ID: 1073460268

View in Genome Browser
Species Human (GRCh38)
Location 10:103661871-103661893
Sequence AAAGTCCCCGCGCCAGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073460264_1073460268 6 Left 1073460264 10:103661842-103661864 CCTAGACTGTTTACTTGAAACCC No data
Right 1073460268 10:103661871-103661893 AAAGTCCCCGCGCCAGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073460268 Original CRISPR AAAGTCCCCGCGCCAGCGGC TGG Intronic