ID: 1073466375

View in Genome Browser
Species Human (GRCh38)
Location 10:103696738-103696760
Sequence GTTTTAGGACACAGCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073466375_1073466386 27 Left 1073466375 10:103696738-103696760 CCTCCCAAGCTGTGTCCTAAAAC 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1073466386 10:103696788-103696810 ATTCTCTGCAGCTGGTCCAGGGG No data
1073466375_1073466385 26 Left 1073466375 10:103696738-103696760 CCTCCCAAGCTGTGTCCTAAAAC 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466375_1073466384 25 Left 1073466375 10:103696738-103696760 CCTCCCAAGCTGTGTCCTAAAAC 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1073466384 10:103696786-103696808 TCATTCTCTGCAGCTGGTCCAGG No data
1073466375_1073466382 19 Left 1073466375 10:103696738-103696760 CCTCCCAAGCTGTGTCCTAAAAC 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1073466382 10:103696780-103696802 AGCCATTCATTCTCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073466375 Original CRISPR GTTTTAGGACACAGCTTGGG AGG (reversed) Intronic
900954921 1:5880916-5880938 ATTTTGGGACACAGCTTCGTTGG - Intronic
901572742 1:10174822-10174844 GTTTTAGAAGAGAGCTTTGGTGG + Intronic
906520222 1:46462349-46462371 GTATTTGGACACTGCCTGGGTGG + Intergenic
907334320 1:53690361-53690383 GCTGCAGGACACAGCTGGGGCGG + Intronic
909768181 1:79384853-79384875 GGTTTAGGAAACATCTTTGGTGG - Intergenic
912835274 1:112990879-112990901 GTTTTAAGACACATCTTGGCCGG + Intergenic
913414466 1:118589797-118589819 GTTTCAGGAAACAGCTTGGGAGG - Intergenic
916274154 1:162975952-162975974 GTTTTTGGAAACACCTTGGATGG + Intergenic
917666185 1:177228237-177228259 GATGGAGGACACAGCTTGAGTGG - Intronic
922353368 1:224753823-224753845 GTTTTATGACCTAGCTTGGGAGG + Intergenic
1063789280 10:9423535-9423557 GTTTTTGGACAAATTTTGGGGGG + Intergenic
1067287192 10:44915070-44915092 GTGTGAGGACACAGCCTGAGGGG - Intronic
1071385202 10:85112768-85112790 GTTTGAGAACACAACCTGGGAGG - Intergenic
1072189540 10:93068707-93068729 GCTCTAGGACACGGCTTGGCCGG + Intergenic
1073466375 10:103696738-103696760 GTTTTAGGACACAGCTTGGGAGG - Intronic
1073623731 10:105075060-105075082 CATTAAGGAGACAGCTTGGGAGG - Intronic
1078139869 11:8684101-8684123 TTTTATTGACACAGCTTGGGAGG + Intronic
1079022395 11:16919992-16920014 GATTTGGATCACAGCTTGGGTGG + Intronic
1084148416 11:67277055-67277077 CTTTGAGGACACAGCCTGGCGGG + Intronic
1085511513 11:77090612-77090634 GTCTTAGGACACTGGCTGGGAGG + Intronic
1085916449 11:80894206-80894228 ACTTTCTGACACAGCTTGGGAGG + Intergenic
1087109373 11:94446719-94446741 GTTTTAGGAATCAAATTGGGGGG + Intronic
1088971214 11:114776091-114776113 CTGCTAGGAGACAGCTTGGGAGG + Intergenic
1091433602 12:456773-456795 GTTTTAGGAAAAAGGATGGGTGG + Intergenic
1096625981 12:52896308-52896330 GGGTTAGGACACAGCTGGGTGGG - Intergenic
1096688931 12:53307630-53307652 GTTTTAGCCCAGTGCTTGGGCGG - Exonic
1097696601 12:62781011-62781033 GTTTCAAGGCACAGCTTGGTTGG + Intronic
1098200491 12:68049793-68049815 GTTTTGGGAGAGAGCATGGGGGG + Intergenic
1098484438 12:71004407-71004429 ATTTGAGGACACAGCGTAGGTGG + Intergenic
1102149468 12:110678819-110678841 GTTTAAAGACACAGTTTTGGGGG + Intronic
1102952758 12:117041212-117041234 ATTTTAGGACACAGCGAGGAAGG + Intronic
1105814676 13:24023890-24023912 GTTTCAGGCCACAGCATGGGTGG + Intronic
1114420040 14:22574314-22574336 GCTTTAGAACTCTGCTTGGGAGG + Intronic
1115760089 14:36571880-36571902 GTTCTAAGATACAGCATGGGTGG - Intergenic
1118921476 14:70153320-70153342 GTCTAAGGACACAGCTTGCATGG + Intronic
1119655564 14:76414282-76414304 GGTTAAGGTCACAGCTGGGGTGG - Intronic
1121294955 14:92812823-92812845 GGTTCAGGACAGAGCTTAGGAGG - Intronic
1121494994 14:94386057-94386079 GTTATAAGGAACAGCTTGGGAGG - Intronic
1122628567 14:103097161-103097183 CTTCTCGGACACAGCTAGGGTGG + Intergenic
1127338792 15:58019304-58019326 GTTTCAAGACAGAGCTTGAGTGG - Intronic
1127947954 15:63774124-63774146 GACTTAGGACAGAGTTTGGGAGG - Intronic
1129682035 15:77663516-77663538 ATTTCAGGATACATCTTGGGTGG - Intronic
1133837401 16:9379121-9379143 GTATTTGCTCACAGCTTGGGAGG + Intergenic
1134347041 16:13400781-13400803 GCTGCAGGACACAGCTTAGGAGG + Intergenic
1134541455 16:15070116-15070138 GGTGTAGAACACAGCTTGGCAGG + Exonic
1135359447 16:21799696-21799718 GGTGTAGAACACAGCTTGGCAGG + Intergenic
1135436914 16:22434673-22434695 GGTGTAGAACACAGCTTGGCAGG + Intronic
1136263348 16:29097248-29097270 GGTGTAGAACACAGCTTGGCAGG - Intergenic
1139487189 16:67264590-67264612 GTGTTAGGATCCAGCTTAGGGGG + Intronic
1139919988 16:70453764-70453786 GTTTTAGGGTACAGATTTGGGGG + Intergenic
1140790486 16:78386537-78386559 GTTTTAGGATGCAGATTGAGAGG + Intronic
1154369675 18:13748411-13748433 GAGTTAGGACACTACTTGGGTGG + Intronic
1154955761 18:21253057-21253079 GTTTTAAGACAGAGCTTTGTTGG + Intronic
1156220112 18:35042318-35042340 GTTTATGGCCACCGCTTGGGTGG + Intronic
1159376683 18:67602629-67602651 GTTTCAGGACTCAGCCTGAGAGG + Intergenic
1161455603 19:4368305-4368327 AGTTTAGGACCCAGCCTGGGAGG + Intronic
1163196269 19:15723302-15723324 GCTTTCAGACACAGCTGGGGTGG + Intergenic
1165747120 19:38236170-38236192 GTTTTAGGCCACCACTTTGGTGG - Intergenic
1165901407 19:39171004-39171026 GTTTTTGGAGACACCTTGGTGGG - Intronic
1167163140 19:47780508-47780530 GTTTTGGGACACAGCACAGGGGG - Intronic
925102291 2:1257570-1257592 GTTCTAAGACAAAGCTTGGAGGG - Intronic
926379450 2:12270892-12270914 GGCTTGGGAAACAGCTTGGGTGG - Intergenic
931856302 2:66305127-66305149 GTTTTTGGACACTTCTTTGGAGG + Intergenic
932739188 2:74278939-74278961 GTTTGAGGAGACAGGTGGGGTGG - Intronic
934036883 2:88095696-88095718 GGTTTAGGACCCAGCTTGCAGGG + Intronic
937777005 2:125789785-125789807 TTTTCAGGACAGAGCTGGGGTGG - Intergenic
939011674 2:136854162-136854184 CTCTTAGGAAACAGCTGGGGGGG + Intronic
939875419 2:147572033-147572055 GGTCAAGGACACAGTTTGGGCGG + Intergenic
941498304 2:166235700-166235722 ATTTTGGGACACAGATTTGGGGG - Intronic
1169169048 20:3449344-3449366 ATTTTAGCACTCACCTTGGGTGG + Intergenic
1172781440 20:37439050-37439072 TCTTCAGGACACAGCCTGGGTGG - Intergenic
1174623394 20:51894533-51894555 GTTTGAAGACACATATTGGGAGG - Intergenic
1177640640 21:23840234-23840256 GTTCTATGGGACAGCTTGGGTGG + Intergenic
1182762731 22:32735680-32735702 GTTTCAGGAGTCAGCGTGGGAGG - Intronic
950828135 3:15847040-15847062 GTTTTAAGACACAGATTCTGGGG + Intronic
950953605 3:17027949-17027971 GTTATAGCACACAGCTCAGGTGG - Intronic
951402823 3:22255276-22255298 ATTTTAGGACACAATTTTGGGGG - Intronic
953157904 3:40391792-40391814 GTTTTAGTACACAATTTGTGAGG + Intronic
956437306 3:69246500-69246522 GTTTTAGAACAAAACTTTGGAGG + Intronic
956747050 3:72318615-72318637 GTGTTGGGAGACAGCTTGTGTGG - Intergenic
960876124 3:122296715-122296737 GTTTTAGATCACATATTGGGGGG - Intergenic
964678040 3:159305239-159305261 GCCTGAGGACACAGCTTGGATGG - Intronic
966782516 3:183595919-183595941 GTTGTAGGAGACTGCTTTGGGGG + Intergenic
966872890 3:184303178-184303200 TTTTCAGGTCACTGCTTGGGGGG + Intronic
968576961 4:1371369-1371391 GTCTCAGGACACAGTCTGGGCGG + Intronic
968735319 4:2292083-2292105 GCTCTGGGACACAGCATGGGGGG + Intronic
968815683 4:2820507-2820529 GATCCAGGACACAGCTTGGAGGG - Intronic
971442942 4:26709693-26709715 CTTTTAGGAGAAAGCTTGGATGG - Intronic
985984562 5:3504023-3504045 CTGTTGGGTCACAGCTTGGGTGG - Intergenic
992195379 5:74334154-74334176 GATTTAGGAAACATCTTGAGGGG - Intergenic
994748558 5:103709746-103709768 GTTCTAAGATACAGCATGGGTGG - Intergenic
995227142 5:109713219-109713241 ATTTTAGGACTGAGTTTGGGGGG + Intronic
1000489740 5:161896498-161896520 ATTTTATGTCACAGCTTGGGAGG + Intronic
1002546250 5:179947355-179947377 GATTTAGGACACAGGTGGGGTGG - Intronic
1004395430 6:15243732-15243754 TTTTTAGAAAACACCTTGGGTGG + Intergenic
1006102578 6:31694685-31694707 GTATTAAGACACAGCTAGGCCGG - Intronic
1008119168 6:47591215-47591237 GTGTTAGAAGACAGCTTGGGTGG + Intronic
1010356192 6:74936688-74936710 TTTTTAGGACACAGCATTGGAGG + Intergenic
1010750826 6:79614554-79614576 CCTTGAGTACACAGCTTGGGAGG + Intergenic
1015738333 6:136425374-136425396 TTGTGAGGACACAGCTTTGGGGG + Intronic
1018406709 6:163492406-163492428 GTTATAGGACATAGTTTGTGGGG + Intronic
1019543492 7:1561638-1561660 GATTTAGGACACAGGACGGGAGG - Intergenic
1022945914 7:35283381-35283403 GTTGTAGAACACAGATTGGATGG + Intergenic
1025932650 7:66009014-66009036 GTTTCAGGAAACAGCTAGAGAGG + Intergenic
1025950742 7:66143417-66143439 GTTTTAGGAAACAGCTAGAGAGG - Intronic
1035231543 7:157468781-157468803 CTTTTCGGACACCGGTTGGGGGG + Intergenic
1035524694 8:303512-303534 GGTTCAGGACACAGGCTGGGAGG - Intergenic
1044801843 8:95965013-95965035 GTTTGAGGAAACAGTATGGGAGG - Intergenic
1044964538 8:97562378-97562400 GTATTAGGACACAGATTCGGAGG + Intergenic
1047900152 8:129411946-129411968 GTTTTAGGAGCTGGCTTGGGAGG + Intergenic
1048185848 8:132240129-132240151 ATTTTGACACACAGCTTGGGAGG + Intronic
1049261095 8:141639629-141639651 GTCTGAGGACACAGCCAGGGAGG + Intergenic
1055335238 9:75226949-75226971 GTTTTAGCAAAGAGCTTGGTTGG - Intergenic
1059228499 9:112695653-112695675 GTTTGATGACATAGCATGGGTGG - Intronic
1060522165 9:124300122-124300144 CTTTGAGGGCACAACTTGGGAGG + Intronic
1062127366 9:134870791-134870813 GTTTTAGGACGAAGGTGGGGTGG + Intergenic
1062479229 9:136743804-136743826 GTCAGAGGACACAGCCTGGGAGG - Intergenic
1062725111 9:138068661-138068683 CTGTAAGGACACAGCTTGGTGGG + Intronic
1186989652 X:15053709-15053731 GATTTTGCACACAGCTTGGTTGG + Intergenic
1187721735 X:22157681-22157703 GTTTTAGGAGAGAGCATGGATGG + Intronic
1187828293 X:23354926-23354948 ACTTTAGGAGACAACTTGGGAGG - Intronic
1188230237 X:27653469-27653491 GTTTTAGGAAGCTACTTGGGGGG - Intronic
1188838009 X:34982497-34982519 GATTTGGCACTCAGCTTGGGTGG - Intergenic
1191803387 X:65105763-65105785 TTTTTGGGAAACTGCTTGGGTGG + Intergenic
1192632587 X:72788992-72789014 CTTCTAGGGAACAGCTTGGGTGG - Intronic
1192649122 X:72931809-72931831 CTTCTAGGGAACAGCTTGGGTGG + Intronic
1199821196 X:151448843-151448865 TTTTTAGGCCACAGATTTGGTGG + Intergenic