGCAGGAGGG + Intronic
1020152840 7:5696785-5696807 CTGGGAGGGCTGTAGGAGGACGG + Intronic
1020210016 7:6152129-6152151 CTCGCAAAGCAGCAGCAGGACGG + Intronic
1020281204 7:6650981-6651003 CTCGCAAGGCTGAAGGGAGAGGG + Intronic
1020378551 7:7515582-7515604 TTTGCAAAGCTGAAGGAGGCTGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023466180 7:40457638-40457660 CTGGCATAGCTGAAGATGGAAGG + Intronic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024212609 7:47218638-47218660 CTGGCAACACCCAAGGAGGAAGG - Intergenic
1024445998 7:49479585-49479607 CTGGCAAGTATGAAGGAGCAAGG - Intergenic
1024500393 7:50099550-50099572 CTGGCCAGGCTGAAGGGTGAAGG - Intronic
1024560494 7:50640895-50640917 CCGGCAAAGCTGAGGATGGAAGG - Intronic
1025977508 7:66380442-66380464 CTCGGGAAGCTGAAGTAGGAGGG + Intronic
1026085698 7:67261268-67261290 CTGGCATATAGGAAGGAGGAAGG - Intergenic
1026618914 7:71933167-71933189 CTGGCAAAGAGGAGGGAAGATGG - Intronic
1028521640 7:91738194-91738216 CTGACAAAGATTGAGGAGGAGGG - Intronic
1031791720 7:126114876-126114898 CTGTCAATGCTGAGGGAGAAAGG - Intergenic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032197600 7:129798564-129798586 GGGGCAAAGCTGAGGTAGGAAGG - Intergenic
1033052061 7:138014611-138014633 CTTGGGAAGCTGAAGCAGGAGGG - Intronic
1033229406 7:139584542-139584564 CTGGCAAAGCTTATGCAGGAGGG + Intronic
1033471999 7:141658663-141658685 CTTGCAGAGGTAAAGGAGGAGGG - Exonic
1033772088 7:144564011-144564033 CTGGCACTGCTGAGGGAAGAAGG + Intronic
1035285907 7:157807130-157807152 CTGGCAAAGCTGTAGGTGAACGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035473817 7:159128508-159128530 CTGCCAAAGCTGCTGGAGGGAGG - Intronic
1035583374 8:754050-754072 CTGGCAGATCTGAGTGAGGATGG + Intergenic
1035828522 8:2669642-2669664 CTGACAAAGCTGAAGCTGAAAGG + Intergenic
1037636105 8:20702103-20702125 CTGGGAAAGCTGGGGAAGGAGGG + Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037819412 8:22128563-22128585 CTGCCTAAGCTGAAGGCAGAGGG + Exonic
1038041019 8:23724306-23724328 TTTGCAAGGCTGAAGCAGGAGGG - Intergenic
1039707638 8:40023525-40023547 CTGGCAAAGATGAGGTAGGCAGG + Intergenic
1040937146 8:52793265-52793287 GTGTCAACTCTGAAGGAGGATGG + Intergenic
1041451121 8:58007647-58007669 CTCACACAGCTGAAGGAGGAGGG - Intronic
1043769772 8:84183699-84183721 TTGGGAAAGCTGGAGGAGCATGG + Intronic
1044634000 8:94304184-94304206 CTAGGAAAGATTAAGGAGGAGGG + Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1047446812 8:124927340-124927362 CTGACACCGCTGAAGGAGGACGG - Intergenic
1047803325 8:128332513-128332535 CTGACAAAACTGAAGGATGTAGG - Intergenic
1048030155 8:130623507-130623529 TTGGCAAGCCTGAATGAGGAAGG - Intergenic
1048378137 8:133840425-133840447 GAGTCAAATCTGAAGGAGGAAGG - Intergenic
1049084871 8:140470799-140470821 ATGGCAAAGCTGGAGCAGGGTGG - Intergenic
1049791325 8:144473994-144474016 GCGGCAAAGCTGCAGGAGCAGGG - Exonic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1051613612 9:18985591-18985613 CTGGCAAAGCTGCCCAAGGATGG + Intronic
1051844143 9:21432751-21432773 CTGGCAAAGAAGAAGAATGAAGG - Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053158167 9:35794113-35794135 GAGCCAAATCTGAAGGAGGAGGG + Intronic
1053379922 9:37640290-37640312 CTGGTAGGGCTGAAGCAGGAGGG + Intronic
1055022757 9:71687756-71687778 CTTGGAAGGCTGAAGTAGGAGGG + Intronic
1055320374 9:75078072-75078094 CTGGGAAAGATGAAGGAGAAAGG + Intronic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1058487603 9:105458034-105458056 CTGGCCAAGCTGCAGGTGGCAGG - Intronic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059166298 9:112079355-112079377 TTGGCAAAACTGCAGGAGCAAGG + Intronic
1060266319 9:122113514-122113536 CTGTCCATGCTGAAGGAGTAGGG + Intergenic
1060776284 9:126377031-126377053 CTGGCACTGCAGAAGGCGGAGGG - Intronic
1061579213 9:131526634-131526656 CAGACAAAGCTGAGGGAAGAGGG + Intronic
1061598281 9:131646936-131646958 CTGGAAGAGCTGAAGGGGAAAGG + Intronic
1061971515 9:134047902-134047924 CTGGCAAGGCTCAGCGAGGAAGG - Intronic
1062107992 9:134766158-134766180 CTGGGAAGGCTGAAGGGGGCAGG - Intronic
1062166061 9:135107880-135107902 GTGGCAATGGTGAAGGAGGGAGG - Intronic
1062628961 9:137455143-137455165 CTGGCAGACCTGATGGGGGAAGG - Intronic
1185660585 X:1725705-1725727 CTGGCTTTGCTGATGGAGGAAGG + Intergenic
1186114104 X:6287199-6287221 ATGGCAATGCTGGAGGGGGAGGG - Intergenic
1187217185 X:17288558-17288580 CTGGCCAATCTGAAGGAAGGTGG + Intergenic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1189415046 X:40805724-40805746 ATGGCAAAGCTGAAAGAGCTTGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1191642439 X:63441900-63441922 CTGGCATATGTGAATGAGGAAGG + Intergenic
1192589723 X:72349941-72349963 ATGGCAGAGTTGAAGGAAGAAGG + Intronic
1195418548 X:104647203-104647225 CTGGGACAGCTGGAGGAGGCAGG + Intronic
1195742050 X:108074768-108074790 ATGGGAAAGCTGAAGCATGACGG + Intronic
1196911854 X:120491874-120491896 CAGGCAAGGGTTAAGGAGGAAGG + Intergenic
1198730476 X:139722550-139722572 CTGGCAGTTCTGAAAGAGGAAGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202381271 Y:24277840-24277862 CTGGCACAGCTGCAGGGGTAGGG + Intergenic
1202489514 Y:25392286-25392308 CTGGCACAGCTGCAGGGGTAGGG - Intergenic