ID: 1073466378

View in Genome Browser
Species Human (GRCh38)
Location 10:103696753-103696775
Sequence GGTCTGATGGGAGCTGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073466378_1073466385 11 Left 1073466378 10:103696753-103696775 CCTAAAACAGCTCCCATCAGACC 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466378_1073466386 12 Left 1073466378 10:103696753-103696775 CCTAAAACAGCTCCCATCAGACC 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1073466386 10:103696788-103696810 ATTCTCTGCAGCTGGTCCAGGGG No data
1073466378_1073466388 28 Left 1073466378 10:103696753-103696775 CCTAAAACAGCTCCCATCAGACC 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1073466388 10:103696804-103696826 CCAGGGGTGACTCAAACCACAGG No data
1073466378_1073466382 4 Left 1073466378 10:103696753-103696775 CCTAAAACAGCTCCCATCAGACC 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1073466382 10:103696780-103696802 AGCCATTCATTCTCTGCAGCTGG No data
1073466378_1073466384 10 Left 1073466378 10:103696753-103696775 CCTAAAACAGCTCCCATCAGACC 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1073466384 10:103696786-103696808 TCATTCTCTGCAGCTGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073466378 Original CRISPR GGTCTGATGGGAGCTGTTTT AGG (reversed) Intronic
900662755 1:3793724-3793746 GGGCTGCGGGGAGCTCTTTTTGG - Intronic
902628288 1:17689417-17689439 GGCTTGATGGGACCTGTGTTTGG + Intronic
903289181 1:22297096-22297118 GGTGTGCTGGGAGCTGGCTTTGG + Intergenic
903943641 1:26948475-26948497 GGTCAGATGGGAGCTGGAGTGGG + Intergenic
904975550 1:34453453-34453475 GGCCTAATGGGAGGTGTTTAGGG - Intergenic
906282862 1:44566054-44566076 GGACTGATAGGAGCTATTTCCGG + Intronic
912558215 1:110531432-110531454 GCTCTAATGGCAGGTGTTTTGGG + Intergenic
912665275 1:111573271-111573293 GGACAAATGGTAGCTGTTTTTGG + Intronic
913616059 1:120560142-120560164 GGCCTGGTGGGAGGTGTTTGGGG + Intergenic
914574219 1:148950756-148950778 GGCCTGGTGGGAGGTGTTTGGGG - Intronic
919941404 1:202288991-202289013 GGTCTGATGGATCCTGTTCTGGG + Intronic
922090802 1:222393419-222393441 GGCCTGATGGGAAGTGTTTGGGG - Intergenic
922226842 1:223652819-223652841 GTTCTGATGTGAGCTGGATTCGG + Intronic
923901490 1:238330570-238330592 TGTCTGATGTGAACTATTTTGGG + Intergenic
1063346789 10:5319126-5319148 GGTGGGTTGGGTGCTGTTTTGGG - Intergenic
1063408969 10:5822009-5822031 GGCCTGGTGGGAGGTGTTTTTGG - Intronic
1065452098 10:25869971-25869993 GGTCTGATGTGGGCTGTTGCTGG - Intergenic
1066796904 10:39132212-39132234 GGACAGTTGGGAGCTGTTTGAGG + Intergenic
1069681428 10:70288371-70288393 GGTTTCCTGGGAGCTGCTTTGGG - Intergenic
1069991088 10:72316636-72316658 GGTCTCACGGGAGCTGCTGTGGG + Intergenic
1072499304 10:95996850-95996872 GGCCTAATGGGAGGTGTTTGAGG + Intronic
1073466378 10:103696753-103696775 GGTCTGATGGGAGCTGTTTTAGG - Intronic
1073471935 10:103727846-103727868 GCTCTGATGGAAGCTGCTCTGGG - Intronic
1074711897 10:116184529-116184551 GGCCTGCTGGGAGTTGGTTTGGG - Intronic
1074854983 10:117466829-117466851 GGTTTGTTGGGTGCTGATTTAGG + Intergenic
1076761873 10:132610110-132610132 GGTTTGTTGGGAGCTGTTGCCGG - Intronic
1076773867 10:132682241-132682263 GTTGTGATGGGAGCTGTTGCTGG + Intronic
1077870858 11:6260212-6260234 GGTGTGAGGGGAGCTGTTTGGGG - Intronic
1078197701 11:9150094-9150116 GGTCTGAGAGGAGCTGCTTCAGG + Exonic
1079223812 11:18588336-18588358 CGTGTGCTGGGAGCTGTTTGAGG + Intronic
1080397481 11:31903219-31903241 GCTGTGAGGGGAGCTATTTTGGG - Intronic
1081814529 11:45931063-45931085 ATTCAGATGTGAGCTGTTTTGGG - Intronic
1081926691 11:46835533-46835555 TGACTGTTGGGAGCTCTTTTTGG - Intronic
1082722557 11:56695921-56695943 AGTCTGATAGGAATTGTTTTTGG + Intergenic
1082889371 11:58122176-58122198 GGGCTCATGGTAGCTGTTCTTGG + Intronic
1087387137 11:97486002-97486024 GGTCAAATGGCAGTTGTTTTAGG - Intergenic
1091240336 11:134047764-134047786 GGTGGGAGGGGAACTGTTTTGGG - Intergenic
1095393147 12:41732781-41732803 GGTCTGGTGGTATCTCTTTTTGG - Intergenic
1096773201 12:53949525-53949547 GATCTGCTGGGATCTGTGTTGGG + Intergenic
1102032584 12:109751343-109751365 CTTCTGATGGGAGGTGTTTTTGG + Intronic
1102459109 12:113089336-113089358 GGACAGATGGGATCTGATTTGGG + Intronic
1102696693 12:114805357-114805379 GGTCTAATGGGAGGTATTTTAGG + Intergenic
1104404526 12:128506505-128506527 GCTCTGGTGGGAGCTATTTGAGG + Intronic
1105939448 13:25134219-25134241 GGCCTAATGGGAGGTGTTTAGGG + Intergenic
1106893986 13:34277915-34277937 GCTCTGATGGAAGCTATTTAGGG + Intergenic
1107128086 13:36865908-36865930 GCTCTCATGGGAGCTGTTTGGGG + Intronic
1111646304 13:91036105-91036127 GGTCTTATGGGAACTGTCATTGG - Intergenic
1112420762 13:99246441-99246463 GGCCTGATAGGAGATGTTTTGGG - Intronic
1113881817 13:113631118-113631140 TGTCTTTTGAGAGCTGTTTTTGG + Intronic
1114918410 14:27296032-27296054 GGCATCATGGGAGGTGTTTTTGG - Intergenic
1116640316 14:47453834-47453856 TGTCTGATGAGATCTGATTTTGG + Intronic
1118410528 14:65472375-65472397 GGCCTAATGGGAGATGTTGTTGG - Intronic
1118457609 14:65958964-65958986 GGTCAGATGGTAACTATTTTAGG - Intronic
1122505701 14:102230527-102230549 GGTCTGATAGGAAATATTTTAGG - Intronic
1123045456 14:105511068-105511090 CGTCTACTGAGAGCTGTTTTAGG + Intergenic
1123887723 15:24743627-24743649 CATCTGATGAGAGCTATTTTAGG + Intergenic
1123893573 15:24805635-24805657 GATCTCATGAGAGCTATTTTAGG + Intergenic
1124086771 15:26558561-26558583 GGCCTGGTGGGAGGTGTATTAGG + Intronic
1124256517 15:28147004-28147026 GCTCTGTTGGGAGCTGATTCTGG + Intronic
1124567713 15:30832089-30832111 GCTCTGTTGGGAGCTGATTCTGG - Intergenic
1125557858 15:40601269-40601291 GGTGTGATGGGGGATGGTTTCGG - Intronic
1126447597 15:48766084-48766106 CTTCTAAAGGGAGCTGTTTTAGG - Intronic
1127832868 15:62766270-62766292 GCTCTGTGGGGAGCTGTTATGGG + Intronic
1128053554 15:64683532-64683554 GGTATGAGGGAGGCTGTTTTGGG - Exonic
1132221905 15:100111288-100111310 GGTCTGATGGGAGCTGTCGGAGG + Intronic
1132546245 16:534699-534721 GGTCTGGTGGGTGCAGTTTTAGG + Intronic
1134064416 16:11218383-11218405 GGTCCTCTGGGAGCTATTTTTGG + Intergenic
1136582334 16:31160595-31160617 CTTCTGAGGGGAGCAGTTTTGGG + Intergenic
1136641794 16:31571351-31571373 GGTCTGGTAGGATTTGTTTTAGG - Intergenic
1139484621 16:67248703-67248725 GATCTGGTGGGGGCGGTTTTGGG + Intronic
1139502900 16:67382493-67382515 GATCTGATGGGACCTTTGTTTGG + Intronic
1143740023 17:8945674-8945696 GGTGGGATGGGAGCTATTGTTGG - Intronic
1144409010 17:14981784-14981806 GGTCTGATTGGAGTTGATTCCGG + Intergenic
1146788861 17:35740331-35740353 CCTCTGATGGGAGGTGTTTGGGG + Intronic
1147486723 17:40822382-40822404 GCTCTGGTGGGGGCTGCTTTGGG - Exonic
1148436881 17:47692404-47692426 GGTCTTATGGGTCCTGTTTGTGG + Intergenic
1150331321 17:64296696-64296718 GAGCTCATGGGAGCTGTCTTGGG - Intergenic
1152152295 17:78609793-78609815 GTTCTGTTGGCAGCTGTATTTGG - Intergenic
1152242889 17:79169427-79169449 GGTCTTGTGGGAGCAGTTTGAGG - Intronic
1152390463 17:80001179-80001201 GGTCTGAGGGAAGCTGTTACGGG - Intronic
1152409982 17:80118267-80118289 GGCCCGAGGGGAGCTGTTCTGGG + Intergenic
1152642284 17:81454250-81454272 GATCAGGTGGGACCTGTTTTGGG + Intronic
1153965871 18:10181782-10181804 CCTCTGATGTGAGCTGTTTATGG + Intergenic
1155508296 18:26551188-26551210 CGTCAACTGGGAGCTGTTTTGGG - Intronic
1157342602 18:46792473-46792495 GGCCTGATGGGAAATGTCTTGGG + Intergenic
1160932949 19:1579220-1579242 GGGCTGATGGTAGCTGATTTTGG - Intronic
1161898130 19:7097972-7097994 GATCTGATTGTAGCTGTTTGAGG - Intergenic
1161936353 19:7374765-7374787 GGTCTGATGGGTGCTGATCGTGG - Intronic
1163785093 19:19270898-19270920 AGTCTGATGGGAGCTCTTAAAGG + Intronic
1163848691 19:19651621-19651643 GTTGCGATGGGAGCTGTTCTTGG + Intronic
1164453663 19:28388719-28388741 GGGCTGGTGGGAGATGTTTGGGG + Intergenic
1164620465 19:29692916-29692938 GCTGTGCTGGGGGCTGTTTTGGG - Intergenic
1164752055 19:30664366-30664388 GGGCTGATGGACGCTGATTTAGG + Intronic
1166680369 19:44762475-44762497 GGCCTGATGTGAGGTGTGTTTGG - Intergenic
928996196 2:37293993-37294015 GATCTTATGGGATGTGTTTTAGG + Intronic
929420620 2:41785947-41785969 GGGCTGCAGGGAGCTGTCTTTGG - Intergenic
929709904 2:44256220-44256242 GGCCTAATGGGAGGTGTTTCTGG - Intergenic
933649900 2:84842191-84842213 TGTCTGATTGGGGCTGATTTGGG - Intronic
934166972 2:89302664-89302686 GGAATAATGGGAGTTGTTTTGGG + Intergenic
934200306 2:89879790-89879812 GGAATAATGGGAGTTGTTTTGGG - Intergenic
937028754 2:118720757-118720779 GCTCTGACAGGAGCTGTTGTAGG - Intergenic
938885087 2:135637847-135637869 GGTCAGATAATAGCTGTTTTAGG + Intronic
938954277 2:136283826-136283848 GTTCTGATTGAAGATGTTTTAGG + Intergenic
940175671 2:150875007-150875029 GGTCTGCTTGGAACTTTTTTGGG - Intergenic
940742584 2:157526432-157526454 AGTGTAATGGGAGCTATTTTAGG + Intergenic
943734719 2:191341640-191341662 GGTCTGCTGGGAGGTATTCTGGG + Intronic
944873265 2:203935322-203935344 GGTGTGAAGGAAGCTGTTTGAGG - Intergenic
944931835 2:204527980-204528002 GGCCTGGTGGGAGGTGTTTGGGG - Intergenic
945780559 2:214166456-214166478 GGCCTGATGGGAGCTGTAGCTGG - Intronic
946055161 2:216894825-216894847 CTTGGGATGGGAGCTGTTTTGGG + Intergenic
946317345 2:218925568-218925590 GGACTGATGGGAGCATGTTTGGG + Intergenic
948309949 2:236977629-236977651 AGTGTGATATGAGCTGTTTTAGG + Intergenic
948931152 2:241133293-241133315 AGTCAGATGGGAGCTGTTGGAGG - Intronic
1168776401 20:451619-451641 GATGTGATGGGTGCTGCTTTGGG - Intronic
1169027846 20:2385248-2385270 AGGGTGATGGGAGCTGCTTTGGG + Intronic
1170696556 20:18664582-18664604 GGGGTGATGGGGGCTGATTTGGG + Intronic
1172453483 20:35046809-35046831 GGGGTGGTGGGACCTGTTTTGGG - Intronic
1174919976 20:54691403-54691425 GATCTGTTGTGAGCTATTTTTGG + Intergenic
1175261811 20:57679459-57679481 GGTCTGATGTGTGCCGTGTTTGG - Intronic
1175321038 20:58088553-58088575 AGTCTGATGGTAGCTTTTCTGGG + Intergenic
1178148712 21:29769442-29769464 GGGGTGGTGGGAGCTGGTTTTGG + Intronic
1178384280 21:32136915-32136937 GGTCCAATAGGAGCTGTTTGGGG - Intergenic
1179016788 21:37600781-37600803 TGTCTGCTTGCAGCTGTTTTGGG + Intergenic
1180733208 22:17997527-17997549 GGTCTGATGGGAGGTGGGGTTGG - Intronic
1183684073 22:39351382-39351404 CGTCAGATGGGAGCTGTTTGAGG + Intronic
1185277307 22:49955337-49955359 GGTCAGATGTGAGCTGTTGAGGG + Intergenic
950030799 3:9851888-9851910 GCACTAATGGGAGCTGCTTTAGG - Intronic
950438170 3:12993062-12993084 GGTGTAATGGGGGCTGTTGTTGG - Intronic
955302971 3:57800895-57800917 GGTCTCCTGGGAGCTGGTATTGG - Intronic
955544938 3:60018316-60018338 GGTCTAATGGGAAGTGTTTGGGG - Intronic
956928876 3:74020102-74020124 GGTCAGATGGGAAATGTTTTAGG - Intergenic
962402129 3:135069456-135069478 GTACTGATGGGAGCTGTCCTAGG + Intronic
963238476 3:142979242-142979264 GGCCTACTGGGAGATGTTTTGGG + Intronic
964968378 3:162527194-162527216 GGCCTGTTGGGAACAGTTTTGGG - Intergenic
966200473 3:177356145-177356167 GGCCTGATGGGAGGTGTTTGGGG - Intergenic
968566235 4:1314949-1314971 GGGCTGGTGGCAGCTGTGTTGGG + Intronic
968953289 4:3705737-3705759 CGTCAGATGGGAGCTGCTTCCGG - Intergenic
969522391 4:7686192-7686214 GGTGTGATCAGATCTGTTTTAGG + Intronic
975351344 4:73350784-73350806 GGCCTGATGAGAGATGTTTTGGG - Intergenic
976868491 4:89761241-89761263 GGTCTCATGGGAACTGATATGGG - Intronic
977262691 4:94817121-94817143 GGGCTGATGAGAGCTGCTCTTGG - Intronic
981172968 4:141646122-141646144 TGACTGATGGCAGCTGTCTTTGG + Intronic
985634611 5:1029970-1029992 GGTCTGATGGGAGGTGAACTGGG + Intronic
986493976 5:8323091-8323113 GCTCAGATTAGAGCTGTTTTAGG - Intergenic
986524212 5:8655474-8655496 GTTCTGATGAGAGCCTTTTTAGG - Intergenic
986952290 5:13103339-13103361 GGTTTGATAGGGGCTGCTTTTGG + Intergenic
990130357 5:52574623-52574645 GGCCTAAAGGGAGCTGTTTTGGG + Intergenic
992120557 5:73587775-73587797 GGTCTGAGGAGAGGTCTTTTAGG + Intergenic
995135457 5:108675296-108675318 GGGTTGATGGGAACTCTTTTTGG + Intergenic
996793578 5:127319479-127319501 GCTGTGCTGGGTGCTGTTTTAGG + Intronic
997517684 5:134502529-134502551 GGTCAGATGGTAGATCTTTTTGG + Intergenic
999867014 5:155711645-155711667 TGCCTGATGGGAGGTTTTTTGGG + Intergenic
1001492326 5:172164692-172164714 GCTCTGATGAGAGCCGTCTTAGG + Intronic
1003110464 6:3248554-3248576 GGCCTGTTTGGAGCTGATTTCGG + Intronic
1005295137 6:24418528-24418550 GGACTAATGGGAGTTGCTTTTGG + Exonic
1008923649 6:56869143-56869165 GATCTGAGGGGACCTATTTTGGG + Intronic
1009357589 6:62770478-62770500 GTTCTGATGAGAGCTCTTTCTGG - Intergenic
1009392475 6:63161072-63161094 AGGCTGATGGGAGATGTATTAGG - Intergenic
1009625381 6:66133956-66133978 GGCCTGGTTGGAGGTGTTTTTGG - Intergenic
1010085938 6:71918103-71918125 GGTCAGATTGTAGATGTTTTAGG + Intronic
1010430122 6:75769122-75769144 GACCTGATGGGAGGTGTTTCAGG - Intronic
1010844118 6:80683809-80683831 GGCCAGCTGGGAGCTGTCTTTGG + Intergenic
1012165315 6:95942415-95942437 TGTCTGACGGGAGTTATTTTGGG + Intergenic
1015407566 6:132855040-132855062 GGCCTAATGGGAGGTGTTTGGGG + Intergenic
1017090602 6:150755470-150755492 GGTCAGATTGGAGCCTTTTTGGG - Intronic
1018716997 6:166541099-166541121 TGCATGATGGGAGCTATTTTGGG - Intronic
1018901372 6:168053485-168053507 GGTCTGCTGGGAGACGTTTCGGG - Intergenic
1019035024 6:169047460-169047482 GGTGTGATGGGCACTGATTTGGG + Intergenic
1019163349 6:170083468-170083490 CATCTGATGGGAACTATTTTGGG + Intergenic
1021612798 7:22474537-22474559 GGTCTGTTGACAGCTCTTTTAGG + Intronic
1022379045 7:29842711-29842733 AGTCTCATGAGAGCTTTTTTTGG + Intronic
1022516555 7:30978353-30978375 GGTGTGAAGGGAGCTGTCTTGGG + Intronic
1023912803 7:44567449-44567471 TGTCTCATAGGAGGTGTTTTTGG - Intronic
1023938888 7:44757711-44757733 GGTCTGAGGGGAGAGGTTTCTGG + Intronic
1024574455 7:50752826-50752848 GTTCTCATGGGAGAAGTTTTAGG - Intronic
1029513641 7:101012597-101012619 GGGCTGTTGGGAGCAGCTTTGGG - Intronic
1029704484 7:102268891-102268913 GGCCTGGTGGGAGGTGTTTGGGG - Intronic
1032138593 7:129305950-129305972 GGTCTGCTGGCAGATGTATTTGG + Intronic
1033805627 7:144951579-144951601 GGTCTTGGAGGAGCTGTTTTGGG + Intergenic
1034203850 7:149299028-149299050 GCTCTGATGGCAGCTGGCTTGGG + Intergenic
1034413408 7:150952955-150952977 ATTCTGATGGAAGCTTTTTTTGG - Intronic
1037563578 8:20096905-20096927 GATCTGATGGCAACAGTTTTAGG - Intergenic
1037654572 8:20872135-20872157 GCTGTGATGGCAGCTGTTCTGGG - Intergenic
1038368730 8:26965736-26965758 TGTCTGATGGGTGATTTTTTAGG - Intergenic
1039626148 8:39056493-39056515 GGTATGATGGGAGTTGTTAAGGG - Intronic
1041169478 8:55126642-55126664 AGTCTGATGGGAACTTTTTATGG - Intronic
1043608897 8:82037067-82037089 GCCTTGATGGGAGTTGTTTTAGG + Intergenic
1045238131 8:100374190-100374212 GGCCAGATGGGAACTATTTTAGG + Intronic
1047497735 8:125420384-125420406 GGTCTCAGGGGAGCATTTTTGGG + Intergenic
1049795983 8:144497469-144497491 CGTCTGCTGGGAGCTGCTCTGGG - Intronic
1049852038 8:144837888-144837910 GGTCTGAAGGGAGCTGCCTCAGG - Intronic
1050207498 9:3212627-3212649 GGCCTGATGGGAGGTGTTTGGGG + Intergenic
1052013541 9:23439376-23439398 AGTCTGATAGGAGATGTTTTGGG - Intergenic
1052181570 9:25534864-25534886 GGTCTGATGGTAATTATTTTGGG - Intergenic
1056876535 9:90338661-90338683 GGCCTAATGGGAGGTGTTTAGGG + Intergenic
1057026386 9:91736932-91736954 GGCCTGATTGCAGCTGTTTTGGG - Intronic
1059846876 9:118289638-118289660 GGTGTGTTTGGGGCTGTTTTGGG - Intergenic
1059857654 9:118417934-118417956 GTTCTGATGGGAGCTCTGCTGGG + Intergenic
1061693517 9:132354636-132354658 GGTCTCGTGTGAGCTGTTTTTGG - Intronic
1186035328 X:5416084-5416106 GGTCTGTTGGGACCTGGTATAGG + Intergenic
1187123424 X:16431007-16431029 GGCCTAATGGGAAATGTTTTAGG + Intergenic
1187532684 X:20111131-20111153 GGTCTGCTGGGAGCTCAGTTGGG - Intronic
1189516118 X:41714997-41715019 GGTCAGTTGAGAGCTGTTTACGG - Intronic
1189787153 X:44569347-44569369 GGCCTGTAGGGAGCTGTCTTTGG - Intergenic
1196370433 X:114972888-114972910 GGTCAGATGGTAACTATTTTTGG - Intergenic
1198115725 X:133543084-133543106 GGTCTAATGGGACTTCTTTTGGG + Intronic
1198688187 X:139250259-139250281 GGTCTAATGGGTGGTGTTTGGGG - Intergenic
1200013548 X:153140209-153140231 GGTTTGATGGCAGAAGTTTTGGG + Intergenic
1200019994 X:153195263-153195285 GGTTTGATGGCAGAAGTTTTGGG + Intergenic
1200026053 X:153259709-153259731 GGTTTGATGGCAGAAGTTTTGGG - Intergenic
1201635901 Y:16122947-16122969 GGTCTGTTGGGACCTGGTATAGG - Intergenic