ID: 1073462903

View in Genome Browser
Species Human (GRCh38)
Location 10:103676779-103676801
Sequence CTCTGCACACAAATGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073462903_1073462906 11 Left 1073462903 10:103676779-103676801 CCCCAGGGCATTTGTGTGCAGAG 0: 1
1: 0
2: 3
3: 23
4: 241
Right 1073462906 10:103676813-103676835 TCAAGTTTGTTCTGAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073462903 Original CRISPR CTCTGCACACAAATGCCCTG GGG (reversed) Intronic
900077953 1:833371-833393 CACTCCACTCAAATGCCCTCAGG + Intergenic
900804967 1:4761529-4761551 CTCTGCACAGAAATGGCCGATGG - Intronic
900922247 1:5680513-5680535 TTCTTAACACACATGCCCTGTGG + Intergenic
902261186 1:15226098-15226120 CTCTGCACCCAGATGCCCATGGG - Intergenic
903095353 1:20967198-20967220 TTTTGCACTTAAATGCCCTGTGG - Intronic
903152704 1:21423475-21423497 CTCTGCCCACAGATGGGCTGAGG + Intergenic
903160425 1:21484510-21484532 CTCTGCCCACAGATGGGCTGAGG - Exonic
903412922 1:23161427-23161449 CCATGCATACAAAGGCCCTGAGG + Intronic
904093972 1:27963469-27963491 CACCACACACAAATGCCCAGAGG - Intronic
905243705 1:36597642-36597664 CTCTGCACAGGGAAGCCCTGGGG - Intergenic
905900057 1:41575426-41575448 CTCTGCCCACAGGTGCCCTGTGG - Intronic
906129776 1:43449176-43449198 GTGTGCACACAAATCACCTGGGG - Intronic
907078706 1:51601837-51601859 TTCTGCACAAAATTGCCCTGAGG - Intronic
909522626 1:76587381-76587403 CTCTGGACACACAGGCGCTGAGG - Intronic
909698746 1:78496137-78496159 GTCTGGACACAAGTGCCTTGGGG + Intronic
917199188 1:172497509-172497531 CTCCACCCACACATGCCCTGGGG + Intergenic
917586791 1:176435033-176435055 TTGTGCACACAAATGACCTCTGG + Intergenic
917699796 1:177568698-177568720 CTCTGCACACATACACCCTTGGG + Intergenic
918244553 1:182647329-182647351 CTAAGGAAACAAATGCCCTGTGG + Intronic
918937182 1:190936522-190936544 TTGTGTGCACAAATGCCCTGAGG + Intergenic
920371907 1:205484473-205484495 CGCTGTCCTCAAATGCCCTGGGG + Intergenic
920450932 1:206060645-206060667 CCCTCCACAAAAGTGCCCTGGGG - Intronic
920559323 1:206927973-206927995 CTCCACACACAGAAGCCCTGTGG + Intergenic
921906280 1:220498447-220498469 CCTTGCACACTAATACCCTGTGG + Intergenic
921959795 1:221022608-221022630 CTCTTCACACAGATGCCCTGAGG + Intergenic
922171777 1:223161671-223161693 CTCTGCTCACTCATTCCCTGAGG - Intergenic
923228451 1:231961236-231961258 ATCTGAACACACAGGCCCTGTGG - Intronic
923925503 1:238622368-238622390 CTGTGCACACAGAAGCCTTGTGG - Intergenic
1063980579 10:11448583-11448605 CTGTGCACACAAAGCACCTGGGG - Intergenic
1064455441 10:15483494-15483516 CTTTGCAAGCACATGCCCTGCGG + Intergenic
1065822760 10:29541011-29541033 CTCTCCAAAACAATGCCCTGTGG - Intronic
1067535571 10:47107429-47107451 CAGTGCTCACAAATCCCCTGGGG + Intergenic
1072481959 10:95817608-95817630 CTGTACACAGAAAGGCCCTGAGG - Intronic
1072568611 10:96639419-96639441 CACTGCACACACATCCCCTTGGG - Intronic
1072623418 10:97095873-97095895 ATGTGCACACAAATCCCCTGGGG + Intronic
1072706752 10:97686722-97686744 CTCTGCACTCCACTGCCCGGTGG + Intronic
1073462903 10:103676779-103676801 CTCTGCACACAAATGCCCTGGGG - Intronic
1075850262 10:125581013-125581035 CTCTGAGCACAAATGTCCTTGGG - Intronic
1076006350 10:126950714-126950736 TTCTGCACACAAAGACTCTGAGG - Intronic
1076829098 10:132985406-132985428 CTCTGGTCACAACAGCCCTGTGG - Intergenic
1077718125 11:4601272-4601294 CTCTGCACACAAACAGCTTGAGG - Intronic
1078444939 11:11397017-11397039 GTCTGCACACATTTGCCATGGGG - Intronic
1079385545 11:19976182-19976204 GTGTGCACACAAATCACCTGGGG + Intronic
1079656695 11:22994168-22994190 CTCTGAAGTCAAAAGCCCTGTGG - Intergenic
1080304180 11:30818900-30818922 CTAAGCACACAGATGCCCAGAGG + Intergenic
1080308218 11:30859832-30859854 ATCAGCACTCAAATGGCCTGAGG + Intronic
1083751072 11:64760862-64760884 CTATGCACACAAATGGGGTGAGG - Intergenic
1085874497 11:80389509-80389531 CTCTGCGCACACATGCTGTGAGG - Intergenic
1086160223 11:83713738-83713760 CTCTTCACACTACTGCACTGTGG + Intronic
1086881045 11:92153671-92153693 CTCTGGAATCAAAAGCCCTGGGG - Intergenic
1087419667 11:97905799-97905821 CTGTTCACACATATGCTCTGTGG - Intergenic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1089417658 11:118305963-118305985 ATGTGCACACAAATCACCTGGGG + Intronic
1093676476 12:21946166-21946188 CTCTGCACACACATGCACCTCGG + Intergenic
1094061458 12:26318854-26318876 TTCTGCACACAGCTGCCCTGGGG + Intergenic
1097235648 12:57537674-57537696 CTCTGCCCAGTAATTCCCTGAGG - Intronic
1098142278 12:67462345-67462367 CTCTGCAGAAAAATCCCCTTTGG - Intergenic
1099928288 12:89044127-89044149 CTCTGCCCTCAAGTGGCCTGTGG - Intergenic
1103287705 12:119816535-119816557 ATATGCACAGAAATCCCCTGGGG + Intronic
1103528054 12:121580494-121580516 CTCTGCACACAACTCCCGGGCGG - Intronic
1103809628 12:123602994-123603016 CAGTGCACATAAATGCCCTGCGG + Intronic
1104235549 12:126932197-126932219 CTTTGGACACAAATGCTCTCAGG - Intergenic
1104586373 12:130051164-130051186 CTCTGCACACACATGGCCGTGGG - Intergenic
1104644723 12:130488787-130488809 CTCTGCAGACCAAAGCCCAGGGG - Intronic
1104980355 12:132570713-132570735 CCCCGCACACAGATGGCCTGTGG - Intronic
1114840389 14:26256238-26256260 CTGTATACACAAATGCCTTGAGG - Intergenic
1119632776 14:76248514-76248536 CTCTCCTCCCAAATGCCCTGGGG + Intronic
1119652138 14:76391526-76391548 GTCTGTAGACAAATGCCCTTTGG + Intronic
1120755892 14:88243934-88243956 CAATGCACCCAAATGCCCTGGGG + Intronic
1121237278 14:92401487-92401509 CTTTGCACACACATGCACTCTGG - Intronic
1121579161 14:95013780-95013802 CTCTCCACCCAATTTCCCTGGGG - Intergenic
1123025671 14:105422517-105422539 CTCTACACACAAGGTCCCTGGGG - Intronic
1124360854 15:29035735-29035757 CACTGCTCACACATGCCCAGGGG - Intronic
1127649181 15:60989822-60989844 CTCTCCACTCAAACACCCTGAGG + Intronic
1127874914 15:63103733-63103755 CCCTTCACAGTAATGCCCTGCGG + Intergenic
1128615240 15:69103804-69103826 GTGTGCACACAAATCACCTGGGG + Intergenic
1131306527 15:91248791-91248813 CTGTGCACATAAATCACCTGGGG - Intronic
1131381310 15:91966078-91966100 CGCTGGGCACAAATGCCCTGCGG - Intronic
1131915254 15:97258087-97258109 CTCTGGACACAAAATCTCTGTGG - Intergenic
1135466564 16:22691384-22691406 ATGTGCACACAAATCACCTGGGG - Intergenic
1136522294 16:30804920-30804942 CCCTTCACAGAATTGCCCTGAGG + Intergenic
1136683455 16:31981140-31981162 CCCTCCACACAAATGTCCCGTGG + Intergenic
1136784087 16:32924696-32924718 CCCTCCACACAAATGTCCCGTGG + Intergenic
1136885695 16:33929110-33929132 CCCTCCACACAAATGTCCCGTGG - Intergenic
1137353189 16:47732572-47732594 ATGTGCAGACAAATGACCTGGGG + Intergenic
1137410291 16:48222528-48222550 CTCCGGACATAACTGCCCTGGGG - Intronic
1139366377 16:66436093-66436115 CTCTGCTCACCAATGCCCACAGG + Intronic
1141393229 16:83681751-83681773 CTCTGCACACACAGGCCCCAAGG - Intronic
1141614416 16:85202434-85202456 CTCTACAAAAAAATGTCCTGTGG - Intergenic
1141720306 16:85751863-85751885 CTCTGCAGACACCTGCCCAGTGG + Intergenic
1142398728 16:89848109-89848131 CTGTTCACACAAATTCCCAGAGG - Intronic
1203086742 16_KI270728v1_random:1188698-1188720 CCCTCCACACAAATGTCCCGTGG + Intergenic
1143790410 17:9290751-9290773 ACCTGTAGACAAATGCCCTGAGG + Intronic
1144393352 17:14817789-14817811 CTCTGTACACCAAAACCCTGTGG - Intergenic
1146527256 17:33577614-33577636 TGCTGCACCCAAATCCCCTGTGG - Intronic
1147144372 17:38476842-38476864 CCCTCCACACAAATGTCCCGTGG + Intronic
1149986759 17:61353322-61353344 CCGTGCACACAGATCCCCTGGGG + Intronic
1150383782 17:64741406-64741428 CTATTCACACACATGCTCTGAGG - Intergenic
1152888869 17:82868395-82868417 CGCTGCACACAGAGGCCCGGGGG - Intronic
1155261353 18:24045343-24045365 CTGTGCACACAAATCCCCCCTGG - Intronic
1156864125 18:41869529-41869551 TTCTGCACACAAAGACTCTGGGG + Intergenic
1157207872 18:45715739-45715761 CTTTCCAAACAAATCCCCTGGGG + Intergenic
1157522621 18:48355859-48355881 ATCAGAGCACAAATGCCCTGAGG + Intronic
1159878214 18:73833527-73833549 AAGTGCACACAAATGCCATGAGG - Intergenic
1160068198 18:75598021-75598043 CTCTGTAGACAAGTGCCCTGGGG - Intergenic
1161346492 19:3771027-3771049 CTCTGCACACCCCAGCCCTGGGG + Intronic
1161582097 19:5086658-5086680 CTCTGCCCACAGAGGCCCTGGGG - Intronic
1164740824 19:30574358-30574380 CTCTGCAAAGAAAGGCCCAGAGG + Intronic
1167338083 19:48898787-48898809 TTCTGAACACGAATGCCGTGTGG + Intergenic
1168416230 19:56170594-56170616 CTCTGCACAGAAATGCTCCTGGG + Intergenic
1168488425 19:56785766-56785788 ATGTGCACACAAATCACCTGGGG + Intronic
1168544131 19:57236024-57236046 TTCTGCAGATAAATTCCCTGAGG + Intergenic
927513481 2:23658702-23658724 CTCTGCACTCAATTCCGCTGTGG - Intronic
927792498 2:26021135-26021157 CTGTGGACACCAGTGCCCTGAGG + Intergenic
929073098 2:38054088-38054110 CTCTGAACACTAATGGCCAGTGG + Intronic
929426951 2:41853556-41853578 CTCTGCACACAAGAGCCTGGAGG + Intergenic
934675574 2:96247373-96247395 CACTGAACACAAGTGCCTTGTGG - Intergenic
935280204 2:101510882-101510904 CTCTGAATACAAATGTGCTGTGG + Intergenic
936801428 2:116272240-116272262 TTATGCACACAAATACCTTGAGG - Intergenic
936844566 2:116815547-116815569 CTGTGCAAACAGATGCCCTATGG - Intergenic
937287279 2:120761530-120761552 CTCTGCACACACACCCCCTCTGG - Intronic
937609333 2:123840985-123841007 CTCTGCACAGGAATGCTGTGGGG - Intergenic
938127091 2:128682445-128682467 CTCTGCACAGCAAGACCCTGGGG - Intergenic
938655314 2:133425498-133425520 CACTGGAAACAGATGCCCTGTGG + Intronic
942447886 2:176090355-176090377 CTCTGCTTCCAAAAGCCCTGTGG - Intergenic
945253023 2:207780211-207780233 CACTACACACAATTGACCTGGGG - Intergenic
946009722 2:216554960-216554982 ATTTGCTCACAAAGGCCCTGGGG + Intronic
946994370 2:225374422-225374444 GTCAGCACACAAATGCACAGAGG - Intergenic
947000734 2:225453326-225453348 CTCTGCTCACAAATTGGCTGGGG + Intronic
947466824 2:230358332-230358354 CTCTAGACACCAATTCCCTGTGG - Intronic
1169289447 20:4336230-4336252 ACATGCACACAAATCCCCTGAGG + Intergenic
1169576885 20:6972774-6972796 CAGTGTACACAAATCCCCTGGGG - Intergenic
1169687265 20:8289297-8289319 ATGTGCACACAAGTCCCCTGTGG + Intronic
1169915850 20:10682345-10682367 ATGTGCACACAAATCACCTGAGG - Intergenic
1173853441 20:46233599-46233621 CTTTGCACCCTAATGCCATGTGG + Intronic
1173981517 20:47227696-47227718 CTCTGCCCAGAAATACCCTTTGG - Intronic
1174369267 20:50075577-50075599 AAATGCACACACATGCCCTGAGG + Intergenic
1174581621 20:51576256-51576278 CTGTGCACACACATGAGCTGAGG - Intergenic
1174668681 20:52285030-52285052 TTCTGCACACAAAAGCCCATTGG + Intergenic
1176049927 20:63113350-63113372 CTCTGCATGCAAATGGCCTTCGG + Intergenic
1179062958 21:37996509-37996531 CTATCCTCACAAAAGCCCTGTGG - Intronic
1179274713 21:39881741-39881763 CTCTGCACCCAGATGGACTGAGG + Intronic
1179801530 21:43813532-43813554 CCCTGCCCTCAAGTGCCCTGAGG - Intergenic
1180088030 21:45516792-45516814 CTCTGCCCACGGATGTCCTGAGG - Intronic
1181420977 22:22798805-22798827 TTGGGCACACAAATCCCCTGAGG + Intronic
1181465321 22:23107704-23107726 CTCTGCACACAGAACCCCAGGGG + Intronic
1181581147 22:23828825-23828847 CCTTGCACACACATGTCCTGTGG - Intronic
1181983157 22:26780714-26780736 ACATGCACACAAATCCCCTGGGG - Intergenic
1183548156 22:38466406-38466428 ATGTGCACACGAATCCCCTGGGG - Intergenic
1184732961 22:46381013-46381035 TCCCGCGCACAAATGCCCTGAGG + Intronic
949981155 3:9502396-9502418 CTCTGCCCACTTGTGCCCTGGGG - Intronic
950963998 3:17133534-17133556 CTATACACACAAATGAGCTGGGG - Intergenic
953017871 3:39095871-39095893 CTCTGAATACAAATGACCTTGGG - Exonic
953032078 3:39185832-39185854 GGCTGCACACAGATGGCCTGGGG - Exonic
953664032 3:44913063-44913085 ATGTGCACACAAATTACCTGGGG + Intronic
953955888 3:47231739-47231761 CTGTGCACACAAATCACCAGGGG - Intronic
954749306 3:52804660-52804682 CCCTGCTCACAAGTGCCCTATGG + Intronic
955038446 3:55291814-55291836 ATGTGCACACAAATCACCTGGGG + Intergenic
955217596 3:56997297-56997319 CTGTCCACTCACATGCCCTGTGG + Intronic
955713164 3:61801227-61801249 CTATGCACACAGACGCCCTCAGG + Intronic
956848380 3:73205060-73205082 CTCTGAAAACATATGCCTTGGGG - Intergenic
959227319 3:103602771-103602793 TTCTACACACACAGGCCCTGGGG + Intergenic
960311245 3:116118925-116118947 ATGTGCATACAAATGCCCTGGGG + Intronic
960917819 3:122714917-122714939 TTCTACACAGAAATGCCCTGAGG - Intronic
961555534 3:127694480-127694502 CTCTGCAGACAGGGGCCCTGAGG - Intronic
962399401 3:135044341-135044363 CTCTGCCTACATCTGCCCTGAGG + Intronic
962446518 3:135470811-135470833 CTGTGCATACAAATCACCTGGGG + Intergenic
965471180 3:169094360-169094382 CTCTGCACACATATGCCAGCTGG + Intronic
967408116 3:189139733-189139755 CACTGCACACAGATGCCATGGGG - Intronic
968919868 4:3516933-3516955 CGCTGGACACAACTGCCTTGGGG + Intronic
969502597 4:7562304-7562326 CTGCGTACACAAAGGCCCTGAGG + Intronic
970126881 4:12823854-12823876 CTTTGCAGAGAAATGGCCTGAGG + Intergenic
971215890 4:24661892-24661914 ATGTGCACACAAATTCCCTGTGG - Intergenic
971452370 4:26812069-26812091 CCCTGAGCACAAATGTCCTGAGG + Intergenic
972242912 4:37213457-37213479 CTCTGCACACCACTGCCCCTGGG + Intergenic
974091717 4:57317987-57318009 CTGTGCACCCAGATGCCATGAGG - Intergenic
975257195 4:72251832-72251854 CTTTGCACATACATGCACTGTGG + Intergenic
977331693 4:95644565-95644587 CTAAGCACACAAACTCCCTGGGG - Intergenic
984487400 4:180388570-180388592 CTCCCCAAACAGATGCCCTGTGG + Intergenic
986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG + Intergenic
986468538 5:8050966-8050988 CTCTGCACACAGATGTCCACAGG - Intergenic
986749092 5:10769941-10769963 TTCTTTACCCAAATGCCCTGTGG - Intergenic
987129997 5:14851327-14851349 CTCTGCACAGAAGTGCCATTCGG + Intronic
989264352 5:39455798-39455820 CTCTGCTCACAAATGACCGCCGG + Intronic
989312814 5:40040273-40040295 CTGTGCACTCAAATTCCTTGAGG - Intergenic
989957870 5:50376747-50376769 CTCAGCACACCACTGCACTGTGG + Intergenic
990067939 5:51741502-51741524 CATTTAACACAAATGCCCTGTGG - Intergenic
991575052 5:68093973-68093995 CTCTCCACTCAAATGACATGTGG - Intergenic
992625170 5:78630295-78630317 GACTCCCCACAAATGCCCTGCGG + Intronic
995174526 5:109159829-109159851 CTCTGCACAAAAATAGTCTGTGG + Intronic
995216218 5:109597822-109597844 ATGTGCACACAAATCACCTGAGG - Intergenic
995968222 5:117936143-117936165 CTCTGGACTCAAATTGCCTGTGG - Intergenic
996336408 5:122388413-122388435 CTCTGCACACCAATCCACTATGG - Intronic
996668041 5:126083738-126083760 CTCTGAACACAAATCCCCACTGG + Intergenic
996772671 5:127101496-127101518 CTCTGCTCAAAAATCCCCTGGGG + Intergenic
997347305 5:133201389-133201411 CTCCCCACACAGATGCTCTGGGG + Intronic
997787592 5:136727848-136727870 CTCAGGACATAAATGGCCTGTGG + Intergenic
999417305 5:151409683-151409705 ATGTGCACACAAATTTCCTGGGG - Intergenic
999591230 5:153148665-153148687 CTCTACAGACACATGCCCTAGGG + Intergenic
999841986 5:155437856-155437878 CTCTGCACACCAGTACCATGTGG - Intergenic
1001231436 5:169992045-169992067 CTGTGGACAGAACTGCCCTGTGG + Intronic
1001383265 5:171317761-171317783 CTCTGGCCTCAAAGGCCCTGGGG + Intergenic
1002485199 5:179530442-179530464 ACCTGCTCCCAAATGCCCTGGGG + Intergenic
1004159963 6:13204522-13204544 ATCTTCCCAGAAATGCCCTGGGG + Intronic
1004634895 6:17457178-17457200 CTCTGCACACACATGCTCACAGG + Intronic
1005189264 6:23201235-23201257 TTCTCCACACAAAAGCCCTGGGG + Intergenic
1006164149 6:32054597-32054619 CTCTGCCCACAAGTACCCAGGGG - Intronic
1006424626 6:33956376-33956398 CTCTACACCCAAATGCCCACAGG + Intergenic
1006754160 6:36400114-36400136 ATGTGCACACAAATCCCCTGGGG + Intronic
1007810818 6:44484586-44484608 ATGTGCACACACATGCCCTGGGG + Intergenic
1008004802 6:46399953-46399975 TCCTGCACACAAAATCCCTGAGG + Intronic
1012955266 6:105563175-105563197 CTCTGCACACAAAATTCCTTGGG + Intergenic
1013941384 6:115667318-115667340 ATGTGCACACAAATCCCCTGCGG - Intergenic
1015446945 6:133317242-133317264 ATCTGCACACACCTGTCCTGTGG - Intronic
1017781462 6:157718820-157718842 CTCTGCAAACCAAGGCTCTGAGG - Intronic
1018788049 6:167123506-167123528 CTCTCCAGACTGATGCCCTGAGG - Intronic
1019725813 7:2602114-2602136 CCCTGCACACAAAGGCCAGGAGG + Intronic
1021399585 7:20194463-20194485 CTCTTCACACATCTGCCATGGGG - Intronic
1024419736 7:49150208-49150230 CCCTGAACACATTTGCCCTGTGG - Intergenic
1024540711 7:50473273-50473295 CTCTGCACACCAGGGCCCTGAGG + Intronic
1028309793 7:89317065-89317087 CTCTGTATACCTATGCCCTGGGG - Intronic
1029985699 7:104921243-104921265 CTCTGCACACAAATGTAATTAGG - Intergenic
1030322785 7:108187074-108187096 CTGTGCACTGAAGTGCCCTGTGG - Intronic
1033111082 7:138577453-138577475 CTCTACACACAAAGTCCCAGTGG + Exonic
1033451204 7:141463718-141463740 CAGTGCAAACAAAGGCCCTGAGG + Intronic
1034462168 7:151204138-151204160 CTCTCCTCACCAATTCCCTGCGG + Intronic
1034997289 7:155586182-155586204 AGCTGCACACACATGCGCTGTGG + Intergenic
1035527671 8:326306-326328 CACTCCACTCAAATGCCCTCAGG - Intergenic
1035773436 8:2168728-2168750 CTCAGCACACACTTGCCCTGGGG + Intergenic
1039775561 8:40732717-40732739 CTCTTCCCAAAAAGGCCCTGAGG + Intronic
1040967901 8:53102372-53102394 CTCTCCACACCATTGACCTGTGG + Intergenic
1041370509 8:57154749-57154771 CTCTGGGAAGAAATGCCCTGGGG + Intergenic
1041770549 8:61467925-61467947 CACTGCACACACATACCCTGTGG - Intronic
1047303237 8:123633152-123633174 CTCTGGACACTTATCCCCTGAGG - Intergenic
1047510372 8:125511263-125511285 TTCTGCAGACAAAGCCCCTGGGG - Intergenic
1049332243 8:142060806-142060828 CTCTGCAGCCACCTGCCCTGGGG + Intergenic
1050458118 9:5853417-5853439 CTGTGCTCAGAGATGCCCTGGGG + Intergenic
1051263248 9:15286450-15286472 CTCTGGATATAAATGCCCTTAGG - Intronic
1051448803 9:17171923-17171945 CTCTGCACACAACTGCACTATGG - Intronic
1051586766 9:18734835-18734857 CACAGCACAAAACTGCCCTGAGG - Intronic
1053020036 9:34688379-34688401 CTCTGTACAGAGAAGCCCTGTGG + Intergenic
1054729390 9:68685463-68685485 GTGTGCACACAAATCACCTGTGG + Intergenic
1054790093 9:69248444-69248466 CTCCGCACACCCATGCCCTCAGG + Intronic
1054954018 9:70887126-70887148 CTCTGCACACAGGTTACCTGTGG + Intronic
1056025325 9:82488821-82488843 CTCTGCTCACAAATGCACTGAGG - Intergenic
1056552669 9:87664363-87664385 CTCTGCCCACTTCTGCCCTGAGG + Intronic
1058340350 9:103887718-103887740 CTCTGAAGACAAATGGTCTGTGG + Intergenic
1058738321 9:107917473-107917495 CCATACACACTAATGCCCTGTGG - Intergenic
1060102097 9:120849619-120849641 ATGTGCACAGAAATCCCCTGGGG - Intergenic
1060335320 9:122716515-122716537 CTATGCATACCAGTGCCCTGAGG - Intergenic
1060547381 9:124469300-124469322 ATGTGCACACAAATGCCATCTGG + Exonic
1061529177 9:131196846-131196868 CTCAGCACAGCAATGGCCTGTGG - Intronic
1061538928 9:131266881-131266903 CTCCTCACAGAGATGCCCTGTGG - Intronic
1061659515 9:132119566-132119588 CTCTCCCCATAATTGCCCTGTGG - Intergenic
1062062168 9:134502498-134502520 CTCTGCACCCAGATGCAGTGGGG + Intergenic
1186209462 X:7234249-7234271 CTGTGCACAGAGATGCCCTCAGG + Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1186525233 X:10242245-10242267 CTCTGCACACAAATCACCTGGGG - Intergenic
1186809659 X:13175845-13175867 ATGTGCACACAAATCACCTGGGG - Intergenic
1186846306 X:13534314-13534336 ATGCGCACACAAATCCCCTGGGG + Intergenic
1189977059 X:46472366-46472388 CTCTGCACATTTGTGCCCTGTGG + Intronic
1191079567 X:56494945-56494967 CTCAGAACTCAAATGCCGTGTGG + Intergenic
1191685497 X:63885311-63885333 GTCTGCACACAAGTGCCATCAGG - Intergenic
1192222856 X:69209213-69209235 ATTTGCAGACAAATGCCTTGTGG - Intergenic
1193118402 X:77797719-77797741 CACTGCCCAAAAATTCCCTGTGG - Intergenic
1195863298 X:109403869-109403891 CTCAGCAAATAAATGCTCTGTGG - Intronic
1197641173 X:128969872-128969894 CTCTAAACACAAATGCCCGTAGG - Intergenic
1197998974 X:132412229-132412251 CTCTGGCCACAAAGGCCCTCAGG + Intronic