ID: 1073473651

View in Genome Browser
Species Human (GRCh38)
Location 10:103739221-103739243
Sequence GCCTCACTCAGAGTGCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073473651_1073473661 21 Left 1073473651 10:103739221-103739243 CCAGTCTGCACTCTGAGTGAGGC 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1073473661 10:103739265-103739287 GCTGCCCAGTCCTCCCCACCAGG No data
1073473651_1073473664 28 Left 1073473651 10:103739221-103739243 CCAGTCTGCACTCTGAGTGAGGC 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1073473664 10:103739272-103739294 AGTCCTCCCCACCAGGCTCCTGG No data
1073473651_1073473657 -1 Left 1073473651 10:103739221-103739243 CCAGTCTGCACTCTGAGTGAGGC 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1073473657 10:103739243-103739265 CCACCGGGCCACTGTGCCTGGGG No data
1073473651_1073473655 -2 Left 1073473651 10:103739221-103739243 CCAGTCTGCACTCTGAGTGAGGC 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1073473655 10:103739242-103739264 GCCACCGGGCCACTGTGCCTGGG No data
1073473651_1073473654 -3 Left 1073473651 10:103739221-103739243 CCAGTCTGCACTCTGAGTGAGGC 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1073473654 10:103739241-103739263 GGCCACCGGGCCACTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073473651 Original CRISPR GCCTCACTCAGAGTGCAGAC TGG (reversed) Intronic
901020896 1:6254895-6254917 TCATCACTCATGGTGCAGACCGG + Exonic
901029659 1:6299576-6299598 GCCACACACAGAGGGCAGAGAGG + Intronic
904308973 1:29613171-29613193 TCCTCACTGAGAGAGCTGACAGG - Intergenic
904482130 1:30800711-30800733 GCCTGGCTTAGAGTGCAGATGGG - Intergenic
906017088 1:42591660-42591682 GCCTCACACAGAGTCCCCACTGG + Intronic
906722012 1:48014630-48014652 TCATCACTCAGAGAGTAGACAGG - Intergenic
906952086 1:50343167-50343189 GACTCAGTCAGATGGCAGACAGG + Intergenic
906964588 1:50443950-50443972 GCCTCACTGAGGCTGTAGACGGG - Intronic
909029994 1:70528501-70528523 CCCTCATTCAGAGAGCACACAGG - Intergenic
911223646 1:95278944-95278966 GTATTACTCAGAGTCCAGACAGG - Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
918292536 1:183122654-183122676 GTCTCAGTCAGGGTGCAGAAAGG - Intronic
918668701 1:187185249-187185271 GCCTGACTCAGAGCTCAAACAGG - Intergenic
918708300 1:187696146-187696168 ACCTCCTTCAGACTGCAGACAGG - Intergenic
919823019 1:201484710-201484732 GCCTCACTCAGAGTGGACCAAGG + Exonic
922583590 1:226717493-226717515 GCCTCACCCAGAGTGGGGCCTGG + Intronic
1063638112 10:7804574-7804596 GCCTCACTCAGACTGAAGGAAGG - Intronic
1068550005 10:58396910-58396932 TTCTCACTCTGGGTGCAGACAGG + Exonic
1069676919 10:70255086-70255108 GCCCGACTCAGAGGGCAGCCCGG + Exonic
1071263857 10:83946177-83946199 GCCGCAGACAGAGTGCAGGCAGG - Intergenic
1073473651 10:103739221-103739243 GCCTCACTCAGAGTGCAGACTGG - Intronic
1074158745 10:110820107-110820129 CCCTCAATCAGTGGGCAGACAGG + Exonic
1075017145 10:118918198-118918220 GCCTCACTCAAGTTGCAGGCTGG - Intergenic
1075121981 10:119670941-119670963 GCATGACTCAGGGTGCAGATAGG - Intronic
1080213152 11:29810411-29810433 TCCACACTGAGAGTGCAGTCGGG - Intergenic
1082791114 11:57347400-57347422 TCCTCACTCTGTGGGCAGACGGG - Exonic
1083378021 11:62242090-62242112 GCCCCAGTCAGAGTGCAGGGAGG + Intergenic
1084636206 11:70394529-70394551 CCCTGACTTAGAGTGCAGATGGG - Intergenic
1084658719 11:70534861-70534883 GCCTCACCGAGAGTGCAGTCAGG + Intronic
1087840347 11:102914386-102914408 GCCTGAATCTAAGTGCAGACAGG + Intergenic
1091797261 12:3304421-3304443 GCCTCACTCAGCATTCACACCGG - Intergenic
1092032700 12:5301723-5301745 GCCTCTCTCAGAGTTCATCCAGG - Intergenic
1092995994 12:13951269-13951291 GCCTCAGTCAGTCTGCATACAGG - Intronic
1107375625 13:39801143-39801165 GCCTGACTCAGAGCTCAGATAGG + Intergenic
1109411285 13:61972575-61972597 GCTAGACTCAGAGTGCTGACTGG + Intergenic
1112971728 13:105270363-105270385 GCCTCACACAGAGTCCCCACTGG + Intergenic
1114680457 14:24479803-24479825 GCCCCACACAGAGTCCACACTGG - Intergenic
1121209505 14:92197530-92197552 GCCTGAATCACAGTGCACACAGG + Intergenic
1122037064 14:98956531-98956553 GCCCAAGTCAGAGTGCAGCCTGG - Intergenic
1122572665 14:102717856-102717878 GCCTCACTCAGAGAGGAGGTGGG + Intronic
1122962609 14:105103183-105103205 GCCTGTCTCAGAGTGCGGATGGG + Intergenic
1124024690 15:25954542-25954564 GCCTAACTCGAGGTGCAGACAGG - Intergenic
1124189719 15:27564407-27564429 GACTCATTCTGAGTGCAGCCAGG + Intergenic
1124341210 15:28890165-28890187 CCCTCACTCAGTGGGCAGTCAGG + Intronic
1129525363 15:76210203-76210225 ACCTCACTCAGAGTGAATACAGG - Intronic
1129805762 15:78455903-78455925 GCCTCACTCACATGGCTGACAGG + Intronic
1131520810 15:93113364-93113386 GCCTCACTGAGTGTTCACACTGG + Intergenic
1132652870 16:1029363-1029385 GCCTCACTCCCCGTGCAGCCCGG - Intergenic
1136278408 16:29192737-29192759 GGCCGAGTCAGAGTGCAGACAGG + Intergenic
1137680166 16:50335414-50335436 TCCTTCCTCAGAGTGCAGAATGG + Intronic
1139342333 16:66275912-66275934 GCCTGACTCAGAGCACAGACAGG + Intergenic
1140348203 16:74235310-74235332 ACCTCAGGCAGAGAGCAGACAGG + Intergenic
1142082791 16:88158770-88158792 GGCCGAGTCAGAGTGCAGACAGG + Intergenic
1142567926 17:852665-852687 GGCTGACTCAGAGAGCAGACGGG - Intronic
1144055954 17:11540638-11540660 ACCTAACACAGAGTGTAGACAGG - Intronic
1144187272 17:12808311-12808333 GCCCCACACAGAGTGCCCACTGG - Intronic
1149188102 17:54026100-54026122 GCCTTACACAGAGTAAAGACAGG + Intergenic
1149544227 17:57491235-57491257 GCCTCTCTGAGAGCGCAGTCAGG + Intronic
1150349217 17:64429821-64429843 GCCTCTCTCTGTGTGCAAACTGG - Intergenic
1152080524 17:78184620-78184642 GCTTCACACAGGCTGCAGACTGG - Intronic
1152496507 17:80676555-80676577 GCCTCACTCACTGCGGAGACAGG - Intronic
1152518443 17:80839730-80839752 GCCACGCTCAGAGTACAGAAAGG - Intronic
1154191023 18:12231272-12231294 CCCTACCTGAGAGTGCAGACAGG - Intergenic
1154231311 18:12558643-12558665 GCTACACACAGAGTGCTGACTGG + Intronic
1155806201 18:30174894-30174916 GCCAGACACAGAGTGCTGACTGG + Intergenic
1156051416 18:32939723-32939745 GCATGACTCAGTGTGCAGATAGG + Intronic
1156816504 18:41317577-41317599 GCCTCTCTCAGAAACCAGACAGG + Intergenic
1158925297 18:62251594-62251616 GCATCTCTTTGAGTGCAGACTGG - Intronic
1159439106 18:68455033-68455055 GCCTGAGTCAGAGAGCTGACAGG - Intergenic
1160295827 18:77635972-77635994 GCCTCACTCAGGGTGAATTCCGG + Intergenic
1161332875 19:3696688-3696710 GCCTACAGCAGAGTGCAGACGGG + Intronic
1161492282 19:4568571-4568593 GTGTCACTCAGAGTGCAGTGGGG - Intergenic
1165072028 19:33261245-33261267 ACTTCACTCTGAGTGCAGAGAGG - Intergenic
1166017530 19:39994132-39994154 CCCTCACACAGAGTACACACTGG + Intronic
1166998464 19:46731068-46731090 GCCTCACTCAGACCGCAAACGGG + Intronic
1168013493 19:53553839-53553861 ACCCCACTCAGAGGCCAGACGGG + Intronic
926082939 2:10003492-10003514 GCTTCACTCATAATGTAGACGGG + Intergenic
931489879 2:62733720-62733742 GGTTCTCTCACAGTGCAGACTGG - Intronic
934251123 2:90356271-90356293 GCCTCACTCAGAAAGCACAAGGG - Intergenic
934258439 2:91447139-91447161 GCCTCACTCAGAAAGCACAAGGG + Intergenic
934930725 2:98420537-98420559 GTCTGAGTCAGAGTGCAGTCAGG + Intergenic
935921378 2:108019163-108019185 GCCACACTCACAGGGCAGCCAGG + Intergenic
936000146 2:108819418-108819440 ACCTCACTCAGAGTGCTGAAGGG + Intronic
939125405 2:138172184-138172206 CCCTCACACAGAGTCCTGACTGG + Intergenic
943030976 2:182685655-182685677 CACTCAGACAGAGTGCAGACAGG - Intergenic
948701157 2:239761305-239761327 GCCTCACTCAGAGGTAAGAACGG - Intergenic
1169448353 20:5690759-5690781 GCCTCACTCAAGGTGGTGACAGG - Intergenic
1169680801 20:8211054-8211076 CACACGCTCAGAGTGCAGACAGG - Intronic
1174275275 20:49399089-49399111 GTCTCACTCTGTGTGCAGGCTGG + Intronic
1176711627 21:10155047-10155069 GCCCCACTCAGGGTCCTGACTGG - Intergenic
1177903420 21:26946001-26946023 GCCTCTCCCAGAGAGCTGACAGG - Intronic
1179678167 21:42998959-42998981 GCCTCACACAGAGTCCCTACTGG - Intronic
1179976489 21:44871039-44871061 GCCTCTGTCACAGTGCAGAGTGG - Intronic
1181061173 22:20282738-20282760 GCCTCATTCAGAGGGCAGCATGG + Intronic
1181079385 22:20403843-20403865 GCCTGACTCAGAGGGCAGCCGGG - Intronic
1181349827 22:22246900-22246922 GCCTCACTCAGAGAGGTGCCGGG + Intergenic
1183269220 22:36850268-36850290 CCCCCACTCAGAGTGCATGCTGG + Intergenic
956874222 3:73446181-73446203 GCAGAACTCAGAGTGCTGACGGG - Intronic
962197852 3:133379315-133379337 GGCTCACACAGAGTTCACACAGG + Intronic
965145955 3:164904206-164904228 ACCTAACTCAGAGTCCTGACAGG + Intergenic
965491784 3:169346247-169346269 ACCTCTCTCAGACTGCAGCCAGG + Intronic
966426654 3:179787293-179787315 ACCTCACTTAGAGTGGAGTCAGG - Exonic
967622532 3:191650782-191650804 GGCCCACACAGAGTCCAGACTGG - Intergenic
968635198 4:1674895-1674917 CCCTCACGCAGACTGGAGACTGG - Intronic
968959786 4:3737657-3737679 TCCTCACTTGGAGTGAAGACAGG - Intergenic
969596774 4:8153544-8153566 ACCTCATTCAGAGTGGAGTCAGG + Intronic
970402707 4:15733290-15733312 GCCGGACACAGAGTGCTGACTGG + Intronic
973045488 4:45531132-45531154 GCCAGACACAGAGTGCTGACTGG - Intergenic
974202771 4:58662785-58662807 CCCTCACACAGAGTCCATACTGG - Intergenic
976891917 4:90058958-90058980 GTCTCACTCAGACTGCAGTGCGG - Intergenic
978462551 4:108972732-108972754 GCCCCACTCAGTGTGAAAACTGG + Intronic
980598552 4:134988414-134988436 GCCCCACACAGAGTGCTTACTGG + Intergenic
985718410 5:1475790-1475812 GCCCCACTCGGAGTGGAGATGGG - Intronic
985718431 5:1475858-1475880 GCCCCACTCGGAGTGGAGATGGG - Intronic
985870959 5:2556523-2556545 GCCCCATCTAGAGTGCAGACGGG + Intergenic
988964367 5:36401651-36401673 GCTTCTCTCAAAGTGCAGTCAGG + Intergenic
989139568 5:38189430-38189452 GCCTCACTCCACCTGCAGACAGG + Intergenic
989749252 5:44871555-44871577 GCCTCAGCCAGAGAGCAGAGTGG - Intergenic
995885469 5:116889380-116889402 GCATCTCTCAGAGTGCAGCCAGG - Intergenic
997190617 5:131931453-131931475 GCCTGTCTCAGAGTGCTGATAGG - Intronic
997849702 5:137320253-137320275 GCCTGATTCAGAGTGCTGATGGG + Intronic
998749774 5:145307293-145307315 GCCTCCCTCAGGGTGAGGACTGG - Intergenic
1001707578 5:173752745-173752767 GCCTCACTCACAGTGCATTCTGG - Intergenic
1002599864 5:180347967-180347989 CCCTCACTCAGAGTGAGGGCTGG - Intronic
1002947872 6:1780056-1780078 GCCTCACTCAAAGTGGGGAATGG + Intronic
1003967229 6:11264281-11264303 ATCTCACTCAGACTGCAGCCTGG - Intronic
1004196847 6:13512979-13513001 GCTACACCCAGAGTGCTGACTGG - Intergenic
1006223845 6:32519476-32519498 GCCTGATTCAGAATGGAGACTGG - Exonic
1006611632 6:35297725-35297747 GCCTCACGCAATGTGCAGGCAGG + Intergenic
1008211640 6:48731400-48731422 GCCTCACTTAGAAGGCAGAGTGG + Intergenic
1008368726 6:50710770-50710792 GCCTCAGTCAGAGGCCAGGCCGG - Intergenic
1010878397 6:81138046-81138068 GTCTGACTCAGTGTGGAGACAGG + Intergenic
1018711069 6:166498529-166498551 GACACACGCAGAGTGCCGACTGG - Exonic
1019291639 7:253387-253409 GCCTCCCGGAGAGCGCAGACAGG - Intronic
1021380075 7:19955863-19955885 GCCTCACACAGAGTCCCCACTGG + Intergenic
1023265801 7:38404089-38404111 ACCTCAGTCACACTGCAGACTGG + Intronic
1023511705 7:40959940-40959962 GCCTCACCCAGAGAGCACAAGGG - Intergenic
1024365669 7:48517581-48517603 GCCTCACTAAGGGAGGAGACAGG - Intronic
1024376029 7:48639083-48639105 GCCTCACTCACAGAGGATACAGG + Intronic
1027178520 7:75920888-75920910 GCATCATTCAGAGTGCAGTTTGG + Intronic
1027655631 7:80927127-80927149 GCCAGACACAGAGTGCTGACTGG + Intergenic
1034038777 7:147854358-147854380 TCAGCACTCAGAGTGCAGAAGGG - Intronic
1034393598 7:150803558-150803580 GTCTCTCTCAGAGTCCAGTCGGG - Intronic
1035443196 7:158921186-158921208 GCCTCACTGTGAGTGAAAACCGG + Intronic
1035451595 7:158980485-158980507 GCCTCACTCAGAGGTGAGAAGGG - Intergenic
1035455319 7:159005183-159005205 GTCTCACTCTGTGTGCAGACTGG - Intergenic
1035760053 8:2062302-2062324 GGATCACTCTGACTGCAGACAGG + Intronic
1037194601 8:16173279-16173301 GGCTCGTGCAGAGTGCAGACAGG - Intronic
1040091257 8:43401072-43401094 GCCCCACACAGAGTGCCCACTGG - Intergenic
1042886155 8:73554385-73554407 GCCAGTCTCAGAGTGCTGACAGG - Intronic
1043270660 8:78329391-78329413 GCTACACACAGAGTGCTGACTGG + Intergenic
1046498837 8:115048696-115048718 GCCTATCTCAGAGTGCTGAAAGG + Intergenic
1047480078 8:125273764-125273786 TCCTCACTCATATTGCAGATTGG + Intronic
1049225418 8:141448421-141448443 GCCTCCCTCAGACCGCACACTGG + Intergenic
1049446981 8:142635714-142635736 GCATCACCCAGAGTGAAGCCAGG + Intergenic
1050828742 9:9984495-9984517 GCAACATTCAGAGTGCAGATTGG + Intronic
1052072584 9:24100404-24100426 GCTTCAGTCAGAGGGCAGACAGG - Intergenic
1057002522 9:91524729-91524751 ACCTGACTCAGAGTTCAGATAGG + Intergenic
1057456643 9:95219087-95219109 GCCTGACTCAGAGTTCGGATGGG + Intronic
1059458459 9:114414536-114414558 TCCTCACTCAGAGGGCAGCTGGG + Intronic
1060048002 9:120355971-120355993 GCCTCACTAAGAGTCCACAGAGG - Intergenic
1060673952 9:125495390-125495412 CCCTCACTTAGAGCCCAGACAGG + Intronic
1062501376 9:136853424-136853446 GCCTCACTCAGACCACACACTGG + Exonic
1202796382 9_KI270719v1_random:124036-124058 GCCCCACTCAGGGTCCTGACTGG - Intergenic
1185767431 X:2737025-2737047 ACCTCCCTCAGAATGCAGAGAGG - Intronic
1186245530 X:7612706-7612728 GACACACTCAGAGTGCATATGGG + Intergenic
1187038690 X:15569866-15569888 GCCACACTCTGAGTGAAGCCAGG + Intronic
1187540429 X:20187849-20187871 GTCATACTCAGAGTGCTGACTGG - Exonic
1188049315 X:25465301-25465323 GCCTGACTCAGAGCTCGGACAGG - Intergenic
1193564114 X:83056338-83056360 ACCTCACACAGAGTGCATACTGG - Intergenic
1194606517 X:95985569-95985591 CCCTCACTCAGTGTCCAGAGAGG + Intergenic
1198410273 X:136360205-136360227 CCCTCACTCAGAATGGAGACTGG + Intronic
1200012331 X:153128070-153128092 GCCCCACTCAGAGAGAAGATGGG - Intergenic
1200027269 X:153271849-153271871 GCCCCACTCAGAGAGAAGATGGG + Intergenic
1200356932 X:155562047-155562069 GCCCCACACAGAGTCCACACTGG - Intronic
1200574025 Y:4866549-4866571 GCCTCACTCAGGAAGCAGAAGGG + Intergenic
1200771971 Y:7134790-7134812 GCCTCACTCAGGAAGCACACGGG + Intergenic
1201450060 Y:14102235-14102257 GCGTCACTCACACTGTAGACCGG - Intergenic
1202342723 Y:23886768-23886790 GCCTGACACAGAGTGCTGATTGG + Intergenic
1202528046 Y:25783317-25783339 GCCTGACACAGAGTGCTGATTGG - Intergenic