ID: 1073462334

View in Genome Browser
Species Human (GRCh38)
Location 10:103673108-103673130
Sequence AAGGACTTCATAGGAACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073462329_1073462334 -2 Left 1073462329 10:103673087-103673109 CCATCCAGCACACATACATCCAA 0: 1
1: 0
2: 0
3: 24
4: 330
Right 1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG No data
1073462324_1073462334 21 Left 1073462324 10:103673064-103673086 CCTGACTTTAAGGACAACCCACC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG No data
1073462325_1073462334 4 Left 1073462325 10:103673081-103673103 CCCACCCCATCCAGCACACATAC 0: 1
1: 0
2: 4
3: 45
4: 445
Right 1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG No data
1073462327_1073462334 0 Left 1073462327 10:103673085-103673107 CCCCATCCAGCACACATACATCC 0: 1
1: 0
2: 0
3: 34
4: 407
Right 1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG No data
1073462326_1073462334 3 Left 1073462326 10:103673082-103673104 CCACCCCATCCAGCACACATACA 0: 1
1: 0
2: 2
3: 83
4: 741
Right 1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG No data
1073462328_1073462334 -1 Left 1073462328 10:103673086-103673108 CCCATCCAGCACACATACATCCA 0: 1
1: 0
2: 2
3: 76
4: 401
Right 1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG No data
1073462322_1073462334 23 Left 1073462322 10:103673062-103673084 CCCCTGACTTTAAGGACAACCCA 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG No data
1073462331_1073462334 -6 Left 1073462331 10:103673091-103673113 CCAGCACACATACATCCAAGGAC 0: 1
1: 0
2: 0
3: 20
4: 206
Right 1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG No data
1073462323_1073462334 22 Left 1073462323 10:103673063-103673085 CCCTGACTTTAAGGACAACCCAC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073462334 Original CRISPR AAGGACTTCATAGGAACAAC TGG Intronic
No off target data available for this crispr