ID: 1073460119

View in Genome Browser
Species Human (GRCh38)
Location 10:103661314-103661336
Sequence CCGCGGGGTCCGGGGGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073460106_1073460119 -5 Left 1073460106 10:103661296-103661318 CCAGACCGGCCCGCTGCACCGCG 0: 1
1: 0
2: 0
3: 14
4: 102
Right 1073460119 10:103661314-103661336 CCGCGGGGTCCGGGGGACATGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1073460102_1073460119 10 Left 1073460102 10:103661281-103661303 CCATATAGCAAGGCCCCAGACCG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1073460119 10:103661314-103661336 CCGCGGGGTCCGGGGGACATGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1073460104_1073460119 -3 Left 1073460104 10:103661294-103661316 CCCCAGACCGGCCCGCTGCACCG 0: 1
1: 0
2: 0
3: 12
4: 446
Right 1073460119 10:103661314-103661336 CCGCGGGGTCCGGGGGACATGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1073460105_1073460119 -4 Left 1073460105 10:103661295-103661317 CCCAGACCGGCCCGCTGCACCGC 0: 1
1: 0
2: 0
3: 11
4: 310
Right 1073460119 10:103661314-103661336 CCGCGGGGTCCGGGGGACATGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1073460110_1073460119 -10 Left 1073460110 10:103661301-103661323 CCGGCCCGCTGCACCGCGGGGTC 0: 1
1: 0
2: 2
3: 14
4: 125
Right 1073460119 10:103661314-103661336 CCGCGGGGTCCGGGGGACATGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1073460100_1073460119 21 Left 1073460100 10:103661270-103661292 CCAAGGACAGGCCATATAGCAAG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1073460119 10:103661314-103661336 CCGCGGGGTCCGGGGGACATGGG 0: 1
1: 0
2: 1
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073460119 Original CRISPR CCGCGGGGTCCGGGGGACAT GGG Intronic
900559057 1:3294661-3294683 CCGCGAGGCCTGGGGGACAGAGG - Intronic
903132860 1:21290562-21290584 CCGAGAGGCCCGGGGGAGATGGG + Intronic
905179096 1:36155833-36155855 CCGCGGGGACTGGGGGAGAGGGG - Intronic
905463526 1:38136501-38136523 CCCCGGGGACCTGGGGACATGGG - Intergenic
907880714 1:58546844-58546866 CCGCGGGGCCCGGGGCAGCTGGG - Intergenic
914195454 1:145446021-145446043 CCCAGGGGGACGGGGGACATGGG - Intergenic
914474441 1:148011722-148011744 CCGCGGGGTCCGTGGGCCCATGG + Intergenic
1064380703 10:14838796-14838818 CCGGGGGGTCCCGGGGACGGCGG + Intronic
1067778005 10:49176958-49176980 CCATGGGGTCAGGGGGACTTCGG - Intronic
1073208420 10:101780703-101780725 CCGTGGGGTCTGGGGGTCTTTGG - Intergenic
1073460119 10:103661314-103661336 CCGCGGGGTCCGGGGGACATGGG + Intronic
1076790946 10:132776409-132776431 GGGCAGGGTCCGGGGGGCATGGG + Intronic
1076873392 10:133204429-133204451 CAGCGGGGTCCGGAGGGCTTGGG + Intronic
1080012431 11:27472360-27472382 CCGGGGGCGGCGGGGGACATCGG - Exonic
1081862201 11:46339626-46339648 GTGCGGGGACTGGGGGACATGGG - Intronic
1083340558 11:61956035-61956057 CCCCCGAGTCCGGGGGACTTTGG - Intronic
1083655281 11:64226371-64226393 CCCCTGGGTTTGGGGGACATGGG + Exonic
1083888818 11:65585628-65585650 GCGCGGGGTCCCGGGAAGATGGG + Intronic
1083997182 11:66278337-66278359 CCGTGGGGCTCGGGGGACGTGGG - Exonic
1084265599 11:68003843-68003865 CGGCGGGCACCGGGGGACACGGG - Intronic
1094839793 12:34338079-34338101 TCGCGGGGTCCGGGGGACACTGG + Intergenic
1094840288 12:34339934-34339956 GCGCGGGGTCCTGGGGACCCTGG + Intergenic
1094841758 12:34345276-34345298 ACGCGGGATCCCGGGGACTTTGG - Intergenic
1094842168 12:34346717-34346739 GCGCGGGGTCCCTGGGACACAGG - Intergenic
1094842731 12:34348789-34348811 GCGCGGGGTCCCGGGGACCTAGG - Intergenic
1094842936 12:34349550-34349572 GCGCAGGGTCCTGGGGACACTGG - Intergenic
1094844274 12:34354598-34354620 GCGCGGGGTCCAGGGTACACTGG - Intergenic
1094854883 12:34398501-34398523 GCACGGGGCCCAGGGGACATTGG + Intergenic
1098819146 12:75207757-75207779 CCGCCTGGCCCGGGGGACAGCGG + Exonic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103727076 12:123003308-123003330 CAGCGGTGTCCTGGGGAAATGGG - Intronic
1104033972 12:125085681-125085703 CAGCTGGGTGAGGGGGACATGGG + Intronic
1104660967 12:130611257-130611279 CTGTGGGGTCTGGGGGACGTGGG - Intronic
1113905279 13:113816615-113816637 CCGCGGGGTCTGGTGGCCACGGG - Exonic
1122296722 14:100709940-100709962 CCCCTGGGTGGGGGGGACATGGG + Intergenic
1123918267 15:25053025-25053047 CCGCCTGGTCCTTGGGACATCGG + Intergenic
1129322376 15:74782312-74782334 CCGCGGGCTCCGGCGGCCAGAGG - Exonic
1132699064 16:1214581-1214603 CCTCGGGGACATGGGGACATGGG - Intronic
1133173653 16:3997754-3997776 CTGCTGGGTCCGGGTGACACAGG - Intronic
1135946156 16:26866815-26866837 TTGGGGGGTCCGGGGGGCATCGG - Intergenic
1138105685 16:54286114-54286136 CCGCGGGCTCCGGCGCGCATCGG + Exonic
1142875127 17:2847744-2847766 AGGCGGGGGCCGGGGGACCTTGG + Intronic
1144004604 17:11088767-11088789 CCGAGGGGGCCGGGGGGCAGCGG - Intergenic
1145059305 17:19722529-19722551 GCGGGGGGTGCGGGGCACATAGG + Intergenic
1147135180 17:38429989-38430011 CCGCTGGGGCCGGGGGCCTTTGG - Intronic
1147759303 17:42787434-42787456 CTGGGGGGACCGGGGGCCATGGG - Exonic
1147954238 17:44123456-44123478 TCCCGGGGTCCGGGGAAGATGGG + Intronic
1148177975 17:45584463-45584485 CGGCGGGGTTGGGGGGAGATCGG + Intergenic
1150388996 17:64780311-64780333 CTGCGGGGTCCGGGGGGAAGGGG - Intergenic
1151414569 17:73952888-73952910 CCGCGGCGTCCGGGGAGCTTTGG - Intergenic
1152229176 17:79106126-79106148 CCTGGGGGCCCGGGGGACACAGG + Intronic
1152812896 17:82390706-82390728 CCCCTGGGTACGGGGGACTTGGG - Intronic
1160061218 18:75530789-75530811 CCCCTGGGTCCGGGGCATATGGG - Intergenic
1160659172 19:290598-290620 CCGCAGGGTCCCGGGAACAAAGG - Intronic
1160813902 19:1026740-1026762 CCGCGCTGTCGGGGGGACAAGGG - Intronic
1160814726 19:1029634-1029656 CCGCGGGAACCTGGGGAGATGGG + Intronic
1161471272 19:4457725-4457747 CCGCGGGGGCGGGGGGGCACGGG + Exonic
1161473560 19:4472891-4472913 CCCCGGGGTCTGGGGGCCCTGGG + Intronic
1162772391 19:12957066-12957088 CCGCGGGGTCAGGAGGTCCTCGG + Exonic
1163427090 19:17245733-17245755 CCGCGGGCGCCGGGGGACCCAGG - Exonic
1165879542 19:39032405-39032427 CCGCGGGGTCTCCGGGATATCGG - Intronic
1166107592 19:40605090-40605112 CAGCGAAGTCCGGGGGACAGAGG - Exonic
926285294 2:11482934-11482956 CCGCGGCGGCCGGAGGACAAAGG + Intergenic
931321484 2:61177701-61177723 CCGCGGGGCCAGGGGGTCAGGGG + Exonic
945057355 2:205880591-205880613 CCGCTGGGTGCTGGGGACATAGG + Intergenic
946241257 2:218357358-218357380 CCCCGGGGACATGGGGACATGGG + Intronic
1173188704 20:40860301-40860323 CTGCGGGGTGCGGGGGGCATGGG + Intergenic
1176062609 20:63178912-63178934 CGGCGGGGCCCGGGAGACAAAGG + Intergenic
1176101754 20:63367649-63367671 CCCCGGGGGCCGTGGGCCATCGG + Intronic
1179853574 21:44150903-44150925 CAGCGGGGTCCCGGAGAGATGGG - Intergenic
1184278988 22:43426548-43426570 CCGAGTGGTCCGAGGGACAGCGG - Intronic
1184955618 22:47884074-47884096 CCCCAGGGTCAGGGGGACTTTGG + Intergenic
949876535 3:8629596-8629618 CCGGGGGATCCTGGGGACAGCGG - Intronic
954449990 3:50566684-50566706 CCGCAGGCTCTCGGGGACATTGG + Intronic
954616594 3:51971811-51971833 CCTTGGGGTCAGGAGGACATAGG + Intronic
954663770 3:52239549-52239571 CCGTGGGGTCCTGGGCACCTCGG + Intergenic
969714331 4:8861086-8861108 CCGCGGGGTCCCGGACACAGCGG + Intronic
980956705 4:139436233-139436255 CCCCGTGGTCCTGGCGACATCGG + Intergenic
982257602 4:153466146-153466168 CGGCGGGGTGCGGGGGAAAGTGG - Intergenic
985549204 5:524607-524629 CCGCGGGCTCCGGGGGAGGGTGG - Intergenic
985745510 5:1644670-1644692 CTGCGGGGTGCGGGGGAGCTCGG - Intergenic
985745522 5:1644735-1644757 CTGCGGGGTGCGGGGGAGCTCGG - Intergenic
985745534 5:1644800-1644822 CTGCGGGGTGCGGGGGAGCTCGG - Intergenic
985745547 5:1644865-1644887 CTGCGGGGTGCGGGGGAGCTCGG - Intergenic
985782451 5:1878316-1878338 CCGCAGGGGCCGCGGGACCTTGG + Exonic
994631699 5:102295804-102295826 GCGCGGGGTCCGTGGGACGGTGG - Intronic
1000161471 5:158601692-158601714 CCAACAGGTCCGGGGGACATCGG - Intergenic
1001221359 5:169903519-169903541 CAGCGGGGGCCGGGGGGCAGGGG + Intronic
1003482376 6:6545873-6545895 TCGCGGGCTCCTGGGGAGATGGG - Intergenic
1003503622 6:6722815-6722837 CCGTGGGGTCCTGGGGAAAATGG - Intergenic
1005048999 6:21666497-21666519 CCCCGGCGTCCGGGGGAGAGGGG - Intergenic
1019136036 6:169908139-169908161 CCCTGGGGACCGGGGCACATTGG + Intergenic
1022396148 7:29989524-29989546 CCGCGGGTTCGGAGGGACAGCGG + Intronic
1027278986 7:76591741-76591763 CAGCGGGGACCAGGGGACCTGGG - Intergenic
1028913018 7:96228980-96229002 CCACGGGGTTGGGGGGACTTGGG - Intronic
1029524729 7:101087813-101087835 CCCCGGGGTGCTGGGGACACTGG - Exonic
1031980696 7:128122498-128122520 CCGGGGGGTGGGGGGGGCATTGG - Intergenic
1036780520 8:11643816-11643838 CCCAGGGCTCCGGGGAACATGGG + Intergenic
1039921530 8:41897024-41897046 CAGCGGGGTCCGGGGTAGAGCGG - Intergenic
1053287428 9:36859109-36859131 CCTCGGGGTGCAGGGGAAATCGG - Intronic
1062699210 9:137890329-137890351 CCCAGGGGGACGGGGGACATGGG + Intronic
1189322277 X:40094347-40094369 CCGTGCGGGCCGGGGGACCTGGG - Intronic
1192677523 X:73214274-73214296 CTGCTGGGTCCGGGGAAGATGGG - Exonic