ID: 1073466381

View in Genome Browser
Species Human (GRCh38)
Location 10:103696774-103696796
Sequence GCAGAGAATGAATGGCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073466381_1073466388 7 Left 1073466381 10:103696774-103696796 CCACTCAGCCATTCATTCTCTGC 0: 1
1: 0
2: 1
3: 37
4: 369
Right 1073466388 10:103696804-103696826 CCAGGGGTGACTCAAACCACAGG No data
1073466381_1073466386 -9 Left 1073466381 10:103696774-103696796 CCACTCAGCCATTCATTCTCTGC 0: 1
1: 0
2: 1
3: 37
4: 369
Right 1073466386 10:103696788-103696810 ATTCTCTGCAGCTGGTCCAGGGG No data
1073466381_1073466385 -10 Left 1073466381 10:103696774-103696796 CCACTCAGCCATTCATTCTCTGC 0: 1
1: 0
2: 1
3: 37
4: 369
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466381_1073466390 29 Left 1073466381 10:103696774-103696796 CCACTCAGCCATTCATTCTCTGC 0: 1
1: 0
2: 1
3: 37
4: 369
Right 1073466390 10:103696826-103696848 GTACAGTGACCCACAGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073466381 Original CRISPR GCAGAGAATGAATGGCTGAG TGG (reversed) Intronic
900297882 1:1961207-1961229 CCGGAGAATGAATGGGGGAGGGG + Intronic
900900788 1:5514239-5514261 GCAGAGAATGGATGGTAGAGGGG - Intergenic
901002447 1:6155374-6155396 GAAGAGACTCAAGGGCTGAGGGG + Intronic
901454856 1:9357302-9357324 TCAGTGAATGGATGGATGAGTGG + Intronic
902863929 1:19265364-19265386 GCAGAGAATGCATCCCTGATGGG + Intergenic
902935326 1:19760860-19760882 GAAATGAATGAATGACTGAGTGG + Intronic
903547531 1:24135931-24135953 TCAGTAAATGAATGGTTGAGTGG - Intronic
903910694 1:26722745-26722767 GAAGAGAATCATAGGCTGAGTGG + Intronic
904555154 1:31357270-31357292 GCAGAGAATGTGTCCCTGAGTGG - Intronic
906693273 1:47806972-47806994 GCTCAGGAAGAATGGCTGAGTGG - Intronic
907325209 1:53633455-53633477 GGTGTGAATGAGTGGCTGAGGGG + Intronic
907457583 1:54585361-54585383 GCAGGGAAGGGATGCCTGAGGGG + Intronic
911075126 1:93865764-93865786 TCAGAGAATGAGTGGCTGAAAGG + Intergenic
911683778 1:100749496-100749518 TGAAACAATGAATGGCTGAGTGG - Intergenic
912204673 1:107496630-107496652 TTAGAGAATGAATGTCTGAGGGG - Intergenic
914883073 1:151562617-151562639 CCAGAGAATGACCAGCTGAGTGG - Exonic
914953699 1:152142987-152143009 ACAAAGAATAAATGCCTGAGGGG + Intergenic
915607956 1:156965934-156965956 GTAGTGAATGAATGACTGAATGG - Intronic
917415089 1:174800618-174800640 GCCGAGAAGGAAATGCTGAGTGG + Intronic
917481180 1:175413572-175413594 GAAGAGAGTGAAGGGCAGAGAGG - Intronic
917724960 1:177819497-177819519 GCAAAGAATGAAGGGCAGAGCGG + Intergenic
917979030 1:180258197-180258219 GCAGGGAAGGAAGTGCTGAGGGG + Intronic
918859129 1:189798939-189798961 GTACAGAATGCATGGCTGGGAGG + Intergenic
919726941 1:200890929-200890951 GAAGTGAATGAATGGATGAACGG + Intergenic
920399952 1:205670319-205670341 CCAGAGAATCAAAGACTGAGTGG - Intronic
920500154 1:206480562-206480584 GCAGACAAGGCAGGGCTGAGAGG - Intronic
921413660 1:214865864-214865886 GCAGAGAAGAAATGGGAGAGTGG - Intergenic
921895284 1:220393535-220393557 GCAGACAATGAATGAAAGAGTGG - Intergenic
1064982221 10:21175659-21175681 GCAGTGAGTGAGTGGCTCAGGGG - Intergenic
1066237431 10:33499837-33499859 TAGGAGAATGAATGGCTTAGGGG + Intergenic
1066512536 10:36117851-36117873 GAGGAGAAGGAAGGGCTGAGAGG - Intergenic
1066622678 10:37374764-37374786 GCAGACAGTGAATGGCGCAGTGG - Intronic
1066657148 10:37706387-37706409 GCAGAGCATGGATGCCTGATTGG - Intergenic
1067774092 10:49149393-49149415 GCAGAGAATGAAATGCCAAGGGG - Intergenic
1069373126 10:67767860-67767882 GCAGAAAATGATGGGGTGAGAGG - Intergenic
1070216142 10:74383435-74383457 GAAGAAGATGAATGGCAGAGAGG - Intronic
1072338636 10:94423825-94423847 TCAGAGAAGGAATGGCAGAGTGG + Intronic
1073267854 10:102239157-102239179 TCAGAGAATGATTGGCAGAATGG - Intronic
1073466381 10:103696774-103696796 GCAGAGAATGAATGGCTGAGTGG - Intronic
1073824339 10:107303341-107303363 GAAAAGAATGAATTGCTAAGTGG - Intergenic
1074254531 10:111787229-111787251 TCAAAGAATAAATGCCTGAGGGG - Intergenic
1075258821 10:120945628-120945650 GCAATGAATGAATTGCTGAGTGG - Intergenic
1076272764 10:129169195-129169217 GCAGAGAATACAGGGCTGTGAGG + Intergenic
1076979893 11:198693-198715 CCAGAGGGTGAAGGGCTGAGGGG - Intronic
1077972943 11:7214794-7214816 GGAGAGATTGAATGGCTGGTTGG - Intergenic
1078600685 11:12727701-12727723 GCACAGAATGAATTACAGAGTGG + Intronic
1081569503 11:44280851-44280873 GCAGAGGTTGAAGGGCTCAGTGG - Intronic
1081632985 11:44701914-44701936 ACAGAGAATGGAAGGCTCAGAGG - Intergenic
1081634276 11:44710597-44710619 GGAGGGAATGAATGGATGAATGG - Intergenic
1083446898 11:62714155-62714177 GTAGAGAATGAATAGAAGAGGGG - Exonic
1083600364 11:63943558-63943580 GCAGTGAATAAAGGGCAGAGGGG - Intronic
1083759248 11:64806774-64806796 GCAGAAAAGGCAGGGCTGAGGGG + Intronic
1084658804 11:70535337-70535359 GTAGATAATGAATGGATGAATGG - Intronic
1085710348 11:78823655-78823677 GAAGAGAATGAATGAATGAAAGG + Intronic
1087146792 11:94821136-94821158 GCAGAGAAGGAGTCTCTGAGAGG - Intronic
1088357901 11:108962280-108962302 GCAAAGATTTAATGGCAGAGTGG - Intergenic
1090437719 11:126700739-126700761 GGAGAGAATGACAGGCGGAGAGG - Intronic
1090741821 11:129669088-129669110 GCAGAAAATGGATGGGGGAGTGG - Intergenic
1090803345 11:130188110-130188132 GCAGAAAGTGAATGGCTTGGAGG + Exonic
1091395430 12:151551-151573 AGAGAAAATGAATGGCAGAGGGG - Intronic
1091952577 12:4607265-4607287 GCACAGATTCAAAGGCTGAGGGG - Intronic
1092765192 12:11846733-11846755 TGAGTGAATGAATGGCTGTGAGG - Intronic
1093520434 12:20043949-20043971 GAAGAAAATGAGTGGTTGAGGGG - Intergenic
1093786724 12:23200375-23200397 GAAGATAAAGAAAGGCTGAGGGG - Intergenic
1094045184 12:26159183-26159205 ACAGAGGGTGAAGGGCTGAGAGG + Intronic
1094114506 12:26895920-26895942 ACAGAGAATAAATTCCTGAGGGG - Intergenic
1094234237 12:28145439-28145461 GCTGAGACTGAATGACTGATTGG + Intronic
1095220609 12:39609154-39609176 GCATTGAATGGATGGATGAGTGG + Intronic
1096095688 12:48934205-48934227 GCAGAGAATGAATGTATGTGTGG - Intronic
1096428371 12:51523030-51523052 GGAGACAATGAAAGGCTGATCGG - Intergenic
1096748643 12:53744885-53744907 GCAGAGAGAGAATGGCAGGGAGG - Intergenic
1097920969 12:65073225-65073247 TAAGAGAATGAATGGCTGGCAGG - Intronic
1097936915 12:65262736-65262758 GCAGAGAATGAATGAGGAAGCGG + Intergenic
1100138262 12:91583153-91583175 ATAGAGAATGAGTGACTGAGAGG - Intergenic
1100228131 12:92579641-92579663 GCAGAGAATGTATGGCAGGCTGG - Intergenic
1100924099 12:99524262-99524284 GCAAAGAATGAATGACAGAAAGG + Intronic
1101232672 12:102757131-102757153 TCAGAGACTGAATGGTGGAGAGG - Intergenic
1101430643 12:104624067-104624089 GTGGAAAATGAATTGCTGAGCGG + Intronic
1103428693 12:120862606-120862628 GCAAGGAATGGAGGGCTGAGAGG + Intronic
1105280449 13:18959926-18959948 GCAGAGAAGGACTGGGGGAGTGG - Intergenic
1106241695 13:27918292-27918314 GCAGAGAGTGAAAGGCCGTGGGG - Intergenic
1106434573 13:29712411-29712433 GGAGAGCATGAATGGCAAAGAGG - Intergenic
1106522051 13:30506658-30506680 GGAGAGAAGGGAAGGCTGAGAGG - Intronic
1106525298 13:30535144-30535166 GCAGAAAGAGAAAGGCTGAGTGG - Intronic
1107226669 13:38057715-38057737 GAAGAGAAGGAATGGCAGAATGG + Intergenic
1108748823 13:53425072-53425094 TCAGTGACAGAATGGCTGAGTGG + Intergenic
1109866796 13:68274883-68274905 GTAGAGGAAGCATGGCTGAGAGG + Intergenic
1109906385 13:68847005-68847027 GTACAGAAAGAATGGCTGAAAGG - Intergenic
1110351875 13:74518310-74518332 TGAGAGAAGGAATGGCTGACAGG - Intergenic
1110437353 13:75489765-75489787 GCAGAGAATGAATGGAATACAGG + Intergenic
1112356015 13:98675471-98675493 GCAGAGAGTGCCTGGCAGAGGGG - Intergenic
1113261854 13:108573712-108573734 GCAGAATATGAAAGTCTGAGAGG - Intergenic
1113912642 13:113851026-113851048 GGAATGAATGAATGGATGAGTGG + Intronic
1114247446 14:20927932-20927954 GCACAGGAAGCATGGCTGAGGGG + Intergenic
1114516937 14:23306646-23306668 GCAAAGAAGGGCTGGCTGAGAGG - Intronic
1115146451 14:30231934-30231956 GTAGAAAATGAATGGGTGTGGGG - Intergenic
1117234324 14:53755131-53755153 ACAAAGAATAAATGCCTGAGGGG + Intergenic
1117881195 14:60315236-60315258 CCAGAGAATGAACGGCAGGGTGG + Intergenic
1118028231 14:61792875-61792897 GAAGAGAATGAAAGTTTGAGTGG + Exonic
1118407281 14:65438279-65438301 GCAGAGAATGAATATGTGAGGGG - Intronic
1118537641 14:66785892-66785914 GCAGTGAAAGCAGGGCTGAGAGG + Intronic
1119609315 14:76048328-76048350 GCAGAGACTGGCTGGCTCAGGGG - Intronic
1119653095 14:76397385-76397407 GCAGAGAAGGAAAGTCAGAGCGG - Intronic
1120195178 14:81474002-81474024 ACAGAGACAGAATGGCTTAGTGG + Exonic
1120197966 14:81507021-81507043 GCAGTGAATGAAAGGCTCATGGG + Intronic
1120399592 14:84012516-84012538 GCAGATAATGGATGGCTAAATGG - Intergenic
1120766981 14:88337137-88337159 GCAGAGAATGGAAGGGAGAGAGG + Intergenic
1121007530 14:90499917-90499939 TCAGAGAATGAGAGGCAGAGAGG + Intergenic
1121447953 14:93990039-93990061 TAAGAGATTGAATGGGTGAGAGG - Intergenic
1121781906 14:96627498-96627520 ACAGAGAATGAAAGGCAGAGAGG + Intergenic
1123183290 14:106489744-106489766 GCAGAGAAGGAGTAGCGGAGGGG + Intergenic
1123501544 15:20888057-20888079 ACAAAGAATAAATGCCTGAGGGG + Intergenic
1123558797 15:21461756-21461778 ACAAAGAATAAATGCCTGAGGGG + Intergenic
1123595026 15:21899037-21899059 ACAAAGAATAAATGCCTGAGGGG + Intergenic
1125901571 15:43352897-43352919 GGAGAGAATAACTGGCTGAGGGG + Exonic
1126499800 15:49332902-49332924 GCAGAGAGAGAATGAGTGAGGGG - Intronic
1128301656 15:66569974-66569996 GCAGAGCATGTATGGAGGAGGGG - Intergenic
1128906972 15:71475992-71476014 ACAGTTAGTGAATGGCTGAGTGG - Intronic
1129001961 15:72342672-72342694 GCAGGGAATGGATGGCTGCGCGG - Exonic
1129098452 15:73234872-73234894 ACAGAGAATGAGTGGTGGAGTGG - Intronic
1130027279 15:80280760-80280782 TCAGTGAATGAATGGATGGGTGG + Intergenic
1132134135 15:99316639-99316661 GTAGAGAATTAATGGATGATAGG + Intronic
1202967145 15_KI270727v1_random:188915-188937 ACAAAGAATAAATGCCTGAGGGG + Intergenic
1132749294 16:1450075-1450097 GCAGAGAAGGAAGGCCTGCGGGG + Intronic
1132843260 16:1988832-1988854 GTAGAGAATGAATGACACAGAGG + Intergenic
1132941708 16:2511784-2511806 GCAGAAAATGAATGGGTAAGAGG + Intronic
1133072191 16:3254102-3254124 GCAGAGAAAGAATGGCTGGCCGG - Intronic
1133499470 16:6352167-6352189 GCAGAGAATATAGGGCTGGGAGG - Intronic
1133898779 16:9953659-9953681 GCAGAGAAGGAATGTAGGAGAGG + Intronic
1134633861 16:15777553-15777575 ACAGGAAATGAATTGCTGAGAGG + Intronic
1135794393 16:25427108-25427130 GTAGAGCATGAATGGAAGAGAGG - Intergenic
1137645274 16:50067677-50067699 GCAGAGAATGGACTGCAGAGGGG + Intronic
1138157860 16:54722507-54722529 GCAGAGGAGGAATGAATGAGTGG + Intergenic
1138345454 16:56317491-56317513 GGAGAGAATGAATGGGTGGGAGG + Intronic
1139079652 16:63500498-63500520 TGAGTGAATGAATGGCTGAATGG + Intergenic
1139428851 16:66900387-66900409 GCAGAGATGGAGTGGCAGAGGGG + Intergenic
1141669552 16:85484748-85484770 GCAGAGGTGGAGTGGCTGAGAGG - Intergenic
1143137415 17:4719623-4719645 GCAGAGAAGGAAGGGATGGGGGG + Intronic
1143750969 17:9027501-9027523 CCATAGAATGAATGGATGGGTGG + Intronic
1143770392 17:9164840-9164862 GCAGAGAATGAATGGGAAGGTGG + Intronic
1145261326 17:21356484-21356506 ACAGGGGATGAATGGGTGAGTGG - Intergenic
1145261334 17:21356526-21356548 GCAGGGCATGAATGGGTGAGTGG - Intergenic
1145271515 17:21407316-21407338 GGAGTGAATGAGTGGATGAGTGG - Intronic
1145309729 17:21694764-21694786 GGAGTGAATGAGTGGATGAGTGG - Intronic
1146408014 17:32556378-32556400 GCTCTGAATGAATGGGTGAGTGG + Intronic
1146689945 17:34866451-34866473 GCAGAGAATCATTTGCTTAGCGG + Intergenic
1147135263 17:38430367-38430389 GCAGAGAAGGACTGGGTGGGGGG + Intronic
1148088655 17:45009530-45009552 GCAGACATTGATTGGCTGAGAGG - Intergenic
1148333979 17:46829524-46829546 CCTGAGAATGAAGGGCAGAGGGG - Intronic
1148740175 17:49888260-49888282 GCAGAGCAGGAATGGTTGATGGG - Intergenic
1150563983 17:66321860-66321882 TCCCAGAATGAAGGGCTGAGGGG + Intronic
1151538404 17:74751484-74751506 GCAGAGAGTGGTTGGCTGGGTGG + Intronic
1152571609 17:81123600-81123622 TCAGTGAATGAATGAATGAGTGG - Intronic
1152784724 17:82241756-82241778 GCACAGCCAGAATGGCTGAGAGG + Intronic
1153348947 18:4057923-4057945 GCAGAGCCTCTATGGCTGAGAGG - Intronic
1154371672 18:13768970-13768992 ACAGATAAAGAAGGGCTGAGTGG + Intergenic
1155168039 18:23247070-23247092 AGAAAGAATGAGTGGCTGAGGGG + Intronic
1156460386 18:37318380-37318402 GGAGAGAAGGAATGGGAGAGGGG - Intronic
1156817016 18:41323845-41323867 GCACAGGATGAATGGCTCATAGG + Intergenic
1157196102 18:45621445-45621467 GCAGAAAATGCATGGCTGGTGGG + Intronic
1159503444 18:69303259-69303281 ATGGGGAATGAATGGCTGAGGGG + Intergenic
1159936450 18:74371946-74371968 GCAGAGGATGCAGGGGTGAGAGG + Intergenic
1162677106 19:12307385-12307407 GCAGAGAATAGATGGTAGAGGGG - Intergenic
1163979002 19:20880855-20880877 GTGGAGAATGAGTGGCTGACAGG - Intergenic
1163982469 19:20913961-20913983 GTGGTGAATGAGTGGCTGAGAGG - Intergenic
1165339595 19:35201522-35201544 GCAGAGACTTAAAGGATGAGGGG - Intergenic
1165812509 19:38620064-38620086 GCAGTGACTGACTGGCTCAGAGG + Intronic
1166059991 19:40320220-40320242 GAGGAGAAGGAATGGCTGGGAGG - Exonic
1167148459 19:47695863-47695885 ACCGAGAATGAAAGGGTGAGAGG + Intronic
1167798390 19:51725395-51725417 GCAGAGAGAGAATGGCTGTGAGG - Intergenic
926609330 2:14930063-14930085 GCACAGGAAGAATGGCTGGGAGG - Intergenic
927155999 2:20222199-20222221 GGAGTGACTGAATGGGTGAGGGG - Intronic
929036688 2:37699875-37699897 ACAGAGAAGGAATGGATTAGAGG + Intronic
929755775 2:44763136-44763158 TCAGTGAATGAATGGATGATGGG + Intronic
929781655 2:44961103-44961125 GCAGAGAATCAATGTCTGGGAGG - Intergenic
931082782 2:58794202-58794224 TCCTAGAATGAATGGCTAAGTGG - Intergenic
931457133 2:62419300-62419322 ACATAGAATGACTGGCTGAATGG + Intergenic
931694489 2:64861435-64861457 GCTGAGAACGAAGGCCTGAGGGG - Intergenic
931892635 2:66691051-66691073 GCAGAGAATTAATGGCATGGGGG + Intergenic
931923840 2:67049380-67049402 GGTGAGAAAGAATGGGTGAGAGG + Intergenic
932492256 2:72130002-72130024 GCAGAGAAGGAAAAGCTGAGGGG - Exonic
933460239 2:82573850-82573872 ACAGAGGATCAATGGCTGCGAGG - Intergenic
934036895 2:88095755-88095777 GTGGAGGATGCATGGCTGAGAGG + Intronic
934674849 2:96242265-96242287 GAATAGAATGCATGGATGAGAGG - Intergenic
934765557 2:96878288-96878310 GCAGAGAGTGGGAGGCTGAGAGG - Intronic
935057463 2:99580088-99580110 ACAGGCAAAGAATGGCTGAGGGG - Intronic
936541535 2:113355780-113355802 CCAGAGAGTGAAAGGCTGAAGGG - Intergenic
937862123 2:126719373-126719395 GCAGAGTATTAATAGCTCAGCGG + Intergenic
938373446 2:130788483-130788505 GCAGAGAAGGACTGGCACAGGGG + Intergenic
938558810 2:132451470-132451492 TCATTGAATGAATGGATGAGTGG + Intronic
939367936 2:141258861-141258883 GTACAGGAAGAATGGCTGAGGGG - Intronic
940781721 2:157940349-157940371 GGAGAGAATGAATGGGTGATGGG - Intronic
941160566 2:162029955-162029977 GCAGAGGATGGATGGATGGGTGG - Intronic
941525052 2:166597058-166597080 GTACAGAAAGCATGGCTGAGAGG + Intergenic
943298426 2:186166750-186166772 TCAGAGAAGGAAAGCCTGAGAGG - Intergenic
944771315 2:202916858-202916880 ACAGTGAATGTATGGCAGAGGGG - Intronic
945080959 2:206085743-206085765 GCGGAGAATGAAAGGGTGAGTGG - Intronic
945360689 2:208892838-208892860 GCAGAGATTGAAGTGCTGAGAGG - Intergenic
947998421 2:234547748-234547770 GAATAGAATGAATGGCTGAAGGG + Intergenic
1168773585 20:431216-431238 GCAGAGAAGGATGGGCTTAGGGG + Intergenic
1170331822 20:15220903-15220925 GGACAGAATTAATGACTGAGTGG + Intronic
1171112770 20:22499762-22499784 GCTGGGAATGAATTGCTGAGAGG + Intergenic
1172645800 20:36468517-36468539 AGAGAGAATGATTGGCTGGGAGG - Intronic
1172779868 20:37430147-37430169 GAAGTGAATGAATGGATGGGTGG - Intergenic
1172843393 20:37915379-37915401 CCAGAGAATTCATGGCTGAAGGG - Intronic
1173144830 20:40515447-40515469 GTAGAGAATGACTGGGTGAGGGG - Intergenic
1173762883 20:45579341-45579363 GCATAGAATGAGAGCCTGAGTGG - Intergenic
1174860189 20:54084207-54084229 TAAGTGAATGAATGGCTGAGTGG - Intergenic
1174885962 20:54334753-54334775 GCAGAGAGGGAATGACTGGGTGG + Intergenic
1175262756 20:57685005-57685027 GGAGAGGAAGAATGGCTGAGGGG + Intronic
1175288682 20:57857448-57857470 GGAGAGAATGAATAGATGGGTGG - Intergenic
1175448883 20:59045536-59045558 GCAGAGGAGGATTGGCTAAGAGG + Intergenic
1175928626 20:62482816-62482838 GCAGAGAAGGAATGAAGGAGCGG - Intergenic
1176697807 21:10001882-10001904 GCTGAGAGTCTATGGCTGAGTGG + Intergenic
1178056775 21:28807888-28807910 ACACAGAAAGACTGGCTGAGTGG - Intergenic
1180118147 21:45725720-45725742 GCTGAGCAGGAGTGGCTGAGGGG + Intronic
1182252401 22:29011452-29011474 GCAGAGAACCAAAGGCAGAGGGG + Intronic
1182839541 22:33376955-33376977 GGAGAGAATGAATGGCAGCTAGG - Intronic
1183066565 22:35367679-35367701 GCAGAGAATGGTTGGCTCATGGG - Intergenic
1183677970 22:39310400-39310422 GCAGGCAAGGAAGGGCTGAGGGG + Intergenic
1184210186 22:43030743-43030765 GCACAGAAGGAATGGGTGAGGGG - Intergenic
1184280696 22:43435878-43435900 TGAATGAATGAATGGCTGAGTGG + Intronic
1184684343 22:46089337-46089359 GCAGGGAGTGAATGGCCCAGTGG + Intronic
1184946821 22:47809602-47809624 GGAGAGAAGGACAGGCTGAGAGG + Intergenic
1184955982 22:47886215-47886237 GCAGAGAGAGGAGGGCTGAGTGG + Intergenic
949609334 3:5688106-5688128 GCACTGAACCAATGGCTGAGAGG + Intergenic
949665859 3:6338579-6338601 TCAGATAATGAAGGGCTAAGCGG - Intergenic
949738126 3:7198373-7198395 GGAGAGAATTAATGACTGGGAGG + Intronic
950443900 3:13025222-13025244 GGGGAGATGGAATGGCTGAGGGG - Intronic
950462317 3:13132679-13132701 TCAGACAATGAATCCCTGAGAGG - Intergenic
951693420 3:25420706-25420728 TCAGAGAGTGAATGGATGGGTGG + Intronic
952415750 3:33090302-33090324 GCTGAGAAAGGATGGCAGAGTGG + Intronic
952455346 3:33467064-33467086 ACAGAGGATAAATGGTTGAGTGG - Intergenic
953670875 3:44960972-44960994 GCAGAGAACTAATGGCTGAAAGG + Intronic
955754242 3:62212057-62212079 GGAGAGAAAGAACGGCTGTGGGG + Intronic
956330986 3:68108012-68108034 GCAGAAAATGACAGGCTGATTGG + Intronic
957276656 3:78098413-78098435 TTAGAGAATGACTGGCTGATAGG + Intergenic
957730505 3:84127324-84127346 AGAGAGAATGAATGTCTGACAGG - Intergenic
958675329 3:97262695-97262717 GCAGAGAATGAAATGAGGAGTGG - Intronic
959145176 3:102535450-102535472 ACAGAGAAAGATTGGCGGAGTGG - Intergenic
959327905 3:104961108-104961130 GCAGAGACTGAATGAGTGAGAGG + Intergenic
960437587 3:117646043-117646065 GGACAGAATGAAAGGCAGAGTGG - Intergenic
962701296 3:138002143-138002165 TCAGAGAATGCTTCGCTGAGAGG - Intronic
962926822 3:140001588-140001610 ACAAAGGATAAATGGCTGAGGGG - Intronic
963766645 3:149343214-149343236 GCAAGAAATCAATGGCTGAGGGG + Intergenic
965686884 3:171313416-171313438 TCACAGAATGAGTGGCAGAGAGG + Intronic
965861125 3:173151805-173151827 TCAAAGGATGAATGCCTGAGGGG + Intergenic
966327752 3:178776156-178776178 GCAGGGATTGAGTGGATGAGTGG - Intronic
966642210 3:182203923-182203945 CCAGAGCAGGAAAGGCTGAGGGG - Intergenic
966762614 3:183430598-183430620 GAAGAGAAGGAATGGAGGAGAGG + Intergenic
967703413 3:192621060-192621082 GAAGAGAATGTAAGGTTGAGGGG - Intronic
967767838 3:193301451-193301473 GGAGAGAATGAATGAATGAGTGG - Intronic
968671364 4:1853583-1853605 GCAGACAAGGAAAGCCTGAGAGG + Intronic
968690984 4:1990053-1990075 GCAGAACAGGAATGCCTGAGAGG + Intronic
969889963 4:10250870-10250892 CCTGAGAAGGAATGGCGGAGAGG + Intergenic
970508266 4:16754959-16754981 GCAGGCAATGCAGGGCTGAGAGG - Intronic
970614203 4:17752392-17752414 GAAAAGAATGAATGGTTGGGTGG + Intronic
970816185 4:20158897-20158919 GTATAGAAGGCATGGCTGAGAGG - Intergenic
972840187 4:42921749-42921771 TCAGAGAATGAATGTTTTAGAGG - Intronic
973631783 4:52826440-52826462 GCAGAGAATGAATTGGGGAGGGG - Intergenic
973793596 4:54401000-54401022 TCAGAGAATGGCTGGCTCAGAGG + Intergenic
976189189 4:82472914-82472936 GCAGGGAATGAATTTCAGAGAGG + Intergenic
978654971 4:111054123-111054145 AAAGACAAAGAATGGCTGAGTGG + Intergenic
980370354 4:131861756-131861778 GCTGAGAGTCTATGGCTGAGTGG + Intergenic
980675135 4:136068550-136068572 GCACAGAATGAATGGCAAATTGG + Intergenic
982950399 4:161687679-161687701 GTAGAGAGAGAATGGCTTAGTGG - Intronic
985705284 5:1396922-1396944 GCAGATACAGAATGGGTGAGGGG + Intronic
985727089 5:1522281-1522303 GAAGAGGAGGAATGGTTGAGGGG + Intronic
986015652 5:3754786-3754808 TCAAAGAATGAACGGGTGAGTGG + Intergenic
987766709 5:22240979-22241001 GAAGAGAAAGAATGGAGGAGAGG + Intronic
988985606 5:36615595-36615617 GCAGAGACTGAAGGGCAGAAGGG - Intronic
990551406 5:56883575-56883597 GAAGACACTGAATGGCTGAAAGG + Exonic
990618327 5:57530916-57530938 GCAGAGAATGAAAGGGGGATGGG + Intergenic
991165608 5:63563176-63563198 GCACAGACTGCTTGGCTGAGTGG + Intergenic
991420183 5:66432872-66432894 GCATAGGAAGCATGGCTGAGAGG + Intergenic
991697377 5:69285859-69285881 GCAGAGTTTGCATGGCTCAGAGG - Intronic
994565385 5:101439520-101439542 GTAGAGGAAGCATGGCTGAGAGG - Intergenic
994992379 5:107013756-107013778 TCAGGGAAAGAATGGCTGTGGGG - Intergenic
995059180 5:107795326-107795348 GCAGTGAATGAATGAATGAATGG - Intergenic
995403694 5:111769644-111769666 GCACAGAAAGCATGGCTGGGAGG + Intronic
995588903 5:113677765-113677787 GCAGAGAAAGAATGTTTGCGAGG + Intergenic
996321109 5:122218194-122218216 GCACAGGATGCATGGCTGGGAGG - Intergenic
997698113 5:135877652-135877674 GCAGTGAATGCAGGGCTGTGTGG - Intronic
997860740 5:137413451-137413473 GCAGATAATTAACAGCTGAGTGG + Intronic
998275892 5:140753276-140753298 GCAGAGACAGCATGGCTCAGGGG + Intergenic
998458808 5:142294375-142294397 GCAGAGACTGAAGAGCAGAGGGG + Intergenic
999062374 5:148650148-148650170 ACAAAGGATAAATGGCTGAGGGG - Intronic
999429184 5:151511323-151511345 GTATAGAATAGATGGCTGAGAGG + Intronic
999517728 5:152317951-152317973 GCAGAGAAGGAATTTCAGAGAGG - Intergenic
1000285032 5:159819596-159819618 TCAGAGAATAAATGCCTGACAGG - Intergenic
1000890680 5:166798230-166798252 GCAAAGAATAAATGCTTGAGGGG - Intergenic
1001659672 5:173381784-173381806 GCAGAGAATCAATGCTTCAGGGG - Intergenic
1002595281 5:180318075-180318097 GCAGAGAAGGAGTCTCTGAGGGG + Intronic
1003005733 6:2379760-2379782 GCAGAGAAGGATTGATTGAGTGG + Intergenic
1004373452 6:15072395-15072417 GCAGGGCATGAAAAGCTGAGAGG - Intergenic
1004821367 6:19371607-19371629 TCAGAGAATGAATGTTTGAATGG + Intergenic
1005384320 6:25270999-25271021 ACAGAGAATGAATTTTTGAGGGG + Intergenic
1006184132 6:32170792-32170814 CCAGGGAATGAAGGCCTGAGTGG + Exonic
1007094117 6:39202908-39202930 ACAGAGAAAGTAAGGCTGAGAGG - Intronic
1007222866 6:40292950-40292972 GTAGTGAATGAATGGATGAATGG + Intergenic
1007937490 6:45746122-45746144 AGAGGAAATGAATGGCTGAGAGG - Intergenic
1008734110 6:54521162-54521184 CTATAGAATGAATGGCTCAGTGG + Intergenic
1008787251 6:55183615-55183637 GCAGAGAATAAATACATGAGGGG + Intronic
1011355815 6:86472491-86472513 AGAAAGAATGAATGACTGAGGGG - Intergenic
1013393692 6:109713292-109713314 GCAGAGGCAGCATGGCTGAGGGG + Intronic
1013704057 6:112811547-112811569 GCAGCCAAGGAATGTCTGAGTGG + Intergenic
1014019208 6:116568175-116568197 GCAGAGAAAGAAGAGCTGTGAGG + Intergenic
1014812692 6:125904225-125904247 GCAGGGAAGGAATTCCTGAGAGG - Intronic
1016378027 6:143443966-143443988 GAAGAGAATGCAGGGCCGAGTGG + Intronic
1017537748 6:155366564-155366586 CCAGAGAATGAAGGGCAAAGGGG - Intergenic
1017915830 6:158831059-158831081 GCACAGAATGAGAGGCTGCGTGG - Intergenic
1018726967 6:166620400-166620422 GCCCACAAGGAATGGCTGAGTGG - Intronic
1019400739 7:851720-851742 GCAGAGAATGCATGGATCTGGGG + Intronic
1019676420 7:2315276-2315298 GCAGTGAGTGAGTGGGTGAGTGG - Intronic
1019676425 7:2315320-2315342 GCAGAGAGTGAGTGGGTGAGTGG - Intronic
1019676431 7:2315392-2315414 GCAGTGAGTGAGTGGGTGAGTGG - Intronic
1019784941 7:2970210-2970232 TGAGTGAATGAATGGATGAGTGG - Intronic
1019917560 7:4143548-4143570 ACAGTGAATGATTGGCAGAGCGG + Intronic
1020126217 7:5533803-5533825 GAGGAGAATGAATGAATGAGGGG + Intronic
1020405622 7:7830384-7830406 GCAGAGAATGAACTTCTGATGGG - Intronic
1021616632 7:22508422-22508444 GCAGAGAATGGGTGGAAGAGAGG - Intronic
1022926439 7:35059635-35059657 GCAGAGAATGGATGGAAGTGAGG - Intergenic
1023116366 7:36866568-36866590 GCAGAGACCGAATGGGTGAGAGG + Intronic
1023545232 7:41311606-41311628 GCACTGAATGAATGAATGAGGGG - Intergenic
1023683965 7:42716576-42716598 GCTGAGAAGGCATGGCTGAAAGG + Intergenic
1024249165 7:47493255-47493277 GCAATGAATGAATGAATGAGAGG - Intronic
1024423991 7:49204595-49204617 GCAGGGACAGAAAGGCTGAGAGG - Intergenic
1024596256 7:50940281-50940303 GCATAGTAAGGATGGCTGAGTGG + Intergenic
1026311686 7:69191313-69191335 ACAGAGAATGGAAGGCTAAGTGG - Intergenic
1026926457 7:74197533-74197555 GCAGACAAAGAAGAGCTGAGTGG + Intergenic
1028375826 7:90145916-90145938 ACAGAGAATGGATGGAAGAGAGG + Intergenic
1029179766 7:98691647-98691669 CCGGAGAATGAATGTCTGATGGG - Intergenic
1029410392 7:100406089-100406111 GCAGAGGCTCAATGGCTCAGGGG - Intronic
1029824442 7:103174320-103174342 GCACAGAATGGATGGAAGAGAGG - Intergenic
1029953490 7:104612368-104612390 GGAGATAATGAATGGGTGGGTGG + Intronic
1031329103 7:120441482-120441504 GCTGAGAATGAATGGCAGAGTGG + Intronic
1033536597 7:142318135-142318157 CCAGAGAATGAAGAGATGAGTGG - Intergenic
1034022512 7:147660617-147660639 TCAGAGAATGAATGAGTGAATGG - Intronic
1034407436 7:150914482-150914504 GCAGAGAAGAAAAGGTTGAGGGG + Intergenic
1035256717 7:157633766-157633788 GCAGAGAAGGAATGGATGTGAGG + Intronic
1035853888 8:2951827-2951849 GAAGAGTATGAATGACAGAGAGG - Intronic
1036255878 8:7206362-7206384 TCAGTGAAGGGATGGCTGAGTGG + Intergenic
1036889365 8:12585889-12585911 TCAGTGAAGGGATGGCTGAGTGG + Intergenic
1037320130 8:17633768-17633790 GAAGAGAATGAAGAGGTGAGGGG - Intronic
1037476836 8:19266021-19266043 GGAGAGAATGCATGGATGTGGGG + Intergenic
1037520149 8:19673159-19673181 GCAGTGGATGAATGGCTGTGTGG - Intronic
1038037419 8:23698319-23698341 GCAGAGAATGAAGTCCAGAGAGG + Intergenic
1038156961 8:25000328-25000350 GGAGAGAATGAATGGTGCAGCGG - Intergenic
1039731054 8:40278693-40278715 GCAGAAAAAGAGTGGATGAGTGG - Intergenic
1039766643 8:40635339-40635361 GGAGAGAATGAGAGGCAGAGAGG - Intronic
1041579415 8:59440533-59440555 GCAAAGAATAAATGCTTGAGGGG - Intergenic
1041873655 8:62663139-62663161 GCAGAGAGTGATTTGATGAGTGG + Intronic
1043311509 8:78865489-78865511 ACAAAGAATAAATGACTGAGTGG - Intergenic
1046699911 8:117388594-117388616 GCAGAGAATGAATCATTGGGAGG - Intergenic
1046833770 8:118776911-118776933 GCAGAGAATAAATAGAGGAGAGG + Intergenic
1047524085 8:125617696-125617718 TCAGAGAAAGAATGACTGATTGG + Intergenic
1048949438 8:139483186-139483208 GCAGAGAAAAAATTACTGAGAGG + Intergenic
1049151844 8:141040257-141040279 GCAGAGAAGGATGGGCTGTGGGG - Intergenic
1049274701 8:141714288-141714310 ACAGACATTGAATGACTGAGAGG + Intergenic
1049495125 8:142926465-142926487 GCAGAGGATGACAGGCTGGGTGG - Intergenic
1051345693 9:16148818-16148840 ACAGAGAATAAATGTTTGAGGGG - Intergenic
1051868812 9:21713489-21713511 GCAGAGAAAGAACCACTGAGAGG + Intergenic
1052892164 9:33711781-33711803 GCAGAAAATGGATGGGGGAGTGG - Intergenic
1053010886 9:34632476-34632498 GCAGAGAGTGAAAGTCTGACTGG + Intergenic
1053166060 9:35844769-35844791 GCAGAGAGGGAAAGGGTGAGGGG - Intronic
1053634930 9:39988245-39988267 GCTGAGAGTCTATGGCTGAGTGG + Intergenic
1053770995 9:41476064-41476086 GCTGAGAGTCTATGGCTGAGTGG - Intergenic
1054208957 9:62262452-62262474 GCTGAGAGTCTATGGCTGAGTGG - Intergenic
1054315858 9:63585688-63585710 GCTGAGAGTCTATGGCTGAGTGG + Intergenic
1054549731 9:66387893-66387915 GCTGAGAGTCTATGGCTGAGTGG - Intergenic
1054960304 9:70960824-70960846 GCACAGAGTGAAAGGCAGAGCGG - Intronic
1055563963 9:77549647-77549669 GCAGAAAATGAAAGGCCCAGTGG + Intronic
1056725312 9:89109269-89109291 GCAGAGGATGCATGGGTGAAGGG + Intronic
1057385955 9:94606236-94606258 GAAGAGAAGAAATGGCTGTGTGG - Intronic
1058212275 9:102184033-102184055 GCAAGGAATGAATGGCTTACTGG - Intergenic
1059006804 9:110411325-110411347 GCAAAGATTGAATGTATGAGAGG - Exonic
1059419887 9:114184250-114184272 GCAGAGGTTGAATGGCTTAAGGG + Intronic
1059942252 9:119369523-119369545 GCCGAAAATGAATGGGGGAGCGG + Intergenic
1061664174 9:132150676-132150698 GGAGAGAATGAATGGATGGACGG + Intergenic
1062620322 9:137417624-137417646 GCAGAGGAGGAACGGCCGAGCGG + Intronic
1185616542 X:1425350-1425372 GCAGAGGGTGAATGACAGAGAGG - Intronic
1186156377 X:6730640-6730662 TCAGAGAAGGTCTGGCTGAGGGG + Intergenic
1187561593 X:20408515-20408537 GCAGAGCATGAAGGGCCAAGGGG + Intergenic
1187720145 X:22141451-22141473 GCCAACAGTGAATGGCTGAGGGG - Intronic
1189467923 X:41291570-41291592 GCAGGGAGTGATTGGGTGAGGGG - Intergenic
1189600787 X:42622848-42622870 ACTGAGAAAGAATGGCTGAAAGG + Intergenic
1189675906 X:43460159-43460181 ACAAAGAATAAATGCCTGAGGGG + Intergenic
1190225991 X:48545556-48545578 GAAGAGAAAAAGTGGCTGAGAGG - Intronic
1191636956 X:63389238-63389260 ACAAAGAATGAATGCTTGAGGGG + Intergenic
1191881574 X:65848172-65848194 GCAGAGCATAAATGCATGAGGGG + Intergenic
1195400200 X:104453425-104453447 TCAGTGAATGAATGGATGACAGG + Intergenic
1196007263 X:110850077-110850099 GCAAAGTCTTAATGGCTGAGTGG + Intergenic
1196223218 X:113136370-113136392 GTACAGAAAGCATGGCTGAGAGG + Intergenic
1196930220 X:120674638-120674660 CCAGAGAATGTATGTCTGAAGGG + Intergenic
1197192057 X:123658657-123658679 GCAGACAATGAAAAGCTCAGTGG + Intronic
1197532195 X:127643116-127643138 GCAGAGAATGAAGTGCAGTGGGG + Intergenic
1197887220 X:131231114-131231136 GCAGAGGATGGATGGGAGAGCGG + Intergenic
1198570706 X:137952965-137952987 ACAGAGAATAAATGATTGAGGGG - Intergenic
1198621397 X:138515056-138515078 GCAGTGAAAGCATGGCTTAGAGG + Intergenic
1198709110 X:139482173-139482195 ACAGAGAATAAATGCTTGAGGGG - Intergenic
1199539595 X:148944404-148944426 GCTGAGAATGAATGATTGAGTGG - Intronic
1199673638 X:150166535-150166557 TCAGGGAATTAGTGGCTGAGTGG - Intergenic
1200311953 X:155086956-155086978 AGAGAGAAGGAAAGGCTGAGAGG + Intronic
1201303346 Y:12529327-12529349 GCTGAGAAGGATTTGCTGAGCGG + Intergenic
1201792957 Y:17862337-17862359 GTAGAAACTGAATGGCTGAATGG - Intergenic
1201808597 Y:18043649-18043671 GTAGAAACTGAATGGCTGAATGG + Intergenic
1202354488 Y:24031581-24031603 GTAGAAACTGAATGGCTGAATGG - Intergenic
1202516291 Y:25638531-25638553 GTAGAAACTGAATGGCTGAATGG + Intergenic