ID: 1073466385

View in Genome Browser
Species Human (GRCh38)
Location 10:103696787-103696809
Sequence CATTCTCTGCAGCTGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073466379_1073466385 -1 Left 1073466379 10:103696765-103696787 CCCATCAGACCACTCAGCCATTC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466377_1073466385 22 Left 1073466377 10:103696742-103696764 CCAAGCTGTGTCCTAAAACAGCT 0: 1
1: 1
2: 0
3: 16
4: 219
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466375_1073466385 26 Left 1073466375 10:103696738-103696760 CCTCCCAAGCTGTGTCCTAAAAC 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466381_1073466385 -10 Left 1073466381 10:103696774-103696796 CCACTCAGCCATTCATTCTCTGC 0: 1
1: 0
2: 1
3: 37
4: 369
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466378_1073466385 11 Left 1073466378 10:103696753-103696775 CCTAAAACAGCTCCCATCAGACC 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466376_1073466385 23 Left 1073466376 10:103696741-103696763 CCCAAGCTGTGTCCTAAAACAGC 0: 1
1: 1
2: 1
3: 22
4: 172
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data
1073466380_1073466385 -2 Left 1073466380 10:103696766-103696788 CCATCAGACCACTCAGCCATTCA 0: 1
1: 0
2: 0
3: 29
4: 344
Right 1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073466385 Original CRISPR CATTCTCTGCAGCTGGTCCA GGG Intronic
No off target data available for this crispr