ID: 1073466238

View in Genome Browser
Species Human (GRCh38)
Location 10:103696072-103696094
Sequence AGTAGAAGGCAGAGCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073466233_1073466238 1 Left 1073466233 10:103696048-103696070 CCTTCCTGGAGTAGTGGATGCAG 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1073466238 10:103696072-103696094 AGTAGAAGGCAGAGCCCAGAGGG No data
1073466232_1073466238 2 Left 1073466232 10:103696047-103696069 CCCTTCCTGGAGTAGTGGATGCA 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1073466238 10:103696072-103696094 AGTAGAAGGCAGAGCCCAGAGGG No data
1073466227_1073466238 14 Left 1073466227 10:103696035-103696057 CCCACTTACCACCCCTTCCTGGA 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1073466238 10:103696072-103696094 AGTAGAAGGCAGAGCCCAGAGGG No data
1073466231_1073466238 3 Left 1073466231 10:103696046-103696068 CCCCTTCCTGGAGTAGTGGATGC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1073466238 10:103696072-103696094 AGTAGAAGGCAGAGCCCAGAGGG No data
1073466235_1073466238 -3 Left 1073466235 10:103696052-103696074 CCTGGAGTAGTGGATGCAGGAGT 0: 1
1: 0
2: 3
3: 15
4: 165
Right 1073466238 10:103696072-103696094 AGTAGAAGGCAGAGCCCAGAGGG No data
1073466230_1073466238 6 Left 1073466230 10:103696043-103696065 CCACCCCTTCCTGGAGTAGTGGA 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1073466238 10:103696072-103696094 AGTAGAAGGCAGAGCCCAGAGGG No data
1073466228_1073466238 13 Left 1073466228 10:103696036-103696058 CCACTTACCACCCCTTCCTGGAG 0: 1
1: 0
2: 0
3: 18
4: 307
Right 1073466238 10:103696072-103696094 AGTAGAAGGCAGAGCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073466238 Original CRISPR AGTAGAAGGCAGAGCCCAGA GGG Intronic
No off target data available for this crispr