ID: 1073473950

View in Genome Browser
Species Human (GRCh38)
Location 10:103740842-103740864
Sequence TCCACCCAGCACTGTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073473944_1073473950 -3 Left 1073473944 10:103740822-103740844 CCCTTCCTTCCTTCCCTTGATCC 0: 1
1: 2
2: 63
3: 915
4: 6126
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473942_1073473950 4 Left 1073473942 10:103740815-103740837 CCTTCCACCCTTCCTTCCTTCCC 0: 3
1: 73
2: 2696
3: 45866
4: 48444
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473935_1073473950 28 Left 1073473935 10:103740791-103740813 CCCCCTGCCTTTCCTTCTTTCCT 0: 2
1: 9
2: 128
3: 1201
4: 7863
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473945_1073473950 -4 Left 1073473945 10:103740823-103740845 CCTTCCTTCCTTCCCTTGATCCA No data
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473943_1073473950 0 Left 1073473943 10:103740819-103740841 CCACCCTTCCTTCCTTCCCTTGA 0: 1
1: 5
2: 142
3: 1712
4: 13115
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473946_1073473950 -8 Left 1073473946 10:103740827-103740849 CCTTCCTTCCCTTGATCCACCCA 0: 1
1: 0
2: 16
3: 283
4: 3175
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473940_1073473950 16 Left 1073473940 10:103740803-103740825 CCTTCTTTCCTTCCTTCCACCCT 0: 2
1: 173
2: 3560
3: 44093
4: 40641
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473939_1073473950 21 Left 1073473939 10:103740798-103740820 CCTTTCCTTCTTTCCTTCCTTCC 0: 227
1: 2693
2: 5997
3: 12432
4: 24669
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473941_1073473950 8 Left 1073473941 10:103740811-103740833 CCTTCCTTCCACCCTTCCTTCCT 0: 5
1: 569
2: 38014
3: 35219
4: 49951
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473938_1073473950 25 Left 1073473938 10:103740794-103740816 CCTGCCTTTCCTTCTTTCCTTCC 0: 1
1: 51
2: 890
3: 4654
4: 15573
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473936_1073473950 27 Left 1073473936 10:103740792-103740814 CCCCTGCCTTTCCTTCTTTCCTT 0: 1
1: 6
2: 63
3: 692
4: 4324
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data
1073473937_1073473950 26 Left 1073473937 10:103740793-103740815 CCCTGCCTTTCCTTCTTTCCTTC 0: 1
1: 28
2: 305
3: 1822
4: 6668
Right 1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073473950 Original CRISPR TCCACCCAGCACTGTCTTGA TGG Intronic
No off target data available for this crispr