ID: 1073466377

View in Genome Browser
Species Human (GRCh38)
Location 10:103696742-103696764
Sequence AGCTGTTTTAGGACACAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073466377_1073466385 22 Left 1073466377 10:103696742-103696764 CCAAGCTGTGTCCTAAAACAGCT 0: 1
1: 1
2: 0
3: 16
4: 219
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466377_1073466384 21 Left 1073466377 10:103696742-103696764 CCAAGCTGTGTCCTAAAACAGCT 0: 1
1: 1
2: 0
3: 16
4: 219
Right 1073466384 10:103696786-103696808 TCATTCTCTGCAGCTGGTCCAGG No data
1073466377_1073466386 23 Left 1073466377 10:103696742-103696764 CCAAGCTGTGTCCTAAAACAGCT 0: 1
1: 1
2: 0
3: 16
4: 219
Right 1073466386 10:103696788-103696810 ATTCTCTGCAGCTGGTCCAGGGG No data
1073466377_1073466382 15 Left 1073466377 10:103696742-103696764 CCAAGCTGTGTCCTAAAACAGCT 0: 1
1: 1
2: 0
3: 16
4: 219
Right 1073466382 10:103696780-103696802 AGCCATTCATTCTCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073466377 Original CRISPR AGCTGTTTTAGGACACAGCT TGG (reversed) Intronic
902231425 1:15030046-15030068 AGCTGGTTAATGGCACAGCTGGG - Intronic
903726922 1:25454936-25454958 AGCTGTCAGAGGACAGAGCTGGG - Intronic
903811854 1:26039048-26039070 ACCTGGTTTACAACACAGCTGGG + Exonic
907601757 1:55778748-55778770 AGCTGTCTTGGGCCACAGGTTGG - Intergenic
907632357 1:56095402-56095424 AGCTCCTTTAGGACTCATCTCGG + Intergenic
909126254 1:71673676-71673698 ATCTGTTTTAGGACACTAATGGG + Intronic
909292088 1:73896316-73896338 AGCACTTTTAGGATGCAGCTGGG - Intergenic
909747736 1:79119523-79119545 AGCTGTCCTAGGCCACAGATTGG + Intergenic
910292537 1:85613398-85613420 AGCTGGTTAATGACAGAGCTGGG + Intergenic
910726284 1:90343203-90343225 ACCTGTTTTAGATCATAGCTAGG - Intergenic
910862934 1:91760632-91760654 AGCTATTTCTGCACACAGCTAGG + Intronic
911680866 1:100713658-100713680 AGCTGTTCTGGGCCACAGATTGG + Intergenic
912326784 1:108771287-108771309 AGTTGTTTCAGGAAACAGCATGG + Intronic
912835273 1:112990875-112990897 ATCAGTTTTAAGACACATCTTGG + Intergenic
916077057 1:161207384-161207406 AGCTGGTTCAGCAGACAGCTAGG + Intronic
917948428 1:180002167-180002189 AGCTGCTTTAGAAAACAGTTTGG + Intronic
918550673 1:185738631-185738653 AGCTGCTTTGGAAAACAGCTTGG - Intronic
918821649 1:189264203-189264225 AGCTGTCTTAGGAAAAAGCACGG - Intergenic
919647604 1:200110982-200111004 AGTTTTTTTAGGACACACGTAGG - Intronic
920435133 1:205942524-205942546 AGCTTTGTTAGGTCTCAGCTGGG + Intronic
921576786 1:216844519-216844541 AGCTGCATGAGGACACAGCCTGG - Intronic
922120517 1:222662963-222662985 CACTGTTTAAGGACACTGCTGGG - Intronic
922439835 1:225645594-225645616 AGCTGCTTTAGAAAACAGTTTGG - Intronic
923361815 1:233219156-233219178 GGCTGTTTTAGGATAGAGATAGG + Intronic
1063734072 10:8732628-8732650 AGCTCCATTAGTACACAGCTGGG + Intergenic
1064182413 10:13129694-13129716 GGCAGTTTTAGAAGACAGCTTGG - Intronic
1065998279 10:31080140-31080162 AGCTGTGTTAGGTCACAGTGGGG - Intergenic
1067498137 10:46776961-46776983 AAGTGTTTTTGGACATAGCTTGG - Intergenic
1067596506 10:47563454-47563476 AAGTGTTTTTGGACATAGCTTGG + Intergenic
1067776894 10:49170639-49170661 GGCTGTTTGAGTGCACAGCTGGG - Intronic
1068401582 10:56534456-56534478 ATCTCTTTTAGGACAAAGATTGG + Intergenic
1070108411 10:73459099-73459121 AGCTGTTTTGGAAAACAGTTTGG + Intronic
1070139860 10:73731024-73731046 AAGTGTTTTTGGACATAGCTTGG + Intergenic
1070443835 10:76474787-76474809 AGCTGCTTTGGAAAACAGCTTGG + Intronic
1071615952 10:87076784-87076806 AAGTGTTTTTGGACATAGCTTGG - Intronic
1072765810 10:98094263-98094285 AGCTGTTATTGGCCACAGTTAGG - Intergenic
1073466377 10:103696742-103696764 AGCTGTTTTAGGACACAGCTTGG - Intronic
1074009738 10:109465673-109465695 GTCTGTTTTAGGACATAGCAAGG + Intergenic
1074873490 10:117595979-117596001 AGCCCTGTTAGCACACAGCTTGG + Intergenic
1076720599 10:132390920-132390942 AGATGCATCAGGACACAGCTCGG + Intergenic
1079066014 11:17293462-17293484 AGCTGCTTTAGAAAACAGTTTGG + Intronic
1079100206 11:17536591-17536613 AGCTGTCTCAGGAGACAGGTAGG - Intronic
1079222953 11:18580269-18580291 AGCTGCTTTGGGAAACAGCCTGG + Intronic
1079869139 11:25774217-25774239 AGGTGTTTTAGGAAACAGTCTGG - Intergenic
1083194039 11:61072395-61072417 AGCTCTCTTTGGGCACAGCTTGG + Intergenic
1083422694 11:62564085-62564107 AGTTCTTTTAAGACCCAGCTAGG - Intronic
1088531996 11:110820484-110820506 AGCTGCTTTAGAATACAGCCTGG - Intergenic
1089324332 11:117647068-117647090 AGCTTGTTAAGGACACAGGTGGG + Intronic
1091932096 12:4404282-4404304 AGATGTATTAGGAAACACCTGGG + Intergenic
1092650041 12:10624886-10624908 AGCTGTCTGAGATCACAGCTTGG + Intronic
1099149141 12:79087080-79087102 AGCTGTGTTAGTACACAATTCGG + Intronic
1100526119 12:95421097-95421119 AGCTGTTTTGGAAAACAGTTTGG - Intergenic
1100647020 12:96542285-96542307 AGCTGAAGTAGGACAGAGCTTGG - Intronic
1101932728 12:109027966-109027988 AGCTGCTGTAGAAAACAGCTTGG - Intronic
1102214261 12:111149190-111149212 AGCTGTCCTAGGCCACAGGTTGG - Intronic
1102329211 12:112014483-112014505 AGCTGTTGTAGGAAACATCTTGG + Intronic
1102484899 12:113248935-113248957 AGCTGTTTTGGGCCACAGTGTGG + Intronic
1102614925 12:114145275-114145297 AGCTTTCTTAGGACCCATCTGGG - Intergenic
1104065674 12:125303558-125303580 AGCTGCTGTAGGAAACAGTTTGG - Intronic
1106918023 13:34536256-34536278 AGCTTATTTATGACACAACTAGG + Intergenic
1107026786 13:35809956-35809978 AGCAGTTTCAGTCCACAGCTGGG - Intronic
1107543862 13:41418350-41418372 TGGTGTTTTATCACACAGCTGGG + Intergenic
1112616194 13:101008150-101008172 AGCTGTATTAGAAAATAGCTGGG + Intergenic
1112721902 13:102254924-102254946 GACTATTTTAGGAAACAGCTAGG + Intronic
1112931021 13:104738357-104738379 AGGAGTTTTAATACACAGCTTGG - Intergenic
1113181615 13:107634899-107634921 AACTGTTTTAGGAAAGTGCTAGG + Intronic
1114845948 14:26322057-26322079 AGTAGTTTGAGGACAGAGCTTGG + Intergenic
1117422523 14:55560931-55560953 GACTGTTTTAGGGCACAGGTAGG + Intronic
1117709362 14:58508869-58508891 ATGTGTTCTAGGGCACAGCTTGG - Intronic
1118136681 14:63036112-63036134 AGCTGTTTTAGGAACGAGCAAGG + Intronic
1119595236 14:75926729-75926751 AGCTGGTTTAGAAAACAGTTTGG + Intronic
1122186094 14:99997436-99997458 AGGTGTCTTATGCCACAGCTGGG + Intronic
1125516918 15:40326018-40326040 AACTGTTTCAGGACTCAGGTGGG - Intergenic
1125540039 15:40464944-40464966 ACCTCTTTTAGCACACAGCTTGG - Intronic
1126858724 15:52863471-52863493 AGCTTTATTGGAACACAGCTAGG - Intergenic
1126914881 15:53455301-53455323 ATCTGTTTTAAAACGCAGCTTGG - Intergenic
1127471646 15:59295665-59295687 AGTTGTTTTAGGACTCTCCTGGG - Intronic
1127475827 15:59332116-59332138 AGTTGTTTTAGGACACAAAATGG - Intronic
1127890752 15:63248552-63248574 AGCTGTTTAGTGGCACAGCTGGG + Intronic
1128365590 15:66999298-66999320 AGCTGCTTTGGGAAACAGTTGGG + Intergenic
1128547319 15:68577181-68577203 AGGTGTCTTAGGACATAGGTAGG - Intergenic
1129776350 15:78239172-78239194 AGCTGGATTAGGACAAACCTGGG + Intronic
1133255567 16:4513919-4513941 CACTGTTTTGGGACACAGATGGG + Intronic
1134765516 16:16754208-16754230 AGCTGTCTTGGGCCACAGGTTGG + Intergenic
1134980534 16:18605004-18605026 AGCTGTCTTGGGCCACAGGTTGG - Intergenic
1137065906 16:35843117-35843139 AGTTATTTGAGGACCCAGCTTGG - Intergenic
1137689686 16:50414283-50414305 AGCTGCTGTGGGAAACAGCTTGG - Intergenic
1139791115 16:69436188-69436210 GGCTGTTTTAGAACACAGCATGG - Intronic
1140279358 16:73540997-73541019 TGCTGTTTCTGGAAACAGCTGGG - Intergenic
1140558917 16:75954560-75954582 AGATGTTTTAGAAGAGAGCTGGG + Intergenic
1141591617 16:85073067-85073089 AGCTGGGTTATGACACGGCTGGG - Intronic
1142877919 17:2863451-2863473 AGCTGTCTCAGGACACACATGGG - Intronic
1143054201 17:4150561-4150583 CACTGCTTTAGGACACAGTTTGG - Intronic
1143650835 17:8263571-8263593 AGCTCTTTTAGGACATTGCCTGG - Exonic
1146196951 17:30821428-30821450 AGTTGTTTTAGAATATAGCTAGG - Intronic
1146741385 17:35286871-35286893 AGCAGTTTTGGGAAACAGCCAGG - Intergenic
1147422451 17:40328986-40329008 AGCTGTTTTGGAAAACAGTTTGG - Intronic
1148700218 17:49582489-49582511 GGTTCTTTAAGGACACAGCTTGG + Intronic
1149018462 17:51935796-51935818 AGCTGTTTAATAACACACCTTGG + Intronic
1149340436 17:55680466-55680488 CTCTGTTTTAGGCCACAACTCGG + Intergenic
1149645913 17:58241629-58241651 AGCTGTTTGAGAACTCATCTTGG + Intronic
1150513595 17:65783357-65783379 AGCTGTTGTAGAAAACAGTTTGG + Intronic
1151826590 17:76527370-76527392 GTCTGTTTAATGACACAGCTGGG + Exonic
1151976045 17:77483991-77484013 CGCTGAGTTAGGACAAAGCTGGG - Intronic
1152014833 17:77743778-77743800 AGCTGCAGTAGGACACAGCATGG + Intergenic
1155815729 18:30306886-30306908 AGTTGTTTTAAGACTCAACTAGG + Intergenic
1156299693 18:35825644-35825666 AGCTGTTTTAAATCACAGTTGGG - Intergenic
1156847538 18:41684634-41684656 AGCTGTTTTAGGAAAATGGTTGG + Intergenic
1161903303 19:7135998-7136020 AGCTGCTTTAGGAAAGAGTTTGG - Intronic
1163621849 19:18365642-18365664 AGCTGTTTTAAGAAAGAACTGGG - Exonic
1166661360 19:44649381-44649403 AGCTGCTCAGGGACACAGCTGGG + Intronic
1168216580 19:54930502-54930524 AGGTGTTTTAGGTTACAGTTTGG + Exonic
925543957 2:4998663-4998685 AGCTGCTTTAGTAGACAGTTTGG + Intergenic
925733383 2:6939156-6939178 AGCTGCTTTAGGAAATAGTTTGG - Intronic
930810922 2:55539694-55539716 AGCCGCTTTAGAACACAGTTTGG - Intronic
930843678 2:55877579-55877601 ATGTGTTTTAAGACACAGATTGG + Intronic
933262483 2:80146138-80146160 TGCTGTTTGAAGAGACAGCTAGG - Intronic
933776694 2:85775368-85775390 AGGGGCTTTAGGACACAGCTAGG + Intronic
935422673 2:102886419-102886441 AGCTGTGCTAGCACACTGCTAGG - Intergenic
936155830 2:110047007-110047029 AGCTGTTCTAGGACACCGCAGGG + Intergenic
936188858 2:110324421-110324443 AGCTGTTCTAGGACACCGCAGGG - Intergenic
939768533 2:146285273-146285295 AGCTGTTTTGGAAAACAGTTTGG - Intergenic
940019205 2:149139352-149139374 AGCTTGATTAGCACACAGCTTGG + Intronic
940295737 2:152122133-152122155 AGCGGTTTTAGGGCTGAGCTTGG + Intronic
940357020 2:152754636-152754658 AGCTGCTGTAGGAAACAGTTTGG - Intronic
942397580 2:175567936-175567958 AGCTGATCTAAGTCACAGCTAGG - Intergenic
942442651 2:176052210-176052232 AGCTCTTTTAGGAAAGAGGTTGG - Intergenic
943894011 2:193330088-193330110 AGCTTTGTTAGGAATCAGCTTGG + Intergenic
944303389 2:198151177-198151199 AGCTGCTTTGGAAAACAGCTTGG + Intronic
946149688 2:217755901-217755923 AGCTGTATTATGACAAAGCTGGG + Intronic
1168918925 20:1515075-1515097 AGCTGTTTTGGGAAACAGATTGG - Intergenic
1171510815 20:25683174-25683196 AGCAGTTTTAGTTCACAGTTAGG - Intronic
1173898331 20:46567927-46567949 AGCTGATCTAGGGCAGAGCTGGG + Intronic
1174456580 20:50652858-50652880 AGCTGCTTTGGAAAACAGCTTGG + Intronic
1175667246 20:60871021-60871043 AGCTGCCTCAGCACACAGCTGGG + Intergenic
1176130984 20:63496768-63496790 CGCTGTTTCAGGCCCCAGCTGGG - Intronic
1177645386 21:23894104-23894126 AGGTAATTTAGAACACAGCTTGG - Intergenic
1177929772 21:27266595-27266617 AGCGGTTTCTGGAGACAGCTAGG + Intergenic
1179973503 21:44849408-44849430 CACAGTTTTAGGACACAGCCTGG + Intergenic
1182020257 22:27075725-27075747 AGTTGTTTTGGGACAGAGCCTGG + Intergenic
1182756563 22:32684511-32684533 TGCTGTTTTAGAAAAGAGCTTGG - Intronic
1183168414 22:36165540-36165562 AGCTGTTTTAGGACCAAGAAAGG - Intronic
949297289 3:2540327-2540349 AGCTGTTTGGAGACTCAGCTGGG - Intronic
949860418 3:8500242-8500264 AGGTGTTTGAGGACATAGCTGGG + Intergenic
951141973 3:19173112-19173134 AGCAGTTTTTGGACAGAGCCTGG - Intronic
951541631 3:23787532-23787554 AGCTGTTTTAGAATTCAGATGGG - Intergenic
951813731 3:26729827-26729849 AGCTCTTTTAGGGCAGACCTAGG + Intergenic
954296696 3:49678307-49678329 AGCTAATTTAGGGCAGAGCTGGG - Intronic
955173799 3:56591564-56591586 AGCTGTCTTGGGCCACAGGTTGG + Intronic
955973600 3:64460273-64460295 ACCTGTTTTAGGAAATACCTGGG - Intergenic
955973628 3:64460557-64460579 AACTGTTTTTGCAGACAGCTGGG - Intergenic
956130865 3:66052764-66052786 AGCTGTTCTTGGAAACAGGTTGG - Intergenic
956149991 3:66230877-66230899 AGAAGTTTTAGGAAACAACTGGG + Intronic
956531047 3:70219149-70219171 AGGTGTTTTAGAAGAAAGCTAGG - Intergenic
964560072 3:157984955-157984977 AGCTGTTTTAGAAAACAGTTTGG - Intergenic
964974073 3:162599247-162599269 AGCTGCTTTAGAACACAGTTTGG + Intergenic
965965979 3:174489970-174489992 AGCTGTTTTGGAAAACAGTTGGG + Intronic
970113176 4:12661718-12661740 AACTATATTAGAACACAGCTTGG - Intergenic
972487866 4:39559465-39559487 AGCTGTTTTAGTAATCACCTAGG - Intronic
974293886 4:59969181-59969203 TGGTGTCTTATGACACAGCTGGG + Intergenic
976396668 4:84563193-84563215 AGCTATTATGAGACACAGCTTGG + Intergenic
977390269 4:96400356-96400378 AGCTGTTTTGGAAAACATCTTGG + Intergenic
982620122 4:157693449-157693471 AGCTCTTTTAGGACAGGCCTGGG - Intergenic
990218926 5:53565167-53565189 TGCTGTTTTAGCCCACATCTTGG + Intronic
991366107 5:65869821-65869843 AGCTGCTTGATGACAGAGCTGGG - Intronic
993069575 5:83143302-83143324 AGCTGTTTTACTACACATTTTGG - Intronic
997487301 5:134242221-134242243 AGCTGTCTAGGGACTCAGCTGGG + Intergenic
998512689 5:142726665-142726687 AGCTGTTTTAGAAAACAGTTTGG - Intergenic
1002132076 5:177087676-177087698 AGCTCTTTGGGTACACAGCTTGG - Intronic
1004297486 6:14426653-14426675 TGCTGATTTTGGACACAGGTAGG - Intergenic
1007985536 6:46204044-46204066 GGCTGTGTGAGGAAACAGCTAGG - Intergenic
1011186876 6:84687271-84687293 AGCTGTTTAAATAGACAGCTTGG - Intergenic
1013034721 6:106370252-106370274 TGCTTTTTTCTGACACAGCTTGG - Intergenic
1014782432 6:125579901-125579923 AGCTGATCTATTACACAGCTAGG - Intergenic
1018811604 6:167302166-167302188 TGCTGTTTCTGCACACAGCTTGG + Intronic
1019162017 6:170075383-170075405 CACTGTTTTCGGACACAGCCAGG - Intergenic
1019177584 6:170168039-170168061 AGCAGTTGTAGGTCACAGCAAGG - Intergenic
1019634844 7:2070031-2070053 TGCTGTCTGAGGAGACAGCTTGG - Intronic
1020469775 7:8522956-8522978 AGCTGGTATATGACAGAGCTGGG - Intronic
1020942199 7:14554179-14554201 ACATGTTTTAGGAGACAGCTAGG + Intronic
1021783127 7:24126038-24126060 AGCTGAGTTAGGAAACTGCTTGG - Intergenic
1022341378 7:29471757-29471779 AGCAGTTTTAGGACTGAGCCAGG + Intronic
1023645154 7:42304089-42304111 GGCTGTTATAGGAAACAGCTAGG + Intergenic
1023758436 7:43441563-43441585 CTCTGTTTTAGAACACAGGTTGG + Intronic
1024084466 7:45881947-45881969 AGCTGATGAAGGACACTGCTTGG - Intergenic
1024565441 7:50676374-50676396 ATCTGCTTTATAACACAGCTTGG + Intronic
1025761325 7:64397873-64397895 AGCTGTTTTATGTCACAGAATGG - Intergenic
1026822679 7:73560057-73560079 AGCTGTTTCAGGACACAGCTTGG + Intergenic
1027122928 7:75534977-75534999 AGCTATTTAATGACACACCTTGG - Exonic
1027527456 7:79288173-79288195 AGCTGCTTTGGGACAGAGCCAGG - Intronic
1028155339 7:87422879-87422901 CGCTGTTTGAGGGCACAACTTGG + Intronic
1028451210 7:90985389-90985411 AGTTCTTTTAGGACTCTGCTTGG + Intronic
1030976650 7:116132710-116132732 AAATGTTTTAGGAGACACCTCGG + Intronic
1031145532 7:117993625-117993647 AGCTTTTGAAGGACACAGCAAGG + Intergenic
1032808390 7:135382088-135382110 AGCTGTTTTATGGAACATCTGGG + Intronic
1033640237 7:143256429-143256451 AGCTGTTATAGAAAACAGCATGG + Intronic
1034284911 7:149878352-149878374 AGGTGTGTGAGGGCACAGCTGGG + Intronic
1036952656 8:13156230-13156252 AGTTGCTATAGGACTCAGCTTGG - Intronic
1038389006 8:27177446-27177468 AGCTGCTTTAGAAAACAGCCTGG + Intergenic
1038521843 8:28240231-28240253 AGCTATTCTAGCAGACAGCTTGG + Intergenic
1041340211 8:56837553-56837575 AGCTGTTGATGCACACAGCTTGG - Intergenic
1042454738 8:68988044-68988066 AGCTCTATAAGGACACAGGTAGG - Intergenic
1042839999 8:73114063-73114085 AGCTGTTGTAGAAAACAGTTTGG - Intronic
1042951085 8:74201397-74201419 AGCTGTTTGATGACAGGGCTGGG - Intergenic
1046744902 8:117866374-117866396 AGCTGGTGAAGGACACAGCCAGG + Intronic
1046937250 8:119896368-119896390 TGATGGTTGAGGACACAGCTGGG + Intronic
1049273405 8:141707958-141707980 AGCTCCTTAAGGACACAGCTGGG - Intergenic
1049931006 9:456670-456692 AGCTGATTGAGGTCCCAGCTTGG - Intronic
1052550855 9:29946815-29946837 AGCCTTTTTGGAACACAGCTCGG - Intergenic
1052876272 9:33568367-33568389 AGCTATTTTAGAAGGCAGCTAGG + Intronic
1053499744 9:38575980-38576002 AGCTATTTTAGAAGGCAGCTAGG - Intronic
1055224516 9:73978780-73978802 AGCTGCTTTGGAAAACAGCTTGG + Intergenic
1057039000 9:91833852-91833874 AGCTGTTTTCAGACACAGTGAGG - Intronic
1057564127 9:96153325-96153347 AGCTGTTTTGGAACCCAGGTTGG - Intergenic
1057679170 9:97160684-97160706 AGCTATTTTAGAAGGCAGCTAGG - Intergenic
1057726649 9:97572810-97572832 AGCTGGCTCAGGACACAGTTTGG + Intronic
1058150784 9:101461267-101461289 AGCTCTTTTAGGTCACAGTTAGG - Intergenic
1059980260 9:119763777-119763799 AACTCTTTAAGGACAAAGCTGGG - Intergenic
1060460269 9:123846260-123846282 AGCTGTTATGGAAAACAGCTTGG + Intronic
1060521591 9:124297149-124297171 AGCTGGTAAATGACACAGCTGGG - Intronic
1061446197 9:130639578-130639600 TGCTGTTTTGGCACAGAGCTTGG - Intergenic
1203369269 Un_KI270442v1:287516-287538 GGCTTTTTTAGGAGATAGCTGGG - Intergenic
1186199242 X:7139696-7139718 AGCTGTTCAAGGACAGAGCAAGG - Intronic
1186199405 X:7141536-7141558 AGCTGTTCAAGGACAGAGCAAGG - Intronic
1186241920 X:7577510-7577532 AGATGTTTCAGCAAACAGCTTGG - Intergenic
1186646324 X:11510986-11511008 AGCTCTTTTTGGAAAGAGCTAGG - Intronic
1186989651 X:15053705-15053727 GGCTGATTTTGCACACAGCTTGG + Intergenic
1192396787 X:70790183-70790205 AGATGGTTCAAGACACAGCTGGG + Intronic
1193940888 X:87679942-87679964 AGCCCATTTAAGACACAGCTTGG + Intergenic
1194375638 X:93129763-93129785 AGCTGCTTTGGAAAACAGCTTGG - Intergenic
1196697393 X:118627759-118627781 AGCTTATTTAGAACATAGCTTGG + Intronic
1196861271 X:120029816-120029838 AGCTATTATAGAAAACAGCTTGG - Intergenic
1198138906 X:133783060-133783082 AGGTGTCCTAGGACTCAGCTTGG + Intronic
1199457708 X:148047679-148047701 AGCAGTTTTAGGTCACCTCTTGG - Intergenic
1201461961 Y:14235690-14235712 AGATGTTTCAGCAAACAGCTTGG - Intergenic
1201759545 Y:17521983-17522005 GGCTGTTTTAGGAGATGGCTGGG - Intergenic
1201842009 Y:18384007-18384029 GGCTGTTTTAGGAGATGGCTGGG + Intergenic