ID: 1073460268 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:103661871-103661893 |
| Sequence | AAAGTCCCCGCGCCAGCGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073460264_1073460268 | 6 | Left | 1073460264 | 10:103661842-103661864 | CCTAGACTGTTTACTTGAAACCC | No data | ||
| Right | 1073460268 | 10:103661871-103661893 | AAAGTCCCCGCGCCAGCGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073460268 | Original CRISPR | AAAGTCCCCGCGCCAGCGGC TGG | Intronic | ||