ID: 1073466379

View in Genome Browser
Species Human (GRCh38)
Location 10:103696765-103696787
Sequence GAATGGCTGAGTGGTCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073466379_1073466384 -2 Left 1073466379 10:103696765-103696787 CCCATCAGACCACTCAGCCATTC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1073466384 10:103696786-103696808 TCATTCTCTGCAGCTGGTCCAGG No data
1073466379_1073466382 -8 Left 1073466379 10:103696765-103696787 CCCATCAGACCACTCAGCCATTC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1073466382 10:103696780-103696802 AGCCATTCATTCTCTGCAGCTGG No data
1073466379_1073466388 16 Left 1073466379 10:103696765-103696787 CCCATCAGACCACTCAGCCATTC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1073466388 10:103696804-103696826 CCAGGGGTGACTCAAACCACAGG No data
1073466379_1073466386 0 Left 1073466379 10:103696765-103696787 CCCATCAGACCACTCAGCCATTC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1073466386 10:103696788-103696810 ATTCTCTGCAGCTGGTCCAGGGG No data
1073466379_1073466385 -1 Left 1073466379 10:103696765-103696787 CCCATCAGACCACTCAGCCATTC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073466379 Original CRISPR GAATGGCTGAGTGGTCTGAT GGG (reversed) Intronic
905237010 1:36557228-36557250 GAAAGGCAGTGTGGTCTGGTGGG - Intergenic
907431464 1:54414506-54414528 GAATGGATGAGTGCTCTCAGGGG + Intergenic
907533531 1:55126626-55126648 AAATGGCTGAGTGATGTGAAAGG + Intronic
907804460 1:57804390-57804412 AAATGGCTCAGTGGTCTGGATGG + Intronic
909332563 1:74431458-74431480 GAAAGACAGTGTGGTCTGATTGG - Intronic
911174644 1:94806800-94806822 CAAGGTCTGAATGGTCTGATTGG - Intergenic
911316220 1:96359603-96359625 GAATGGCTGTGTGCTGTGCTAGG + Intergenic
915548842 1:156619902-156619924 ACATGGCTTAGTGGACTGATGGG + Intronic
916204590 1:162303221-162303243 GAATGGCTGACTCATATGATAGG + Intronic
916971982 1:170030443-170030465 GAATGGCTGAGTCATAGGATAGG - Intronic
917241689 1:172955699-172955721 GAATAGCTGAATAGTCTGATGGG + Intergenic
918130670 1:181625671-181625693 GAACGTCTGAGTGGTCTGGATGG - Intronic
918131260 1:181631604-181631626 GTATGGCTGGGTGGTGAGATAGG + Intronic
921784823 1:219217731-219217753 GAATGGTTGAGTGGTTTCTTAGG - Intergenic
922055919 1:222042510-222042532 AGAAGGCTGAGTGGTCTGAGTGG - Intergenic
922088586 1:222374097-222374119 GAATGGCTGAGAGGCTTGAATGG - Intergenic
923984517 1:239365985-239366007 GAATGGCAGATTGTTCTGACTGG + Intergenic
924351759 1:243121193-243121215 GAATGGCTGGGTTGTGTGGTAGG + Intergenic
1062848650 10:726861-726883 GAGTGGATGAGTGAGCTGATGGG - Intergenic
1063073271 10:2688903-2688925 GGATGGATGAGTGGATTGATGGG - Intergenic
1063706270 10:8433872-8433894 AAATGAATGAGTGGTCTGCTTGG - Intergenic
1065888449 10:30099962-30099984 GACTGGGTGAGTGGTTTGGTGGG - Intronic
1067895298 10:50173060-50173082 GGAGTGCTGACTGGTCTGATTGG + Intergenic
1067953687 10:50768918-50768940 GGAGTGCTGACTGGTCTGATTGG - Intronic
1069741849 10:70689858-70689880 GAAAGCCTGAGGGGTCTGAGGGG - Intronic
1071166695 10:82815984-82816006 GCATGGCTGAATGGTATAATTGG + Intronic
1073466379 10:103696765-103696787 GAATGGCTGAGTGGTCTGATGGG - Intronic
1074813560 10:117127651-117127673 GAATGGCTGAGGCCTCTGTTGGG - Intergenic
1075723226 10:124599151-124599173 GGATGGGTGAGTGGACAGATGGG - Intronic
1075975735 10:126692447-126692469 GAAGGGCTGATTGGTCAGGTGGG + Intergenic
1076577965 10:131483516-131483538 GGATAGATGAGTGGACTGATGGG + Intergenic
1076867538 10:133175399-133175421 GAATGGGTGAGTGGGTGGATGGG + Intronic
1076867543 10:133175427-133175449 GAATGGATGAGTGGATGGATGGG + Intronic
1076979889 11:198684-198706 GAAGGGCTGAGGGGGCTGAGGGG - Intronic
1077311965 11:1892838-1892860 GGATGGATGAGTGGACAGATAGG + Intergenic
1079008741 11:16811371-16811393 GTATGTCTGAGTGGACTGTTGGG + Intronic
1080662530 11:34309026-34309048 GAATGCCTCTATGGTCTGATAGG + Intronic
1084259244 11:67963970-67963992 GAGAGCCTGAGTGGTCTGTTTGG - Intergenic
1084491770 11:69482597-69482619 GAATGGATGAGTGGATGGATGGG + Intergenic
1084781825 11:71414889-71414911 GAATGGATGAGTGGATGGATAGG + Intergenic
1084894440 11:72255287-72255309 GAATGGTTGTGTGGCCTGTTGGG + Intergenic
1090283209 11:125475766-125475788 GAATGGCTGAGTCATATGGTAGG - Intronic
1090744301 11:129694171-129694193 GAATGGCCCAGGGGACTGATCGG - Intergenic
1092816959 12:12320765-12320787 GAATGCCTTAGTGGTTTGTTAGG + Intergenic
1096683476 12:53272515-53272537 GATGGGCTGAGTGGTGTGAAGGG + Intronic
1100103582 12:91140915-91140937 GGATGGCTGAATGATCAGATGGG - Exonic
1100685842 12:96985539-96985561 AGATGGCAGTGTGGTCTGATGGG - Intergenic
1100701716 12:97155485-97155507 GAGTGGTTAAGTGTTCTGATTGG + Intergenic
1101854241 12:108428791-108428813 GAATGGATGAATGTTCTGTTTGG + Intergenic
1102894451 12:116587533-116587555 GAATGGGTGAATGGTTGGATGGG - Intergenic
1103023967 12:117558609-117558631 GAATGGCTGAGTGAGCGGGTAGG + Intronic
1104346868 12:128007862-128007884 GAATGGCCGAGTCGTGTGTTAGG + Intergenic
1104513495 12:129402760-129402782 GGATGGGTGAGGGGTCTGGTGGG + Intronic
1108606450 13:52044323-52044345 GAATGGCGGAGTTGTATGGTTGG - Intronic
1112934496 13:104781497-104781519 GAATGGCTGAGTGGTGGAAATGG + Intergenic
1113595079 13:111525598-111525620 GAATGGATGGATGGTCAGATGGG + Intergenic
1113829357 13:113282970-113282992 GAATGGCTGGGGCGTGTGATAGG - Intergenic
1113912684 13:113851401-113851423 GAATGGATGAGTGGGTGGATAGG + Intronic
1118661222 14:68015105-68015127 AAATGGCTGAGTTTTCTCATTGG + Intronic
1118959938 14:70519945-70519967 GAATGTTTGAGTGGTCTGGACGG + Intergenic
1120000979 14:79302897-79302919 GAATGGCTTGGTGGTCTGTGTGG - Intronic
1121279789 14:92690227-92690249 GACTGGCTGAGTGAGCTGGTTGG - Intergenic
1121443682 14:93965089-93965111 GGATGGCTGGGTGGACAGATAGG - Intronic
1121890388 14:97584699-97584721 GAAGTGCAGAGTGGTCTGAAAGG - Intergenic
1126334260 15:47569531-47569553 GAATTGCTGTGTGGTCTCCTTGG - Intronic
1126456435 15:48866959-48866981 GAATGGAAGAGTGATTTGATGGG - Intronic
1126976927 15:54193595-54193617 GAATGGCAGAGTTGACTGAAGGG - Intronic
1128341772 15:66827362-66827384 GAAAGGCTGAGGGATCTGTTGGG + Intergenic
1128422325 15:67505444-67505466 GAATGGCTGGGTTGTATGGTTGG - Intergenic
1133204899 16:4227355-4227377 GAATGGCTGGGTGGAAGGATGGG + Intronic
1133773347 16:8880471-8880493 GAATGGATGAGGGAGCTGATGGG - Intergenic
1135892929 16:26373809-26373831 GAATGGATGAGTGGATAGATGGG + Intergenic
1141048885 16:80742859-80742881 GAATGGGTGAGTGGGTAGATGGG + Intronic
1141650069 16:85388154-85388176 GAATGGGTGAGTGGGTGGATGGG + Intergenic
1142355062 16:89598139-89598161 GGATGGGTGAGTGGACGGATGGG - Intergenic
1203138658 16_KI270728v1_random:1746302-1746324 GGCTGGCTGGGTGGTTTGATTGG - Intergenic
1143301252 17:5912148-5912170 GACTGGCTGAGTGGGTGGATGGG - Intronic
1146742560 17:35299273-35299295 GAATGGCAGGGTGGTTTGACTGG - Intergenic
1148564180 17:48623599-48623621 GAAGGGCTGAGAGGTCTCTTGGG - Intronic
1154041490 18:10860273-10860295 GAAAGGCAGAGTGGTCTTAGGGG - Intronic
1155389765 18:25322424-25322446 GAGTGGGTGAGTGATTTGATGGG - Intronic
1155481872 18:26297857-26297879 GAATTGCTGAGTCGTATGGTAGG + Intronic
1157577301 18:48752028-48752050 GAATAGATGAAAGGTCTGATTGG - Intronic
1158543419 18:58376677-58376699 TAATGGCAGAGTGGTCTTTTTGG + Intronic
1159237475 18:65695550-65695572 GAAGCGCTGTGTGGTCTGGTAGG + Intergenic
1161287764 19:3477632-3477654 GAATGGGTGAGTGGGTGGATGGG + Intronic
1161287795 19:3477739-3477761 GAATGGGTGAGTGGGTGGATGGG + Intronic
1163675800 19:18654700-18654722 GAATGGATGAGTGGATGGATGGG - Intronic
1164825277 19:31280479-31280501 GAACGGCTGAGTGTTCACATGGG - Intronic
1167161309 19:47769040-47769062 GGATGGATGAGTGGACAGATGGG - Intergenic
1168326972 19:55543407-55543429 GGATGGGTGAGTGGACAGATGGG - Intronic
925290184 2:2742654-2742676 GAATGGCGGGGTGGGCAGATGGG + Intergenic
925647860 2:6055229-6055251 GTATGGATGAGCCGTCTGATTGG + Intergenic
925769850 2:7271211-7271233 GAATGGATGAATGGGCAGATGGG - Intergenic
926031263 2:9591784-9591806 GAATGGATGAGTGAACAGATAGG - Intronic
928232554 2:29511665-29511687 GAATGGCTGGGTTGTATGGTAGG + Intronic
928782693 2:34844145-34844167 GAATGGCTGAGTGGAAAGATTGG + Intergenic
929606753 2:43239851-43239873 GAATGGGTGAGTGGGTGGATGGG - Intronic
934546735 2:95223998-95224020 GAAGGGGTGAGTGATCTGTTTGG - Intronic
934904292 2:98185514-98185536 GAGGGGCTGAGTGGACTGCTAGG - Intronic
935200404 2:100851848-100851870 GAATGAGTGAGTAGTCTTATTGG + Intronic
935598386 2:104897495-104897517 GATTGGCTGAGTGGGCTGTAGGG - Intergenic
935743701 2:106173011-106173033 GAAAGGCTAAGTGGGCTGTTGGG - Intronic
936243954 2:110810488-110810510 GAATGGGTGAGTGGGTGGATAGG - Intronic
938370914 2:130767934-130767956 GAAGGGCTGAGGGCTCTGAGGGG - Exonic
941324226 2:164093196-164093218 GAATGGCTGAGAGAGCAGATTGG - Intergenic
945500677 2:210569679-210569701 GAATGTCTAAATGGTCTTATTGG + Intronic
945789142 2:214281668-214281690 TAATGGCTGAGTCATATGATAGG - Intronic
948899871 2:240950834-240950856 GAATGGGTGGGTGGTTGGATGGG - Intronic
1170493121 20:16898575-16898597 GAATTGCTGAGTTATGTGATAGG - Intergenic
1172176896 20:32977886-32977908 GGATGCCTGAGTGGCCTGCTGGG - Intergenic
1172196214 20:33093410-33093432 GAATGGGTGGATGGTTTGATTGG - Intronic
1172427154 20:34863211-34863233 GAATGGCTGAGTGGTAGAAGGGG - Intronic
1173546405 20:43901650-43901672 GAATGTCTGAGAGGTTTGAAAGG - Intergenic
1175017963 20:55812153-55812175 GAATGGATGAGTGGATAGATGGG - Intergenic
1175548051 20:59792339-59792361 GAATGGCTGAGTCATGTGGTAGG + Intronic
1175739401 20:61410221-61410243 GAATGGATGGGTGGGCAGATGGG - Intronic
1175815017 20:61878751-61878773 GAATGGCTGAGCGGGCAGAGTGG - Intronic
1181988345 22:26817602-26817624 GAATGGCTGGGTGGTGGGATGGG + Intergenic
1184557795 22:45242413-45242435 GAATGATGGAGAGGTCTGATGGG + Intergenic
1184567697 22:45302228-45302250 GAATGGCTGAGTCATATCATGGG + Intergenic
949438332 3:4052866-4052888 GAATGTTTGAGTGGTCTGGATGG - Intronic
949451960 3:4195956-4195978 GAATGGCTGACTGGTCCCTTTGG + Intronic
949932903 3:9093480-9093502 GAGTGGATGAGTGGGTTGATGGG - Intronic
949932912 3:9093532-9093554 GAGTGGATGAGTGGGTTGATGGG - Intronic
950009607 3:9713463-9713485 GAATGGATAATTGGACTGATGGG + Intronic
952902692 3:38120593-38120615 GCGTGCCTGAGTGGTCTGGTTGG - Exonic
952992034 3:38838702-38838724 GAATGGCTGAGTTGTGTGGTTGG + Intergenic
953781436 3:45874570-45874592 GAATGGCTGAGTGGTGGGAAGGG - Intronic
954146442 3:48636612-48636634 GAAGGGCTGAGTGGCCTGCTGGG - Exonic
955515495 3:59722464-59722486 AAATGCTTGAGTGGCCTGATTGG + Intergenic
958264002 3:91416119-91416141 TACTGGCTGAATGTTCTGATAGG - Intergenic
961383717 3:126512295-126512317 GAAGGGCTGTGTGGTGTGATGGG + Intronic
961469196 3:127100836-127100858 GAATGGCAGGCTGGGCTGATGGG + Intergenic
961736381 3:129004398-129004420 GAATGGGTGAGTGGATGGATGGG - Intronic
961923981 3:130456641-130456663 GAATGGCTGAATAGTCTCTTTGG - Intronic
962025538 3:131543235-131543257 CAAGGGCTGAGTAGTCTCATGGG - Intronic
967111112 3:186294818-186294840 GCATGGCTGAGTGGCGTGCTGGG + Intronic
968564739 4:1305521-1305543 GAATGGCTGAGTCATCTGGTAGG + Intronic
968924853 4:3541778-3541800 GAATGGATGAGTGGGTGGATGGG + Intergenic
969517798 4:7657430-7657452 GAATGACTGAGTGGTGAGTTAGG + Intronic
971155916 4:24082825-24082847 TCATGGCTGATTGTTCTGATGGG - Intergenic
972022024 4:34327131-34327153 GACTGGCTGAGAAGTCTGAATGG - Intergenic
975667111 4:76742869-76742891 GAATGGCTGACTTCTCTGAAAGG - Intronic
976191249 4:82489197-82489219 GAATGAGTGACTGATCTGATTGG + Intronic
979250180 4:118559329-118559351 GAATGGCTGGGTTGTGTGGTAGG - Intergenic
986814592 5:11394530-11394552 GAATGGCCTTGGGGTCTGATGGG + Intronic
987872632 5:23640562-23640584 GGATGGATGAGTGGACAGATAGG + Intergenic
991279830 5:64900093-64900115 GAATGGCTAAGTCATGTGATAGG + Intronic
991290364 5:65028066-65028088 AACTGGCTGTGTGGGCTGATAGG - Intergenic
997066349 5:130564557-130564579 AAATGGCTGAGTCATGTGATAGG - Intergenic
997515709 5:134488068-134488090 GAATGGCTGGGTCATATGATAGG + Intergenic
997879768 5:137579181-137579203 GAATGGTTTGCTGGTCTGATGGG - Intronic
998297141 5:140982163-140982185 AAATGGCTTAGTCCTCTGATGGG + Intronic
999842663 5:155446053-155446075 GAATGGCTGAATTGTATGGTAGG + Intergenic
1001481156 5:172090031-172090053 GAATGGATGAGTGGATAGATAGG + Intronic
1002400412 5:178988817-178988839 GTGAGGCTGAGTGGTCTAATGGG - Intronic
1002917946 6:1544157-1544179 GGATGGATGAGTGGACTGGTGGG + Intergenic
1007525747 6:42491143-42491165 GAATTGCTGAGTGGACTGGTTGG - Intergenic
1008991430 6:57606863-57606885 CACTGGCTGAATGTTCTGATAGG + Intronic
1009179951 6:60505100-60505122 CACTGGCTGAATGTTCTGATAGG + Intergenic
1011756603 6:90505436-90505458 GAATAGCTGAGTTTTATGATAGG - Intergenic
1012226823 6:96714249-96714271 GAATGGCTGATTGGTGAGTTTGG + Intergenic
1012873320 6:104696733-104696755 GAATGGCACAGTCCTCTGATGGG - Intergenic
1012914050 6:105149558-105149580 GAAACACTGAGTGGTCTGATAGG + Intergenic
1015538475 6:134290949-134290971 GAATGGATGAGTGATTTGAGAGG + Intronic
1016152280 6:140756466-140756488 GGATGGGTGTGTGCTCTGATTGG + Intergenic
1017821801 6:158054220-158054242 GAATAGCTGAGTGGATGGATGGG - Intronic
1017836692 6:158185070-158185092 GAATGGCTCTGTGTTCAGATAGG + Intronic
1018965576 6:168485805-168485827 GAATGGATGAATTGTGTGATAGG + Intronic
1019546253 7:1578143-1578165 GGATGGATGAGTGGACAGATGGG - Intergenic
1020842199 7:13232593-13232615 GAATGTTTGAATGCTCTGATTGG - Intergenic
1021717527 7:23473586-23473608 CAAAGGCTGAGTGGGCAGATGGG + Intergenic
1024844937 7:53632567-53632589 GAATGGCTGAGTGAGATGAAAGG - Intergenic
1026452873 7:70544783-70544805 GAATGGCTGCGGGGTGTGCTGGG + Intronic
1028586018 7:92452505-92452527 GAATGGCTGAGTGGCCTCCCTGG + Intronic
1032565813 7:132941700-132941722 GGATGGCTGAGTGATCTGATGGG + Intronic
1034524109 7:151644709-151644731 GAATGGCTGAGTCATTTGGTAGG + Intronic
1034711780 7:153198928-153198950 GAAGGACTGTCTGGTCTGATTGG + Intergenic
1037379784 8:18273170-18273192 GCATGGCTGAGTTCTCTGAAGGG - Intergenic
1038067265 8:23975942-23975964 GCTTGGCAGAGTGGTCAGATGGG + Intergenic
1039297876 8:36176842-36176864 GAATGGAAGAGTGTACTGATTGG - Intergenic
1040474392 8:47763902-47763924 GTATGGTTGTGTGGTGTGATGGG + Intergenic
1043427979 8:80167434-80167456 GAATAGCTGAGTGGTAGGAGGGG - Intronic
1044277063 8:90313530-90313552 AAATGGTAGAGTGGTCTGACAGG + Intergenic
1049171550 8:141164503-141164525 GAATGGCTGAGGGGTCAGCCAGG + Intronic
1049477148 8:142802047-142802069 GGATGGCTGAGTGGGTGGATGGG + Intergenic
1051329886 9:16013040-16013062 GAAAGGCTGACAGATCTGATGGG - Intronic
1051710994 9:19930710-19930732 GAATTCCTGAGTGGTCTGCAGGG - Intergenic
1052248758 9:26371747-26371769 AAATGGTGGAGTGGTTTGATTGG - Intergenic
1052674731 9:31605762-31605784 GAATGGCTGGGTCATATGATAGG + Intergenic
1052765296 9:32634491-32634513 GAGTGGCTGAGTGGCGTTATGGG - Exonic
1053799898 9:41757651-41757673 GAATGGATGAGTGGGTGGATGGG + Intergenic
1054145286 9:61557180-61557202 GAATGGATGAGTGGGTGGATGGG - Intergenic
1054188330 9:61969799-61969821 GAATGGATGAGTGGGTGGATGGG + Intergenic
1054464969 9:65488037-65488059 GAATGGATGAGTGGGTGGATGGG - Intergenic
1054465043 9:65488333-65488355 GAATGGATGAGTGGGTGGATGGG - Intergenic
1054650195 9:67618822-67618844 GAATGGATGAGTGGGTGGATGGG - Intergenic
1056120410 9:83482393-83482415 GAATGCCTGAGAGGGCTGTTAGG + Intronic
1056907249 9:90664152-90664174 GTAGGGTTGAGAGGTCTGATAGG + Intergenic
1057181083 9:93030792-93030814 GAATGGATGAGTGGTTGGAGAGG + Intronic
1057406921 9:94780713-94780735 GATTGGCAGATTGGTCTCATAGG + Intronic
1057601336 9:96460352-96460374 GAAAGGCTGTGTGGTGTGGTGGG - Intronic
1058703011 9:107616243-107616265 GAATGAGTGAATGGCCTGATGGG - Intergenic
1059747801 9:117219884-117219906 CAAGGGCAGAGTGCTCTGATGGG + Intronic
1062100613 9:134726448-134726470 GAATGGATGAGTGGATGGATGGG + Intronic
1185581112 X:1212044-1212066 GGATGGCTGGGTGGGTTGATGGG + Intronic
1189489633 X:41459909-41459931 GAATTGCTGAGTCATATGATAGG + Intronic
1189895882 X:45656134-45656156 GAATGGCTGGGTCGTGTGGTAGG + Intergenic
1190124991 X:47696715-47696737 GAATGGCTAAGTGATGTGGTAGG + Intergenic
1192468765 X:71378314-71378336 GAGTGGCTGAGTGGCGTTATGGG + Exonic
1195482958 X:105369313-105369335 GAATCTCTGGGTGGGCTGATTGG - Intronic
1195883662 X:109618650-109618672 GAATGGCTGAGGGGAATGAGGGG - Intergenic
1196812786 X:119641929-119641951 GAATGGATGAGTGGGCAAATGGG - Intronic
1196859758 X:120015823-120015845 AAAAGGCTGAGCGGTCTGGTGGG + Intergenic
1198079147 X:133222559-133222581 GCATGTCTGAGTGTTCTTATGGG + Intergenic