ID: 1073466380

View in Genome Browser
Species Human (GRCh38)
Location 10:103696766-103696788
Sequence TGAATGGCTGAGTGGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073466380_1073466384 -3 Left 1073466380 10:103696766-103696788 CCATCAGACCACTCAGCCATTCA 0: 1
1: 0
2: 0
3: 29
4: 344
Right 1073466384 10:103696786-103696808 TCATTCTCTGCAGCTGGTCCAGG No data
1073466380_1073466385 -2 Left 1073466380 10:103696766-103696788 CCATCAGACCACTCAGCCATTCA 0: 1
1: 0
2: 0
3: 29
4: 344
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466380_1073466388 15 Left 1073466380 10:103696766-103696788 CCATCAGACCACTCAGCCATTCA 0: 1
1: 0
2: 0
3: 29
4: 344
Right 1073466388 10:103696804-103696826 CCAGGGGTGACTCAAACCACAGG No data
1073466380_1073466386 -1 Left 1073466380 10:103696766-103696788 CCATCAGACCACTCAGCCATTCA 0: 1
1: 0
2: 0
3: 29
4: 344
Right 1073466386 10:103696788-103696810 ATTCTCTGCAGCTGGTCCAGGGG No data
1073466380_1073466382 -9 Left 1073466380 10:103696766-103696788 CCATCAGACCACTCAGCCATTCA 0: 1
1: 0
2: 0
3: 29
4: 344
Right 1073466382 10:103696780-103696802 AGCCATTCATTCTCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073466380 Original CRISPR TGAATGGCTGAGTGGTCTGA TGG (reversed) Intronic
900565740 1:3331092-3331114 TGCAGGGCTGAGTGGGCTGGCGG - Intronic
900649913 1:3725689-3725711 TGAATGGATGAGTGGGTGGATGG + Intronic
900690769 1:3978939-3978961 TGACTGGCTGTGGGATCTGAAGG + Intergenic
900836467 1:5008587-5008609 TGAATGGGTGAGTGGAGGGATGG + Intergenic
900848234 1:5120877-5120899 TGAATGTCTGGGTGGTTGGATGG - Intergenic
900922025 1:5678897-5678919 TGAATGGATGAGTGGATGGATGG + Intergenic
902374758 1:16025160-16025182 GGAAGGGCTGAGTGGCCTGAGGG - Intronic
902613636 1:17611568-17611590 TGAATGGATGAGTGGATGGATGG - Intronic
902647274 1:17808774-17808796 TGAAGGACTGAGAGGTGTGATGG + Intronic
904458267 1:30660284-30660306 TTGATGGCTGGGTGGTCTGGGGG - Intergenic
904936879 1:34137178-34137200 TGAATGGATGGGTGGACGGATGG - Intronic
904993702 1:34614523-34614545 TGAATGACTGAGTGGATGGATGG + Intergenic
905225514 1:36476206-36476228 TGAAAGGCAGTGTGGTGTGATGG + Intronic
905624345 1:39477602-39477624 TGGAAGCGTGAGTGGTCTGAGGG + Intronic
906098861 1:43243174-43243196 TGGATGGATGAGTGGTCAGTGGG - Intronic
906691689 1:47797017-47797039 TGAATGAATGAGTGAGCTGAGGG + Intronic
906797423 1:48709022-48709044 TGACTGGCCGAGTGGCCTCATGG + Intronic
907431463 1:54414505-54414527 GGAATGGATGAGTGCTCTCAGGG + Intergenic
907570717 1:55480823-55480845 TGAATGCCTGAGTGGATGGAGGG + Intergenic
909584430 1:77273649-77273671 TTATTGGATGAGTGGTCTAATGG + Intergenic
912077007 1:105887461-105887483 TGGATGGATGAGTGGACAGAAGG + Intergenic
912339381 1:108896397-108896419 TGGATGGCTGGATGGTCAGAGGG + Intronic
912727967 1:112076000-112076022 TGAATGGGTGGGTGGGCGGAGGG + Intergenic
913094859 1:115506847-115506869 TGATTGACTGAGGGGTCAGAGGG + Intergenic
913221701 1:116665770-116665792 TGCCTACCTGAGTGGTCTGAAGG - Intronic
916369549 1:164074831-164074853 TGCATTGCTGAGTGGTACGAAGG + Intergenic
917104146 1:171475537-171475559 TAAATGACTGATTGGTGTGAGGG - Intergenic
917241688 1:172955698-172955720 TGAATAGCTGAATAGTCTGATGG + Intergenic
918587762 1:186207395-186207417 TGAATGGCTGAGTGTTATCCAGG + Intergenic
919692462 1:200540293-200540315 TGGATGGATGAGTGAACTGATGG - Intergenic
919713926 1:200755472-200755494 TGAAGAGCTGAGTAGGCTGATGG + Intronic
919882340 1:201908862-201908884 GGAATGGCTGAGAGCTCTGAGGG - Intronic
923522494 1:234746551-234746573 TGATGGGCTGATTGGTTTGATGG + Intergenic
1062848651 10:726862-726884 TGAGTGGATGAGTGAGCTGATGG - Intergenic
1063073272 10:2688904-2688926 TGGATGGATGAGTGGATTGATGG - Intergenic
1063073291 10:2689000-2689022 TGAATGGGTGAGTGGATGGATGG - Intergenic
1065888450 10:30099963-30099985 TGACTGGGTGAGTGGTTTGGTGG - Intronic
1065888718 10:30102033-30102055 TGAGTTGTGGAGTGGTCTGAAGG - Intronic
1068698832 10:59998448-59998470 TGAGTAGTTGAGTGGTCAGAGGG - Intergenic
1069741850 10:70689859-70689881 TGAAAGCCTGAGGGGTCTGAGGG - Intronic
1070374320 10:75814525-75814547 TGAATGGCTGAGTGGGAAAAAGG - Intronic
1070580341 10:77714245-77714267 TGACTGGCTGAGTGACCTGAGGG - Intergenic
1073466380 10:103696766-103696788 TGAATGGCTGAGTGGTCTGATGG - Intronic
1074372894 10:112914619-112914641 TGAATGGATGAGTAGACGGATGG - Intergenic
1075437295 10:122454564-122454586 TGAATTGTTGGGTGGTCTCAGGG - Intergenic
1075723227 10:124599152-124599174 TGGATGGGTGAGTGGACAGATGG - Intronic
1076577964 10:131483515-131483537 TGGATAGATGAGTGGACTGATGG + Intergenic
1076577988 10:131483614-131483636 TGGATGGGTGAGTGGACGGATGG + Intergenic
1076578020 10:131483781-131483803 TGATTGGATGAATGGACTGATGG + Intergenic
1076602843 10:131670149-131670171 TGAATGGATGAGTGGATGGATGG + Intergenic
1076740282 10:132479425-132479447 TGCATGGCTGACGGGCCTGAGGG + Intergenic
1076867537 10:133175398-133175420 TGAATGGGTGAGTGGGTGGATGG + Intronic
1076867542 10:133175426-133175448 TGAATGGATGAGTGGATGGATGG + Intronic
1076979890 11:198685-198707 TGAAGGGCTGAGGGGGCTGAGGG - Intronic
1077397348 11:2331657-2331679 AAAATGGCTGAGTGGTGTCAGGG - Intergenic
1078093419 11:8281968-8281990 TGAATGGATGGATGGGCTGAAGG + Intergenic
1078146806 11:8727224-8727246 TTATTGGCTGAAAGGTCTGATGG - Intronic
1078320203 11:10327626-10327648 TGAATGGCAGAGTGGAGTGATGG + Intronic
1079573825 11:21978296-21978318 TGAGTGGCAGTGTGATCTGATGG + Intergenic
1081622727 11:44628419-44628441 TGAAAGGCTGAGAGGCCTGGGGG + Intergenic
1082934441 11:58641690-58641712 AGATAGGCTGAGGGGTCTGAGGG + Intronic
1083201276 11:61122456-61122478 TGGATGGATGAGTGGACTGATGG + Intronic
1083405242 11:62452436-62452458 TCAAGGGCTGAGAGGTCTGTTGG + Intronic
1084491752 11:69482497-69482519 TGAATGGATGAGTGGATGGACGG + Intergenic
1084491769 11:69482596-69482618 TGAATGGATGAGTGGATGGATGG + Intergenic
1084781791 11:71414737-71414759 TGAATGGATGAATGGATTGATGG + Intergenic
1087679235 11:101200741-101200763 TGAAAAGCTTACTGGTCTGAAGG + Intergenic
1089388121 11:118081106-118081128 TGAATGAATGAGTGGATTGATGG + Intronic
1091809688 12:3385931-3385953 AGAATGGCTGAGTGGATGGATGG - Intronic
1092100626 12:5880912-5880934 TGGATGGATGAGTGGATTGAGGG + Intronic
1092815431 12:12308585-12308607 TGAATGGGTGAGTGAAATGAAGG + Intergenic
1093208084 12:16275070-16275092 TGCATGGCTGACTTCTCTGATGG - Intronic
1096611225 12:52803293-52803315 TGAATGGCTGGGTGGATGGATGG + Intergenic
1096683475 12:53272514-53272536 AGATGGGCTGAGTGGTGTGAAGG + Intronic
1097337919 12:58405517-58405539 TGAATGGCTGGGTGTTATGTAGG + Intergenic
1101039728 12:100742997-100743019 TGAATGGGTGAGTGGATGGATGG - Intronic
1101834708 12:108287233-108287255 TGAATGGGTGAGTGGATGGATGG + Intergenic
1101979529 12:109393571-109393593 TGAATGGATGGGTGGGCGGATGG - Intronic
1102042374 12:109809069-109809091 TGGATGGATGAGTGGGCAGATGG - Intronic
1102199742 12:111049092-111049114 TGGATGGATGAGTGGACAGATGG - Intronic
1102640198 12:114360501-114360523 TGAATGGATGGGTGGGTTGATGG + Intronic
1102894452 12:116587534-116587556 TGAATGGGTGAATGGTTGGATGG - Intergenic
1103206020 12:119129822-119129844 TGAATGGCTGAATGGTTAGATGG + Intronic
1104169247 12:126263950-126263972 TGTAGGGCTGAGTGCCCTGAAGG + Intergenic
1104323925 12:127778001-127778023 TTTCTGGCTGAGTGGGCTGATGG - Intergenic
1104766105 12:131331246-131331268 TGAATGGATGAGTGGAAGGATGG - Intergenic
1104888159 12:132124273-132124295 TGAATGGATGAGTAGACAGAAGG - Intronic
1105335484 13:19463770-19463792 TGACTGCCTCAGTGGCCTGATGG + Intronic
1106316941 13:28602543-28602565 TGAATGGCAGAGTGGTAGAAAGG + Intergenic
1107680848 13:42848484-42848506 GGAATGGCTGAGTTTTCTAAAGG + Intergenic
1109094514 13:58096164-58096186 TGAAGTAATGAGTGGTCTGATGG + Intergenic
1110367278 13:74701189-74701211 TGAATGGCTGTCTGGGCTTAGGG - Intergenic
1111187673 13:84761222-84761244 TGTTAGGCTGGGTGGTCTGATGG + Intergenic
1112863454 13:103864185-103864207 TGAATGGGTGATTGATCTCAGGG + Intergenic
1113595078 13:111525597-111525619 TGAATGGATGGATGGTCAGATGG + Intergenic
1113595116 13:111525914-111525936 TGAATGGATGGATGGTCAGATGG + Intergenic
1113901003 13:113798058-113798080 TGTATGGCTGAATGGTTGGATGG + Intronic
1117163945 14:53015558-53015580 GGAATGGCTGAGTGGGGAGAAGG + Intergenic
1119037815 14:71245591-71245613 TGAATGGCTGTGTGCTTTGGCGG - Intergenic
1121087398 14:91157048-91157070 TGAATGGGTGAGTGGGTGGATGG + Intronic
1121708340 14:96018028-96018050 TGGATGGATGAGTGGGCGGATGG + Intergenic
1121737948 14:96231670-96231692 CGACTTGCTGGGTGGTCTGAAGG + Intronic
1122354988 14:101117596-101117618 TGAATGGGTGAGTGGATGGATGG - Intergenic
1124128605 15:26964226-26964248 TGAATGGCTGACTGTTCTTTGGG - Intergenic
1124895101 15:33769062-33769084 AGACAGGCTGAGTGGTTTGAGGG + Intronic
1126456436 15:48866960-48866982 TGAATGGAAGAGTGATTTGATGG - Intronic
1126976928 15:54193596-54193618 AGAATGGCAGAGTTGACTGAAGG - Intronic
1127432825 15:58927716-58927738 TGAAAGGCTGAAAGCTCTGAAGG - Intronic
1128250985 15:66164204-66164226 TTAGTGGCAGAGAGGTCTGATGG + Intronic
1128341771 15:66827361-66827383 TGAAAGGCTGAGGGATCTGTTGG + Intergenic
1128695782 15:69761451-69761473 TGAATGGATGAATGGACGGACGG - Intergenic
1129230843 15:74196460-74196482 TGACTCGCTGAGTTCTCTGAAGG - Intronic
1130122327 15:81061777-81061799 TTAATGTCAGAGTGCTCTGAAGG + Intronic
1131690421 15:94821209-94821231 TGAATTGCTGAGTTGGCTGGAGG + Intergenic
1133111654 16:3551495-3551517 TGAATGGGTGAGTGGGTAGATGG - Intronic
1133111737 16:3551929-3551951 TGGATGGATGAGTGGACTGATGG - Intronic
1133204745 16:4226576-4226598 TGAATGGGTGAATGGACAGATGG + Intronic
1133204898 16:4227354-4227376 TGAATGGCTGGGTGGAAGGATGG + Intronic
1133773348 16:8880472-8880494 TGAATGGATGAGGGAGCTGATGG - Intergenic
1135054997 16:19224466-19224488 TGAATGGATCAGTGAACTGACGG + Intronic
1135157018 16:20061264-20061286 TGGATGGCTGTGTGGACAGATGG + Intronic
1135892928 16:26373808-26373830 TGAATGGATGAGTGGATAGATGG + Intergenic
1135902928 16:26482802-26482824 TGAATGAATGAATGATCTGAGGG - Intergenic
1135903380 16:26487543-26487565 TGAATGAATGAATGATCTGAGGG - Intergenic
1135933244 16:26757305-26757327 TGGATGGCTGAGTGGAAGGATGG + Intergenic
1136115130 16:28089649-28089671 TGTATGGGTGTGTGGTGTGAGGG - Intergenic
1137469083 16:48738529-48738551 TGACTGGCTGTGTGATCTCAGGG + Intergenic
1137625806 16:49907728-49907750 TCATTGGCTGAGTGGGCTCAGGG - Intergenic
1137817241 16:51410134-51410156 TCAGTGGGTGAGGGGTCTGAAGG - Intergenic
1138495757 16:57408259-57408281 TGAATGGATGAGTGGCTGGAAGG - Intronic
1138950964 16:61912469-61912491 TGAATGGATGAATGGGTTGATGG + Intronic
1139604953 16:68011567-68011589 TGAATGGATGAGTGGATAGATGG + Intronic
1139722102 16:68864723-68864745 TGAATGCCAGAGAGGCCTGATGG - Intronic
1140067701 16:71625437-71625459 TGAGTGGGTGAGTGGGCGGATGG + Intergenic
1140441883 16:74994173-74994195 TGAATGACTAAATGGTATGAGGG - Intronic
1140853250 16:78954294-78954316 TGCATGGCTGAGTGGATAGAAGG + Intronic
1141048884 16:80742858-80742880 TGAATGGGTGAGTGGGTAGATGG + Intronic
1141213534 16:82003102-82003124 TGACTGTCTCAGTGGTTTGAGGG + Intronic
1141483869 16:84325866-84325888 TGAATGGATGAATGGGCAGATGG - Intronic
1141650068 16:85388153-85388175 TGAATGGGTGAGTGGGTGGATGG + Intergenic
1143301253 17:5912149-5912171 TGACTGGCTGAGTGGGTGGATGG - Intronic
1143301515 17:5913977-5913999 TGACTGGCTGAGTGGGTGGATGG - Intronic
1145262449 17:21362674-21362696 TAGATGGATGAGTGGACTGATGG + Intergenic
1145262515 17:21363133-21363155 TGGATGGATGAGTGGACAGATGG + Intergenic
1145272623 17:21412845-21412867 TTAATGGCTGTGTGGCCTGGGGG + Intronic
1145310832 17:21700308-21700330 TTAATGGCTGTGTGGCCTGGGGG + Intronic
1147725401 17:42563606-42563628 TGAATGGGTGAGTGAGCTGCAGG + Intronic
1147918853 17:43904292-43904314 GGAATGGCTGAGTGGTAGGGTGG + Intronic
1148564181 17:48623600-48623622 TGAAGGGCTGAGAGGTCTCTTGG - Intronic
1151430606 17:74060009-74060031 TGAGTGGATGAATGGACTGAGGG + Intergenic
1152034088 17:77861363-77861385 TGAATGGATGAGTGGATAGAAGG + Intergenic
1152983761 18:303793-303815 TGAATGGCTGAGCAGTTTTATGG - Intergenic
1153590869 18:6673119-6673141 TGAATGGCTCTGTGTCCTGAGGG - Intergenic
1153690112 18:7583825-7583847 TGTATGCCTGAGTGGTCTTAGGG + Intronic
1154041491 18:10860274-10860296 GGAAAGGCAGAGTGGTCTTAGGG - Intronic
1157174420 18:45438227-45438249 TGAATGGCTGCCTGCTCTCAGGG - Intronic
1158711282 18:59840242-59840264 TGAGTGGCTGTGTGGTATGAAGG + Intergenic
1160261081 18:77294904-77294926 TGATTGTCTGTGTTGTCTGAGGG - Intergenic
1160692380 19:465960-465982 TGGATGGATGAGTGGATTGATGG + Intronic
1160692592 19:466766-466788 TGGATGGATGAGTGGATTGATGG + Intronic
1161131290 19:2590549-2590571 TGAATGGATGAGTGGGCGGATGG - Intronic
1161287763 19:3477631-3477653 TGAATGGGTGAGTGGGTGGATGG + Intronic
1161287794 19:3477738-3477760 TGAATGGGTGAGTGGGTGGATGG + Intronic
1161449032 19:4334428-4334450 TGAATGGGTGGGTGGGCGGATGG - Intronic
1161449247 19:4335402-4335424 TGGATGGATGAGTGGGCAGACGG - Intronic
1161641148 19:5424033-5424055 TGGATGGCTGAGTGGGAAGATGG - Intergenic
1161766153 19:6210028-6210050 TGAGTGGATGGGTGGTTTGATGG - Intergenic
1162441907 19:10697759-10697781 TGAATGGCTGATTGGATTAAGGG - Intergenic
1163251979 19:16131509-16131531 TGGATGGTTGATTGGTCAGAAGG + Intronic
1163441971 19:17326840-17326862 TGGATGGCTGAAGGTTCTGAAGG + Intronic
1163462212 19:17445798-17445820 TGGATGGATGACTGGTTTGATGG - Intronic
1163675614 19:18653987-18654009 TGGATGGAAGAGTGGACTGATGG - Intronic
1163675801 19:18654701-18654723 TGAATGGATGAGTGGATGGATGG - Intronic
1163927502 19:20360140-20360162 TGATTGGGTGAGTGGTTTGGCGG - Intergenic
1164386909 19:27779419-27779441 AGAATGTCCGAGTAGTCTGATGG - Intergenic
1164701511 19:30287830-30287852 TGAATGGATGAGTGGGTGGATGG + Intronic
1165699793 19:37928902-37928924 TGGATGGCAGAGTGGCTTGAAGG - Intronic
1166341607 19:42140656-42140678 TGAATTTCAGAGTGCTCTGAAGG - Intronic
1167161310 19:47769041-47769063 TGGATGGATGAGTGGACAGATGG - Intergenic
1167668898 19:50838695-50838717 AGAAGGGCTGGGGGGTCTGAGGG + Intergenic
1168296985 19:55382119-55382141 TGGATGGATGAGTTGTTTGATGG - Intronic
1168423380 19:56219754-56219776 TGGATGGCTGATTGAGCTGACGG - Exonic
925377526 2:3398867-3398889 TGAATGGCTTGCTGGTCTGAAGG + Intronic
925769851 2:7271212-7271234 TGAATGGATGAATGGGCAGATGG - Intergenic
925786235 2:7433902-7433924 TGAATAGCTGAGTGGAGTGGGGG + Intergenic
926152887 2:10434624-10434646 TGATAGGCTGAGTGGGCGGAGGG - Intergenic
929606754 2:43239852-43239874 TGAATGGGTGAGTGGGTGGATGG - Intronic
932951175 2:76295384-76295406 AGAATGGCTAAGTGGTTTGGAGG - Intergenic
935598387 2:104897496-104897518 GGATTGGCTGAGTGGGCTGTAGG - Intergenic
935854130 2:107256731-107256753 TGACAGAGTGAGTGGTCTGAGGG + Intergenic
936484553 2:112915074-112915096 TGAAGGTGTGAGTGGTCTTAAGG - Intronic
937399365 2:121568398-121568420 TCAAAGGCTGAGTTTTCTGAGGG - Intronic
938370915 2:130767935-130767957 GGAAGGGCTGAGGGCTCTGAGGG - Exonic
939361920 2:141183617-141183639 TGAATAGCAGAGTGATCTGTAGG - Intronic
939386894 2:141512315-141512337 TGAATGGCTGTGTGCCCTGGAGG - Intronic
941780641 2:169441033-169441055 TGGATGGCTCAGGGGGCTGATGG - Intergenic
942150348 2:173070216-173070238 TGAATGGATCAGTGCTCTGGTGG - Intergenic
945434695 2:209805524-209805546 TGAAGGCTTGACTGGTCTGAAGG + Intronic
945704911 2:213218134-213218156 GGTGTGGCTGAGTGGACTGAGGG + Intergenic
946685574 2:222266219-222266241 TGAATTCCTGAGTGTGCTGAGGG - Intronic
948137879 2:235650459-235650481 TGGATGGGTGAGTGGGCAGAGGG - Intronic
948479363 2:238240368-238240390 TGAATGAATGAGTGGACGGACGG - Intronic
948769231 2:240239673-240239695 TGAATGGCTGGGTGGATGGATGG + Intergenic
948899872 2:240950835-240950857 TGAATGGGTGGGTGGTTGGATGG - Intronic
1169067168 20:2700616-2700638 GGAGGTGCTGAGTGGTCTGAGGG - Intronic
1170519526 20:17169593-17169615 TGAATAGCTGTGTGTTCTTAGGG - Intergenic
1171250758 20:23645274-23645296 TGAAGGCCTGGGTGGCCTGAGGG - Intergenic
1171312076 20:24152685-24152707 TGAATGGCTGTGTGGGGAGACGG - Intergenic
1172176897 20:32977887-32977909 TGGATGCCTGAGTGGCCTGCTGG - Intergenic
1172427155 20:34863212-34863234 GGAATGGCTGAGTGGTAGAAGGG - Intronic
1172808974 20:37633539-37633561 TGAATGGCTGGGGGATTTGAGGG - Intergenic
1172826392 20:37790739-37790761 TGAATAGCTATGAGGTCTGATGG - Intronic
1173976482 20:47190493-47190515 TGAATGGCTGGGTGGTTTTACGG + Intergenic
1174098714 20:48110067-48110089 TGAATGGATGAATGGGCAGATGG - Intergenic
1174291520 20:49512286-49512308 TGAATGGATGAATGGACAGATGG + Intronic
1175017964 20:55812154-55812176 TGAATGGATGAGTGGATAGATGG - Intergenic
1175131303 20:56791751-56791773 TGAATGGATGGGTGGACAGATGG - Intergenic
1175739402 20:61410222-61410244 TGAATGGATGGGTGGGCAGATGG - Intronic
1176738089 21:10571214-10571236 TGAGTGCCTCAGTGGCCTGATGG - Intronic
1176965303 21:15205866-15205888 TGTATTGCTGACTGTTCTGAAGG - Intergenic
1178191357 21:30285188-30285210 TGAGTGGCATCGTGGTCTGAAGG + Intergenic
1178409283 21:32350326-32350348 TGAAAGGCTGAGAGGTTGGAGGG + Intronic
1178752446 21:35317708-35317730 TGATGTGCTGAGTGGTCTGCAGG - Intronic
1179308691 21:40177979-40178001 GGAGTGGCTGATTGCTCTGATGG + Intronic
1179727900 21:43350507-43350529 TGCATGGCTCAGGGCTCTGAGGG + Intergenic
1179961988 21:44772767-44772789 AGAAGGGCTGAGTGGTCCCAGGG - Intronic
1180182378 21:46123749-46123771 TGAATGGATGAGTGGGGGGATGG + Intronic
1181988344 22:26817601-26817623 CGAATGGCTGGGTGGTGGGATGG + Intergenic
1182941576 22:34282192-34282214 TGAATGGCTAACTGGACTTAGGG - Intergenic
1183489794 22:38110294-38110316 TGTATGGCTGAGTGCTCTCGGGG + Intronic
1183724943 22:39583284-39583306 TGAATGGATGAGTGGTTGGAGGG - Intronic
1184449603 22:44575204-44575226 TGGATGCCTGAGTGGTGTGTGGG + Intergenic
949091293 3:32679-32701 TGAATGGATGAGTGGATAGATGG - Intergenic
949932904 3:9093481-9093503 TGAGTGGATGAGTGGGTTGATGG - Intronic
949932913 3:9093533-9093555 TGAGTGGATGAGTGGGTTGATGG - Intronic
949932922 3:9093581-9093603 TGAATGGATGAGTGGGTTGATGG - Intronic
950451219 3:13066898-13066920 TGAATGGGTGAGTGATCGGCAGG + Intronic
953781437 3:45874571-45874593 AGAATGGCTGAGTGGTGGGAAGG - Intronic
954146443 3:48636613-48636635 TGAAGGGCTGAGTGGCCTGCTGG - Exonic
955561943 3:60200903-60200925 TGAATGGATGAATGGACAGAAGG - Intronic
957594633 3:82246922-82246944 GGAATGGCTAAGTAGTGTGATGG + Intergenic
959125240 3:102283180-102283202 TGAATGGAGGAGTGCTGTGAAGG - Intronic
960083835 3:113569598-113569620 TAAATGAATGAGTGGTCAGAAGG + Intronic
961383716 3:126512294-126512316 GGAAGGGCTGTGTGGTGTGATGG + Intronic
961736382 3:129004399-129004421 TGAATGGGTGAGTGGATGGATGG - Intronic
962025539 3:131543236-131543258 TCAAGGGCTGAGTAGTCTCATGG - Intronic
963965559 3:151365910-151365932 AGAATGGCTGGGGGTTCTGAAGG + Exonic
964396658 3:156253046-156253068 TGAATGGTTGAGTATTCTCATGG + Intronic
967475479 3:189911822-189911844 TGTATGTCTGAGTGGACAGATGG - Intergenic
968048288 3:195635903-195635925 GGAATGGCTTAGTTATCTGAGGG + Intergenic
968099116 3:195953717-195953739 GGAATGGCTTAGTTATCTGAGGG - Intergenic
968306322 3:197654018-197654040 GGAATGGCTTAGTTATCTGAGGG - Intergenic
968924803 4:3541578-3541600 TGAATGGGTGGGTGGGTTGATGG + Intergenic
968924852 4:3541777-3541799 TGAATGGATGAGTGGGTGGATGG + Intergenic
969216715 4:5729068-5729090 TGAATGGGTGGGTGGGCAGATGG - Intronic
969501662 4:7557011-7557033 TGGATGGATGAGTGGACAGATGG - Intronic
969502537 4:7561859-7561881 TGAATGGATGAGTAGACTGATGG - Intronic
969523144 4:7690459-7690481 TGAATGGATGAGTGGGTGGATGG + Intronic
969650363 4:8463583-8463605 TGGAAGGCAGAGAGGTCTGAAGG - Intronic
970882303 4:20946393-20946415 AGAAGGCCTGAGTGGTCAGATGG + Intronic
971155917 4:24082826-24082848 TTCATGGCTGATTGTTCTGATGG - Intergenic
971328617 4:25664338-25664360 TGAAAGGGTGAGAGGTCTGCGGG + Intronic
971455277 4:26838169-26838191 TGCATGGGTGAGTAGGCTGAGGG - Intergenic
977918071 4:102615156-102615178 TGAATGACTGAATGAACTGAAGG - Intronic
978132808 4:105220317-105220339 TTAATGGCTGAATGGGGTGAAGG - Intronic
985504777 5:272394-272416 GGAATGGCTTAGTTATCTGAGGG + Intronic
985547487 5:517187-517209 TGGATGGATGAGTGGATTGATGG - Intronic
985547510 5:517353-517375 TGGATGGATGAGTGGATTGATGG - Intronic
985547530 5:517486-517508 TGGATGGATGAGTGGACTGATGG - Intronic
985547536 5:517530-517552 TGGATGGATGAGTGGATTGATGG - Intronic
985743337 5:1633201-1633223 GGAATGGCTTAGTTATCTGAGGG - Intergenic
989547942 5:42696364-42696386 TGAATGACTGACAGGCCTGAGGG + Intronic
995401012 5:111741679-111741701 TGAATGGCCCAGTGTTCTGCAGG - Intronic
996706166 5:126501062-126501084 TGAAAAGCTGAGCTGTCTGAGGG - Intergenic
996919419 5:128750259-128750281 TGAATGAATGAATGGTCTGCAGG - Intronic
997879769 5:137579182-137579204 TGAATGGTTTGCTGGTCTGATGG - Intronic
998193460 5:140045865-140045887 TGTATTGCTGAGTGTCCTGAAGG + Intergenic
999523167 5:152373842-152373864 TGAGTAGCTGAGTGGGTTGAGGG - Intergenic
999698957 5:154210504-154210526 TTAATGCCTGAGTGGGCTGAGGG - Intronic
1001329780 5:170754184-170754206 TGGATGGATGAGTGGACGGATGG + Intergenic
1001579636 5:172789927-172789949 TGAATGGTGGAGGGGGCTGAGGG + Intergenic
1001952068 5:175823294-175823316 TGGATGGATGAGTGGTGAGATGG + Intronic
1002341606 5:178519902-178519924 TGGATGGATGAATGGTCAGATGG + Intronic
1002917945 6:1544156-1544178 TGGATGGATGAGTGGACTGGTGG + Intergenic
1007813556 6:44503843-44503865 TGAATGGTTGAGTTGTGTGAAGG - Intergenic
1008028489 6:46665982-46666004 TGAATTGCTTAGTTCTCTGAAGG - Intronic
1008734114 6:54521170-54521192 TGAATGGCTCAGTGGTGGGAGGG + Intergenic
1010726244 6:79336916-79336938 TGAATGGCAGAGTAGACTGCAGG - Intergenic
1010904096 6:81464970-81464992 TGAATGGATGAGTTGTCAGCTGG + Intergenic
1011524744 6:88252314-88252336 TGAATGGCTGGGTGACCGGATGG + Intergenic
1012803881 6:103870157-103870179 TGAATGGGTGGGTGGACTGATGG - Intergenic
1013598119 6:111679384-111679406 TGAATGCATGAATTGTCTGAAGG + Intronic
1013663739 6:112325713-112325735 TGACAAGCTGAGTGGTCGGAAGG + Intergenic
1014044660 6:116871723-116871745 TAAATGGCTGAGAGGATTGAGGG - Intergenic
1015255807 6:131178502-131178524 TGAATGGCAGAGTGGTGTATGGG - Intronic
1015457331 6:133441631-133441653 TGACAGGGTGAGTGGTCTGGTGG + Intronic
1017821684 6:158053729-158053751 TGGATGGCTGGGTGGATTGATGG - Intronic
1017821794 6:158054185-158054207 TGAATAGCTGAGTGGATGGATGG - Intronic
1017821802 6:158054221-158054243 TGAATAGCTGAGTGGATGGATGG - Intronic
1019335883 7:482499-482521 TGAATGGATGAGTGGATGGAAGG + Intergenic
1020554031 7:9647071-9647093 TGATTGGATGAGTGGTTGGATGG + Intergenic
1022366285 7:29721694-29721716 TGAATGGATGATTGGTTGGATGG - Intergenic
1022841032 7:34164013-34164035 TGAATGGCTGAGTGAGCTTCTGG + Intergenic
1023986421 7:45099805-45099827 TGCATGGCTGGGGGTTCTGATGG - Intergenic
1024615612 7:51109072-51109094 TGAATGGCCCAGTGTTCTGATGG + Intronic
1024963002 7:54997034-54997056 TCCATGGCAGAGTGCTCTGATGG - Intergenic
1026362973 7:69619678-69619700 TGAATGAATGAGTGGGCAGACGG - Intronic
1026452872 7:70544782-70544804 TGAATGGCTGCGGGGTGTGCTGG + Intronic
1028440041 7:90849139-90849161 TGAATGGCTTGGTGCTCTTACGG + Intronic
1028986322 7:97011697-97011719 TAAATGGCTCAGTGGTTTCAAGG - Intergenic
1029599765 7:101556882-101556904 TGAATGACTGAGTGGATGGATGG + Intronic
1032565812 7:132941699-132941721 GGGATGGCTGAGTGATCTGATGG + Intronic
1034042406 7:147893531-147893553 TATATGGCAGACTGGTCTGATGG + Intronic
1035288676 7:157823042-157823064 TGAATGGATGAGTGGATAGAAGG - Intronic
1035483003 7:159202291-159202313 TGAATGGCTGACTCTCCTGAAGG + Intergenic
1035773474 8:2169044-2169066 TGAAGGGCTGAGTGGACTTGCGG + Intergenic
1036663034 8:10720683-10720705 TGAATGGCTGGCTGGATTGATGG + Intergenic
1037379785 8:18273171-18273193 TGCATGGCTGAGTTCTCTGAAGG - Intergenic
1038317879 8:26502921-26502943 TGAATCTTTGAATGGTCTGAAGG - Intronic
1040947955 8:52904537-52904559 TCAATGGCTTAGTAGTCAGAAGG - Intergenic
1042694638 8:71543308-71543330 TGAACTGCAGAGTGGCCTGAGGG + Intronic
1042788090 8:72572213-72572235 TTCATGGCTGAGTCCTCTGAGGG + Intronic
1042860189 8:73305134-73305156 TGAATGGCTAAGGGCTCTGCCGG - Intronic
1043427980 8:80167435-80167457 GGAATAGCTGAGTGGTAGGAGGG - Intronic
1045979326 8:108166333-108166355 TAAATGACTGAGTGGGATGATGG + Intergenic
1046353504 8:113047086-113047108 GGAAGTTCTGAGTGGTCTGAGGG + Intronic
1049364568 8:142230880-142230902 TGGATGGATGAGTGGGCTCATGG - Intronic
1049417244 8:142500676-142500698 TGACTGACTGACTGTTCTGAAGG + Intronic
1049477147 8:142802046-142802068 TGGATGGCTGAGTGGGTGGATGG + Intergenic
1051710995 9:19930711-19930733 AGAATTCCTGAGTGGTCTGCAGG - Intergenic
1053799897 9:41757650-41757672 TGAATGGATGAGTGGGTGGATGG + Intergenic
1054145287 9:61557181-61557203 TGAATGGATGAGTGGGTGGATGG - Intergenic
1054145335 9:61557380-61557402 TGAATGGGTGGGTGGGTTGATGG - Intergenic
1054188281 9:61969599-61969621 TGAATGGGTGGGTGGGTTGATGG + Intergenic
1054188329 9:61969798-61969820 TGAATGGATGAGTGGGTGGATGG + Intergenic
1054464970 9:65488038-65488060 TGAATGGATGAGTGGGTGGATGG - Intergenic
1054465044 9:65488334-65488356 TGAATGGATGAGTGGGTGGATGG - Intergenic
1054465091 9:65488533-65488555 TGAATGGGTGGGTGGGTTGATGG - Intergenic
1054650196 9:67618823-67618845 TGAATGGATGAGTGGGTGGATGG - Intergenic
1054650233 9:67618977-67618999 TGAATGGGTGGGTGGGTTGATGG - Intergenic
1058703012 9:107616244-107616266 TGAATGAGTGAATGGCCTGATGG - Intergenic
1059745341 9:117194946-117194968 TGAATGAATGAATGGACTGATGG - Intronic
1059747800 9:117219883-117219905 TCAAGGGCAGAGTGCTCTGATGG + Intronic
1060859766 9:126944823-126944845 TCAATGGCTGAATGCACTGAGGG - Intronic
1061256660 9:129457409-129457431 TGGATGGATGAGTGGACGGAGGG + Intergenic
1061398817 9:130357431-130357453 TGGATGGATGAGTGGATTGATGG + Intronic
1061950519 9:133933470-133933492 TGAATGGATGAGTGGATGGATGG + Intronic
1061950593 9:133933813-133933835 TGAATGGATGAGTGGATGGATGG + Intronic
1062100612 9:134726447-134726469 TGAATGGATGAGTGGATGGATGG + Intronic
1062148509 9:135004790-135004812 TGAATGGATGAGTGGATGGATGG + Intergenic
1062172269 9:135141559-135141581 TGGATGGATGAGTGGACAGATGG + Intergenic
1062210581 9:135361644-135361666 TGAATGGATGAGTGGGTGGAAGG + Intergenic
1185495281 X:549939-549961 TGGATGGATGAGTGGACGGATGG - Intergenic
1185632401 X:1524697-1524719 TGAATGGATGAGTGGATGGATGG - Intronic
1185632416 X:1524773-1524795 TGAATGGATGAGTGGATGGATGG - Intronic
1185632430 X:1524841-1524863 TGAATGGATGAGTGGATGGATGG - Intronic
1185883218 X:3758995-3759017 TGAATGGATGAGTGGGTGGATGG - Intergenic
1186166655 X:6833572-6833594 TGAATGGATGAATGGTTGGATGG + Intergenic
1187230759 X:17420534-17420556 TGAATGGATGGGTGGACTGGTGG - Intronic
1188517864 X:31006595-31006617 TGAATGGTTAAGTGGTGTAAAGG - Intergenic
1188522939 X:31058937-31058959 TGAGTGGCTGAGTGGACCGGAGG + Intergenic
1189279994 X:39814298-39814320 TGAATGCCTCCGTGGTCTGAGGG + Intergenic
1190245213 X:48686264-48686286 TGCATGGATGTGTGGACTGATGG + Intronic
1190245398 X:48687418-48687440 TGAATGGATAAGTGGTTGGATGG + Intronic
1190311974 X:49123128-49123150 GGAGTGTCTGAGGGGTCTGAGGG - Intronic
1190381203 X:49841110-49841132 TGAATGTCTGGGTGGTCTTGGGG - Intergenic
1190689387 X:52900860-52900882 TGAGTGGTTGTGTGATCTGAGGG + Intronic
1190696596 X:52954932-52954954 TGAGTGGTTGTGTGATCTGAGGG - Intronic
1192250833 X:69412198-69412220 ACAATGGCTGAGATGTCTGAAGG - Intergenic
1193158446 X:78199991-78200013 TGAATGAATGAGCTGTCTGAAGG - Intergenic
1195883663 X:109618651-109618673 GGAATGGCTGAGGGGAATGAGGG - Intergenic
1198079146 X:133222558-133222580 TGCATGTCTGAGTGTTCTTATGG + Intergenic
1200918579 Y:8592978-8593000 TGAGTTGCTGAGTGGTCTTTAGG - Intergenic
1202596341 Y:26544511-26544533 TGAGTGCCTCAGTGGCCTGATGG - Intergenic