ID: 1073468237

View in Genome Browser
Species Human (GRCh38)
Location 10:103706895-103706917
Sequence TTCCTGCCTATTTATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073468235_1073468237 18 Left 1073468235 10:103706854-103706876 CCTGATTGTCACAGATGGGTCAG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1073468237 10:103706895-103706917 TTCCTGCCTATTTATGAGGACGG No data
1073468234_1073468237 19 Left 1073468234 10:103706853-103706875 CCCTGATTGTCACAGATGGGTCA 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1073468237 10:103706895-103706917 TTCCTGCCTATTTATGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073468237 Original CRISPR TTCCTGCCTATTTATGAGGA CGG Intronic
No off target data available for this crispr