ID: 1073466376

View in Genome Browser
Species Human (GRCh38)
Location 10:103696741-103696763
Sequence GCTGTTTTAGGACACAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073466376_1073466386 24 Left 1073466376 10:103696741-103696763 CCCAAGCTGTGTCCTAAAACAGC 0: 1
1: 1
2: 1
3: 22
4: 172
Right 1073466386 10:103696788-103696810 ATTCTCTGCAGCTGGTCCAGGGG No data
1073466376_1073466384 22 Left 1073466376 10:103696741-103696763 CCCAAGCTGTGTCCTAAAACAGC 0: 1
1: 1
2: 1
3: 22
4: 172
Right 1073466384 10:103696786-103696808 TCATTCTCTGCAGCTGGTCCAGG No data
1073466376_1073466385 23 Left 1073466376 10:103696741-103696763 CCCAAGCTGTGTCCTAAAACAGC 0: 1
1: 1
2: 1
3: 22
4: 172
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466376_1073466382 16 Left 1073466376 10:103696741-103696763 CCCAAGCTGTGTCCTAAAACAGC 0: 1
1: 1
2: 1
3: 22
4: 172
Right 1073466382 10:103696780-103696802 AGCCATTCATTCTCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073466376 Original CRISPR GCTGTTTTAGGACACAGCTT GGG (reversed) Intronic
901176321 1:7302059-7302081 GCTATTTTAGGACTCACTTTTGG + Intronic
906151431 1:43590029-43590051 GTTGTTTTAGGATACAGATCAGG + Intronic
906602181 1:47139572-47139594 ACTGCGTTAGGACACAGCTGTGG - Intronic
910876514 1:91883952-91883974 GCTTCCTTAGGAAACAGCTTGGG - Intronic
911776518 1:101820280-101820302 GCTGTTTTAGGGCAATGGTTTGG - Intronic
912384207 1:109263280-109263302 GCTGTTAGAGGCCACAGCCTGGG + Intronic
912959046 1:114179126-114179148 ACTCTTTTAGGACTCAGCTCTGG + Intergenic
913221655 1:116665451-116665473 GCTGTCTTAGAACACATCTCAGG - Intronic
914327056 1:146629201-146629223 ACTGATTTATGACACAGCCTTGG + Intergenic
914338978 1:146742146-146742168 GATGTTCTAGGACATAGCTTTGG - Intergenic
915173164 1:153992686-153992708 CCAGTTTTAAGAAACAGCTTAGG + Exonic
918961358 1:191282508-191282530 GCTGGTATAGGACACTGCATGGG - Intergenic
918990610 1:191693780-191693802 GCTGTTTTAGAACATAAATTTGG + Intergenic
1067190187 10:44062210-44062232 GTCATTTCAGGACACAGCTTGGG - Intergenic
1067498136 10:46776960-46776982 AGTGTTTTTGGACATAGCTTGGG - Intergenic
1067596507 10:47563455-47563477 AGTGTTTTTGGACATAGCTTGGG + Intergenic
1067680564 10:48435200-48435222 GCTGTTTTGAAACACAACTTAGG - Exonic
1068860743 10:61845421-61845443 GCTGTTTTATGACACATTGTCGG + Intergenic
1070139861 10:73731025-73731047 AGTGTTTTTGGACATAGCTTGGG + Intergenic
1070641071 10:78170590-78170612 GCCGTTTAAGGACTCAGATTGGG + Intergenic
1070889034 10:79928435-79928457 GGTGTCCTAGAACACAGCTTAGG - Intergenic
1073466376 10:103696741-103696763 GCTGTTTTAGGACACAGCTTGGG - Intronic
1074641894 10:115394312-115394334 GCTGTTTGAGTACAAAGCTCTGG + Intronic
1076333757 10:129691416-129691438 GCTGCTTCAGGACACTGCCTGGG - Intronic
1076912888 10:133401057-133401079 GCTGCTCTAGGACCCAGCTCAGG - Intronic
1078406581 11:11075208-11075230 GCAGTTTGTGGATACAGCTTTGG + Intergenic
1079082325 11:17422549-17422571 ACTGGGTTAGGAAACAGCTTGGG - Intronic
1079670560 11:23165147-23165169 GCTGTTTTAAGCCACTGCTTTGG + Intergenic
1083886848 11:65577205-65577227 GCTGGATTAGGGCACAGCTGTGG + Intronic
1084013545 11:66365887-66365909 GATGTTTTAGGAAGCAGTTTGGG - Intronic
1086946797 11:92851755-92851777 GCTGTGTTTGGTGACAGCTTGGG - Intronic
1087409527 11:97774498-97774520 GCAGATTAAGGACACATCTTTGG + Intergenic
1088402437 11:109436051-109436073 GATATTTTGGGGCACAGCTTTGG + Intergenic
1088933604 11:114377270-114377292 GCTGAGATTGGACACAGCTTTGG + Intergenic
1089704466 11:120267609-120267631 GGTTGTTTAGGACACAGCTGAGG + Intronic
1091747090 12:2999406-2999428 GCTGTTTGAGGACAGGGGTTAGG + Intronic
1092650042 12:10624887-10624909 GCTGTCTGAGATCACAGCTTGGG + Intronic
1095880909 12:47135382-47135404 GCTGATACAGGACTCAGCTTTGG + Intronic
1098009592 12:66036444-66036466 TCTATTTTTGGACACAGCTCAGG - Intergenic
1098484437 12:71004404-71004426 GCTATTTGAGGACACAGCGTAGG + Intergenic
1100647019 12:96542284-96542306 GCTGAAGTAGGACAGAGCTTGGG - Intronic
1101299232 12:103460632-103460654 GCTGCTTGAGGGCTCAGCTTTGG + Intronic
1102329212 12:112014484-112014506 GCTGTTGTAGGAAACATCTTGGG + Intronic
1104797070 12:131527337-131527359 GCTGTGGGAGGACACACCTTTGG - Intergenic
1105314248 13:19242834-19242856 GCTGATTGGGGACACAGCTCTGG - Intergenic
1109379034 13:61534491-61534513 ACAATTTTAGGCCACAGCTTGGG + Intergenic
1109919956 13:69043792-69043814 GGTGTTTAAGGACACAGATCTGG + Intergenic
1111587263 13:90298145-90298167 ACTGTTTTAGGAATCTGCTTAGG + Intergenic
1113182008 13:107639644-107639666 GCTTCTTCAGGACACAGGTTTGG + Intronic
1114648957 14:24271218-24271240 GCTGCTTCCGGACACAGCTGTGG - Exonic
1115018484 14:28645935-28645957 GCTGTTTTAAGCTACAGTTTTGG - Intergenic
1117564906 14:56983829-56983851 GATGTTTTAGGATAAAGCTTTGG + Intergenic
1117709361 14:58508868-58508890 TGTGTTCTAGGGCACAGCTTGGG - Intronic
1119012071 14:71003824-71003846 TCTGGTTTAGAAGACAGCTTTGG - Intronic
1119998357 14:79277729-79277751 GCTGGTTTAAGACACTGCGTGGG + Intronic
1123181284 14:106472836-106472858 GCTGTTTTTGGACATAGATCTGG + Intergenic
1202945611 14_KI270726v1_random:23864-23886 GCTGTTTTTGGACATAGATCTGG - Intergenic
1128985273 15:72216029-72216051 GCTGTTTATGAACACAGGTTAGG + Intronic
1133255568 16:4513920-4513942 ACTGTTTTGGGACACAGATGGGG + Intronic
1133478546 16:6147340-6147362 GTTGTGTTAGGTCATAGCTTGGG - Intronic
1134347040 16:13400778-13400800 GGTGCTGCAGGACACAGCTTAGG + Intergenic
1134590625 16:15450145-15450167 GCAGCTTTAGGCTACAGCTTTGG - Intronic
1139919985 16:70453761-70453783 ACTGTTTTAGGGTACAGATTTGG + Intergenic
1139995302 16:70975206-70975228 GATGTTCTAGGACATAGCTTTGG + Exonic
1140006505 16:71081738-71081760 ACTGATTTATGACACAGCCTTGG - Intronic
1140279357 16:73540996-73541018 GCTGTTTCTGGAAACAGCTGGGG - Intergenic
1140784951 16:78331966-78331988 ACTGCTTGAGGACACAGCTTTGG - Intronic
1142068712 16:88077495-88077517 CCTGGTTTAGGACACAGCTGTGG + Intronic
1142137872 16:88459880-88459902 GCTGTCCTGGGAGACAGCTTGGG - Intronic
1145716153 17:27023957-27023979 GGCATTTTTGGACACAGCTTTGG - Intergenic
1148056924 17:44804675-44804697 GCTTTTGTTGGACCCAGCTTTGG + Exonic
1149340437 17:55680467-55680489 TCTGTTTTAGGCCACAACTCGGG + Intergenic
1149645914 17:58241630-58241652 GCTGTTTGAGAACTCATCTTGGG + Intronic
1153310831 18:3675461-3675483 TCTGTTTGATGGCACAGCTTTGG + Intronic
1153552840 18:6280454-6280476 GCTCTGTTAGCACACAGTTTAGG - Intronic
1157505441 18:48222971-48222993 GCTGTCTCAGAACACAGCTCAGG - Intronic
1157539060 18:48486385-48486407 GCTGGCTGGGGACACAGCTTTGG - Intergenic
1157549251 18:48569856-48569878 GCTGTCCTAGGACACAGCATTGG + Intronic
1159109004 18:64034728-64034750 GCTGTGAAATGACACAGCTTTGG + Intergenic
1165747121 19:38236173-38236195 GTTGTTTTAGGCCACCACTTTGG - Intergenic
926577973 2:14603414-14603436 GCTACTGTAGGAGACAGCTTAGG - Intergenic
927974540 2:27328036-27328058 GCTCTTTCAAGACACAGATTTGG - Exonic
930019608 2:46993554-46993576 GCTTATTTAGGAGTCAGCTTTGG + Intronic
933262482 2:80146137-80146159 GCTGTTTGAAGAGACAGCTAGGG - Intronic
933776695 2:85775369-85775391 GGGGCTTTAGGACACAGCTAGGG + Intronic
936032186 2:109081393-109081415 GCTGTTTTTGGAAACATCTGTGG + Intergenic
936105506 2:109621060-109621082 GCTGCTTTTGGCCAAAGCTTTGG - Intergenic
936155831 2:110047008-110047030 GCTGTTCTAGGACACCGCAGGGG + Intergenic
936188857 2:110324420-110324442 GCTGTTCTAGGACACCGCAGGGG - Intergenic
937894330 2:126967044-126967066 GCAATTTTAAGCCACAGCTTAGG - Intergenic
942388342 2:175465136-175465158 GATTTTTTAGGACCCAGTTTTGG - Intergenic
942872103 2:180747505-180747527 GCTGTGTAAGGACACTGCTTCGG + Intergenic
942959066 2:181807880-181807902 GATGCTTTAGGACAGAGCATAGG - Intergenic
946456390 2:219830110-219830132 GCTGTCTGAGGACTCAGATTTGG - Intergenic
947640520 2:231705295-231705317 TCTGTTTTAGGACTTAGCCTCGG + Intergenic
1169344518 20:4819950-4819972 GCTGTTTGCGGTGACAGCTTGGG - Intronic
1170133374 20:13046684-13046706 GCTATTTTAGTACAAACCTTTGG - Intronic
1171160537 20:22918421-22918443 GCTAGTTGAGGACACAGCTGTGG + Intergenic
1171331291 20:24340935-24340957 GCTATTTTATGACACAAGTTTGG - Intergenic
1171429472 20:25072165-25072187 GTTGTTTTAAGCCACAGTTTGGG + Intronic
1172795543 20:37534725-37534747 ACTGTCTTAGTTCACAGCTTAGG + Intergenic
1174787650 20:53447567-53447589 GCTGTTTCAGGACCTAACTTGGG + Intronic
1175403977 20:58715463-58715485 GAAGTTTTAGGAGACAGCTTAGG + Exonic
1177606519 21:23385803-23385825 CTTGTTTTAGGAAACATCTTAGG + Intergenic
1177645385 21:23894103-23894125 GGTAATTTAGAACACAGCTTGGG - Intergenic
1180068216 21:45423455-45423477 GCTGTGTGTGGACACAGCTTTGG - Intronic
1182292113 22:29288296-29288318 GCTGCTTTTGGAGACATCTTAGG + Intronic
1184649100 22:45911541-45911563 GCTTTCTTGGGACACAGCTCAGG + Intergenic
951141972 3:19173111-19173133 GCAGTTTTTGGACAGAGCCTGGG - Intronic
952051494 3:29389823-29389845 GCTGTTTGAGGACTCAGCTTTGG + Intronic
953944841 3:47137581-47137603 GCTTCTTTAGGACAGAGATTTGG + Intronic
954811018 3:53247929-53247951 GCTCCTTGAGGACAGAGCTTTGG + Intronic
957291684 3:78285241-78285263 GCTATGTGAGGACACAGCATTGG - Intergenic
958272169 3:91515202-91515224 ATCGTTTTAGAACACAGCTTTGG - Intergenic
961032531 3:123619066-123619088 GCTGCTTTAGGATTCAGCTGAGG + Intronic
961563206 3:127745795-127745817 ACTCTTTCAGGGCACAGCTTTGG - Intronic
963134312 3:141886861-141886883 GCTGTGTTAGCACACATCTTTGG + Intronic
964974074 3:162599248-162599270 GCTGCTTTAGAACACAGTTTGGG + Intergenic
967240372 3:187432847-187432869 CTTGTTTTAAGACACTGCTTAGG - Intergenic
967823807 3:193862667-193862689 GCTGTTTTATGACAGACTTTGGG - Intergenic
968949818 4:3684644-3684666 GCTGTCTTAGGAAACAGCTGTGG - Intergenic
971990202 4:33882570-33882592 TCTGTTTAAGAAAACAGCTTCGG + Intergenic
974293887 4:59969182-59969204 GGTGTCTTATGACACAGCTGGGG + Intergenic
974772306 4:66432773-66432795 GCTGTAATAGGACACAACTCAGG - Intergenic
979481509 4:121223687-121223709 GGTGTTCAAGGACACAGCTCTGG - Intronic
982760337 4:159275293-159275315 GCTGTTTTCAGAGACATCTTAGG + Intronic
985422790 4:189801380-189801402 CCTCTTTTATGACCCAGCTTGGG - Intergenic
986493975 5:8323079-8323101 GCTGTTTTAGGCCACCTTTTAGG - Intergenic
989866142 5:46510916-46510938 GCAGTTTTAAAACACTGCTTTGG + Intergenic
989867236 5:46529754-46529776 GCAGTTTTAAAACACAGTTTTGG + Intergenic
989887595 5:46912968-46912990 GCTGTTTTGAAACACTGCTTTGG + Intergenic
991259777 5:64654154-64654176 GCTGTTTTACCATGCAGCTTTGG + Intergenic
991314468 5:65285011-65285033 GCTGTTTTAGTACTCTGCGTAGG + Intronic
992625267 5:78631115-78631137 TTTGTTTTAGAACACAGTTTAGG - Intronic
995457693 5:112369301-112369323 GCTGTGTTAGGAGACTGCTGTGG - Intronic
995591131 5:113700818-113700840 GCTGCTTCAGTAAACAGCTTTGG - Intergenic
997903959 5:137795717-137795739 GCTGGTTATGGACACTGCTTTGG - Intergenic
998196949 5:140081900-140081922 GCTTGTTTAAAACACAGCTTTGG - Intergenic
998497937 5:142607112-142607134 GATGTTTTATGACCCAGCTTAGG + Intronic
999290438 5:150422058-150422080 GCAGTTTCAGGACACAGCTGAGG + Intergenic
1002132075 5:177087675-177087697 GCTCTTTGGGTACACAGCTTGGG - Intronic
1003230911 6:4253043-4253065 GCTGATTTAGGACATAGAGTTGG + Intergenic
1005808214 6:29494809-29494831 GATGTCTTAGGACTCAGATTCGG + Intergenic
1008673618 6:53796455-53796477 CCTGTTTTAGGCCTGAGCTTTGG + Intronic
1008982939 6:57505927-57505949 ATCGTTTTAGAACACAGCTTTGG + Intronic
1009121626 6:59337951-59337973 GCAGTTTTGAGACACAGTTTTGG + Intergenic
1009171007 6:60398797-60398819 ATTGTTTTAGAACACAGCTTTGG + Intergenic
1009507513 6:64503626-64503648 GCTGTTTCAGGACAAATGTTTGG - Intronic
1009861480 6:69339646-69339668 AATGCTTTAAGACACAGCTTGGG + Intronic
1010111537 6:72240685-72240707 GCTTTTCTAGGTAACAGCTTAGG + Intronic
1010356190 6:74936685-74936707 CCCTTTTTAGGACACAGCATTGG + Intergenic
1012805060 6:103883532-103883554 TCTGTTTTTGAACACAGCTACGG - Intergenic
1013034720 6:106370251-106370273 GCTTTTTTCTGACACAGCTTGGG - Intergenic
1013175885 6:107676082-107676104 GAAGCTCTAGGACACAGCTTGGG - Intergenic
1017559709 6:155614385-155614407 GCTGGTTTAGAACTGAGCTTGGG - Intergenic
1019223684 6:170494058-170494080 GCTTTTTTAGAACCCAGCCTTGG + Intergenic
1019799120 7:3074854-3074876 GCTGTTTCAGGGCCCAGCTTAGG + Intergenic
1023365011 7:39455256-39455278 GCTGTCTAAGGATAGAGCTTAGG - Intronic
1026822680 7:73560058-73560080 GCTGTTTCAGGACACAGCTTGGG + Intergenic
1028465395 7:91145863-91145885 GCTTGTTTAGGACACAGGATAGG - Intronic
1029844082 7:103395161-103395183 GCTGTTTTAAGTCACTGTTTTGG + Intronic
1031160443 7:118161225-118161247 CCTTTTTTTGTACACAGCTTTGG + Intergenic
1031876397 7:127146697-127146719 GCTCTAGTAGGACACAGCTAAGG + Intronic
1032155621 7:129465287-129465309 GTTTTTTTAGGACTCAGGTTAGG - Intronic
1032692447 7:134302479-134302501 TGTGTCTTAGGACACAGATTTGG - Intronic
1034409945 7:150935258-150935280 CCAGGTTTAGGACACAGCTCTGG - Intergenic
1034593858 7:152168899-152168921 GCTGTTTTTGTATACAGATTGGG - Intronic
1037556074 8:20023821-20023843 TGTGTTTTAGGACCTAGCTTTGG - Intergenic
1038547732 8:28438789-28438811 GCTTTCTAAGGACACAGATTGGG - Intronic
1043125910 8:76394480-76394502 GCTGTTTTAGAAAACATCTCTGG - Intergenic
1044523832 8:93229728-93229750 GCTATTTTCGGACACTTCTTAGG - Intergenic
1046102224 8:109628470-109628492 GCTGTTGTGGCACACATCTTTGG - Intronic
1046895726 8:119470264-119470286 GCTTTTTTATGACCTAGCTTCGG - Intergenic
1047513556 8:125534011-125534033 ATTGGTTTAGGATACAGCTTGGG + Intergenic
1049224412 8:141442905-141442927 CTTTTTTTATGACACAGCTTGGG - Intergenic
1049662884 8:143828291-143828313 TCTGTTTGAGAAGACAGCTTGGG - Intronic
1052557754 9:30039745-30039767 GATGTTTTAGGTGACAGGTTTGG + Intergenic
1053533388 9:38903692-38903714 GTTTCTTCAGGACACAGCTTGGG - Intergenic
1054205615 9:62128121-62128143 GTTTCTTCAGGACACAGCTTGGG - Intergenic
1054632746 9:67460249-67460271 GTTTCTTCAGGACACAGCTTGGG + Intergenic
1054991488 9:71332295-71332317 GCTTTTTTTGGATACATCTTTGG + Intronic
1055957633 9:81789056-81789078 GCTTTATCAGGACACAGCTCTGG - Intergenic
1057297536 9:93858213-93858235 GCTGCTTGAGGACACAGATCTGG + Intergenic
1057297908 9:93860099-93860121 GCTGTTTGAGGCCATAGCTTTGG - Intergenic
1057726650 9:97572811-97572833 GCTGGCTCAGGACACAGTTTGGG + Intronic
1061705267 9:132448383-132448405 GTTGTGTTAAGGCACAGCTTTGG + Intronic
1186582427 X:10834758-10834780 GCTGTTTTAGGTCTCTGTTTAGG + Intergenic
1187111204 X:16302557-16302579 GGTGGTTTAGGAAACAACTTGGG - Intergenic
1189128138 X:38469747-38469769 TCTGTTACAGAACACAGCTTTGG + Intronic
1189806254 X:44738282-44738304 GCTGCTTTAGCAAAAAGCTTGGG + Intergenic
1190561674 X:51692386-51692408 GCTGATGTCAGACACAGCTTGGG - Intergenic
1190562617 X:51700919-51700941 GCTGATGTCAGACACAGCTTGGG + Intergenic
1192133002 X:68570487-68570509 GATATTTTTGGACAAAGCTTTGG + Intergenic
1193940889 X:87679943-87679965 GCCCATTTAAGACACAGCTTGGG + Intergenic
1197126628 X:122954587-122954609 GTTGTTTTAGGACACACATATGG + Intergenic
1198448321 X:136740577-136740599 TCTGGTTTAGGACTCAGCTTAGG - Intronic
1199457707 X:148047678-148047700 GCAGTTTTAGGTCACCTCTTGGG - Intergenic