ID: 1073475204

View in Genome Browser
Species Human (GRCh38)
Location 10:103748046-103748068
Sequence CCATCCTTGCAGGAGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1367
Summary {0: 1, 1: 0, 2: 3, 3: 85, 4: 1278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073475204_1073475209 -4 Left 1073475204 10:103748046-103748068 CCACCCATCTCCTGCAAGGATGG 0: 1
1: 0
2: 3
3: 85
4: 1278
Right 1073475209 10:103748065-103748087 ATGGTGACAGTAACATTAAGAGG No data
1073475204_1073475210 20 Left 1073475204 10:103748046-103748068 CCACCCATCTCCTGCAAGGATGG 0: 1
1: 0
2: 3
3: 85
4: 1278
Right 1073475210 10:103748089-103748111 CGTAACATTCATTGAGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073475204 Original CRISPR CCATCCTTGCAGGAGATGGG TGG (reversed) Intronic
900761997 1:4479118-4479140 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
901839391 1:11944588-11944610 CCGTCCTGGCAGGAGCTCGGGGG + Intronic
903490242 1:23722874-23722896 ACAGCTCTGCAGGAGATGGGTGG + Intergenic
904849958 1:33451158-33451180 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
905396316 1:37668965-37668987 CCATGCTGGGAGGAGATGGATGG - Intergenic
906289405 1:44610139-44610161 CCATCTTTGCATGGGAGGGGAGG + Intronic
906360667 1:45155329-45155351 CCATTCTTGCAGGAGTAAGGTGG - Intronic
906563281 1:46777033-46777055 CCATTCTTGCAGGAGTAAGGTGG + Intronic
906592770 1:47043145-47043167 CCATTCTTGCAGGAGTAAGGTGG + Intronic
906702111 1:47867028-47867050 ACTTCCTTGCAGGAGACAGGCGG - Intronic
906718047 1:47984834-47984856 GCATCCGTGCAGGTGTTGGGAGG - Intronic
906808011 1:48798166-48798188 CCATTCTTGCAGGAGTAAGGTGG + Intronic
906816071 1:48880654-48880676 CCATTCTTGCAGGAGTAAGGTGG + Intronic
906876688 1:49546695-49546717 CCATTCTTGCAGGAGTAAGGTGG + Intronic
906956133 1:50376254-50376276 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
907095856 1:51780174-51780196 CCATTCTTGCAGGAGTAAGGTGG - Intronic
907291616 1:53417166-53417188 CCAGCCTGGTAGGAGGTGGGAGG + Intergenic
907316140 1:53574013-53574035 CTATCTTTGCAGGAGCTGGCTGG - Intronic
907420257 1:54342375-54342397 CCTCCCTGGGAGGAGATGGGTGG + Intronic
908668044 1:66514242-66514264 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
908883901 1:68765651-68765673 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
909098522 1:71320510-71320532 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
909234450 1:73134643-73134665 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
909405460 1:75283185-75283207 CCATTCTTGCAGGAGTAAGGTGG + Intronic
909623599 1:77691670-77691692 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
909667249 1:78148834-78148856 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
910078092 1:83304316-83304338 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
910157926 1:84241246-84241268 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
910373643 1:86545773-86545795 CCATTCTTGCAAGAGTAGGGAGG - Intergenic
910387272 1:86698653-86698675 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
910406893 1:86899645-86899667 CCATCCGGGAGGGAGATGGGGGG - Intronic
910544023 1:88394035-88394057 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
910653237 1:89592530-89592552 ACATCCTTGCTGTATATGGGTGG - Intronic
910708108 1:90151172-90151194 CCATCCTTGCAGGAGTAAGGTGG + Intergenic
911255179 1:95625000-95625022 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
911384140 1:97153943-97153965 CCATTCTTGCAGGAGTGAGGTGG - Intronic
911562449 1:99423025-99423047 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
912161554 1:106992139-106992161 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
912180617 1:107214820-107214842 CCATTCTTGCAGGAGTGAGGTGG + Intronic
912237761 1:107870324-107870346 CCATTCTTGCAGGAGTAAGGTGG + Intronic
912284444 1:108354135-108354157 CCATGCTTGCAGGAGTAAGGCGG - Intergenic
912348574 1:108989399-108989421 TCCTCCTTGCAGGAGTAGGGGGG + Intronic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
912941300 1:114047665-114047687 GGATCCTTGCAGCAGAGGGGTGG - Intergenic
912981984 1:114383047-114383069 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
913080394 1:115379634-115379656 CCATTCTTGCAGGAGTAAGGCGG + Intergenic
913143655 1:115967387-115967409 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
913206993 1:116547989-116548011 CCATTCTTGCAGGAGTAAGGTGG + Intronic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
913339310 1:117742036-117742058 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
913464151 1:119122346-119122368 CCATTCTTGCAGGAGTAAGGTGG - Intronic
914231041 1:145764785-145764807 CCATCCGGGAGGGAGATGGGGGG + Intronic
914569643 1:148903095-148903117 CCATTCTTGCAGGAGTAAGGTGG + Intronic
914603186 1:149227163-149227185 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
915018061 1:152755072-152755094 CCATTCTTGCAGGAGTAAGGTGG + Intronic
915514363 1:156404130-156404152 CCAACCTTGCAGCAGAAGCGGGG - Intergenic
915589944 1:156864944-156864966 CCATCCCTGAGGGAGATGGGAGG - Intronic
915643408 1:157248142-157248164 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
915675802 1:157529250-157529272 CCATTCTTGCAGGAGTAAGGTGG - Intronic
915750972 1:158210529-158210551 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
915767174 1:158374407-158374429 CCCTCATTGCAGGGGAGGGGGGG + Intergenic
915800444 1:158786298-158786320 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
916331244 1:163619540-163619562 CCATTTTTGCAGGAGTTAGGTGG + Intergenic
916671584 1:167026858-167026880 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
916855951 1:168749983-168750005 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
916917893 1:169429491-169429513 CCATTCTTGCAGGAGTAAGGTGG + Intronic
917062317 1:171054806-171054828 CCATTCTTGCAGGAGTAAGGTGG - Intronic
917073614 1:171179881-171179903 CCATGCTGGGAGGTGATGGGTGG + Intergenic
917081433 1:171260377-171260399 CAATCCTGGCAGGAAAAGGGAGG + Intronic
917319438 1:173764177-173764199 CCATCCTTGCAGGAGTAAGGTGG - Intronic
917782251 1:178410824-178410846 CCATTCTTGCAGGAGTAAGGTGG - Intronic
917887380 1:179399879-179399901 CCATCCTTGCAGGAGTAAGGTGG - Intronic
917898032 1:179511750-179511772 CCATTCTTGCAGGAGTAGGGTGG + Intronic
918128878 1:181607840-181607862 GCATCCTGGCAGGAAATGGAAGG + Intronic
918731461 1:188002359-188002381 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
919072986 1:192779343-192779365 CCATTCTTGTAGGAGTTAGGTGG + Intergenic
919485259 1:198138231-198138253 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
919794560 1:201313505-201313527 TCCTTGTTGCAGGAGATGGGCGG - Exonic
920152318 1:203919553-203919575 CCATCCGTGAGGGAGGTGGGGGG - Intergenic
920193164 1:204207957-204207979 CCATTCTTGCAGGAGTAAGGTGG - Intronic
920726514 1:208440427-208440449 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
921001153 1:211044713-211044735 CCATTCTTGCAGGAGTAAGGTGG - Intronic
921116073 1:212092930-212092952 CCATTCTTGCAGGAGTAAGGTGG + Intronic
921414168 1:214869590-214869612 CCGTCCTGGAGGGAGATGGGGGG - Intergenic
921518674 1:216130997-216131019 CCATTCTTGCAGGAGTAAGGTGG + Intronic
921843296 1:219852237-219852259 CCATTCTTGCAGGAGTAAGGTGG - Intronic
922215791 1:223519130-223519152 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
922658430 1:227406872-227406894 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
922794209 1:228331770-228331792 CCATCCTTGCAGAAGTTAGGTGG + Intronic
922995101 1:229950840-229950862 CCATTCTTGCAGGAGAAAGGTGG + Intergenic
923366998 1:233272446-233272468 CCATTCTTGCAGGAGTAAGGTGG - Intronic
923657162 1:235927132-235927154 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
923662142 1:235967533-235967555 CCATTCTTGCAGGAGTTAGGTGG - Intergenic
923777645 1:236994477-236994499 CTATCCCAGCAGGAGATGGGAGG - Intergenic
923960704 1:239079898-239079920 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
923996752 1:239504367-239504389 CCATTCTTGCAGGAGTAAGGTGG - Intronic
924069395 1:240260442-240260464 CCATTCTTGCAGGAGTAAGGTGG + Intronic
924250370 1:242127106-242127128 CCATTCTTGCAGGAGTAAGGTGG - Intronic
924280145 1:242428980-242429002 CCATCTTTAGAGGAGATGGACGG - Intronic
924320971 1:242849851-242849873 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
924685547 1:246285941-246285963 CCATTCTTGCGGGAGAAAGGTGG - Intronic
924691968 1:246361249-246361271 CCATTCTTGCAGGAGTGAGGTGG - Intronic
924789565 1:247232504-247232526 CCATTCTTGCAGGAGTGGGGTGG - Intergenic
1063070018 10:2652012-2652034 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1063247507 10:4237669-4237691 CCATTCTTGCAGGAGTGAGGCGG - Intergenic
1063328571 10:5131634-5131656 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1063431995 10:5999267-5999289 CGGTCCTTGCAGGACCTGGGGGG + Intergenic
1063460923 10:6214681-6214703 CCATCCTTTCAAAAGAGGGGAGG - Intronic
1063542432 10:6947704-6947726 CCATCCTTGCAGGAGTAAGGTGG - Intergenic
1063926900 10:10987914-10987936 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1064476755 10:15698599-15698621 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1064521483 10:16207447-16207469 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1064867796 10:19901364-19901386 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1064907686 10:20365122-20365144 CCATCCTTGCAGGAATAAGGTGG + Intergenic
1064965194 10:21008602-21008624 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1065079547 10:22114082-22114104 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1065259358 10:23908702-23908724 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1065268633 10:24003349-24003371 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1066143323 10:32529460-32529482 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1066706387 10:38183563-38183585 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1066708602 10:38207820-38207842 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1066980898 10:42414743-42414765 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1066983566 10:42442506-42442528 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1067043053 10:42968055-42968077 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1068077494 10:52274870-52274892 CCATTCTTGCAGGAGGGAGGTGG + Intronic
1068097776 10:52513282-52513304 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1068172626 10:53415714-53415736 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1068347911 10:55807950-55807972 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1068629396 10:59284395-59284417 CCACCCCTGCTGGAGCTGGGAGG - Intronic
1068912357 10:62391938-62391960 CCATTCTTGCAGGAGCAAGGTGG + Intronic
1069107437 10:64400295-64400317 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1069242277 10:66157850-66157872 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1069814979 10:71188111-71188133 CCATCCTCCCAGCAGAGGGGAGG + Intergenic
1071020776 10:81052768-81052790 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1071137423 10:82468266-82468288 CCTCCCTTGCATGAGAAGGGTGG + Intronic
1071405389 10:85325022-85325044 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1071485111 10:86095662-86095684 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1071894987 10:90056565-90056587 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1072392742 10:95004913-95004935 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1072551413 10:96480313-96480335 CCATCTGGGCAGGAGAAGGGAGG + Intronic
1073475204 10:103748046-103748068 CCATCCTTGCAGGAGATGGGTGG - Intronic
1073877245 10:107939339-107939361 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1074029569 10:109672738-109672760 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1074242439 10:111652505-111652527 CCATCATGGCAGAAGATGAGGGG + Intergenic
1074575830 10:114668230-114668252 CCAGCCTGGGAGGAGGTGGGAGG + Intronic
1074888381 10:117713450-117713472 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1075341798 10:121652659-121652681 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1075976333 10:126699281-126699303 CCATCCTTGCAGGAGAAAGGTGG - Intergenic
1075986718 10:126794126-126794148 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1076872222 10:133199735-133199757 CTACCCTTGGTGGAGATGGGTGG + Intronic
1077365544 11:2160114-2160136 CCAGCCCGGCTGGAGATGGGTGG - Intronic
1077610692 11:3641859-3641881 CCATCCCTGGAGGAGACGTGAGG + Exonic
1077676613 11:4199801-4199823 CCATTCTTGCAGGAGTAAGGGGG + Intergenic
1078285733 11:9952842-9952864 CCATTCTTGCAGGAATAGGGTGG - Intronic
1078588392 11:12615595-12615617 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1078707078 11:13754815-13754837 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1078724265 11:13914924-13914946 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1078948729 11:16103326-16103348 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1078997043 11:16712437-16712459 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1079174964 11:18131486-18131508 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1079178525 11:18167493-18167515 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1079179915 11:18182752-18182774 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1079462919 11:20699969-20699991 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1079573763 11:21977473-21977495 CCATCTTGGCAGCAGTTGGGAGG + Intergenic
1079791233 11:24742389-24742411 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1079951749 11:26814199-26814221 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1080202936 11:29694463-29694485 CCATTTTTGCAGGAGTAGGGTGG + Intergenic
1080324554 11:31055287-31055309 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1080338245 11:31224812-31224834 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1080486308 11:32711094-32711116 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1080567826 11:33528279-33528301 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1080931312 11:36814275-36814297 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1081539552 11:44021307-44021329 CCATTCTTGCAGGAGTTAGGCGG + Intergenic
1081789885 11:45775064-45775086 CCATCCTTGCACCTGCTGGGTGG - Intergenic
1082773325 11:57226235-57226257 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1082868970 11:57926066-57926088 CTATCCTTGCAGGAGTAAGGTGG + Intergenic
1083044753 11:59724280-59724302 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1083064146 11:59906030-59906052 CCGTTCTTGCAGGAGTAGGGTGG + Intergenic
1083127278 11:60583300-60583322 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1083141427 11:60724958-60724980 CCATCCTTGGAGGTGCTGGGAGG + Intergenic
1084686274 11:70697784-70697806 CCACCTCTGCAGGAGATGAGTGG + Intronic
1085654665 11:78302485-78302507 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1085748350 11:79135298-79135320 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1086193587 11:84110067-84110089 ACATCCTTGCATGAGAAGGAAGG - Intronic
1086265062 11:84988195-84988217 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1086330322 11:85747451-85747473 CCATCAATTCAGTAGATGGGTGG + Intronic
1086513425 11:87585532-87585554 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1087064395 11:94013683-94013705 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1087466291 11:98510566-98510588 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1087502590 11:98977336-98977358 CCATTCTTGCAGGAGTGTGGTGG - Intergenic
1087619600 11:100526620-100526642 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1087730943 11:101778144-101778166 CCATTCTTGCAGGAGAAAGCTGG + Intronic
1088410426 11:109528190-109528212 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1088525569 11:110749522-110749544 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1088581004 11:111316716-111316738 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1088809400 11:113380686-113380708 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1088825019 11:113486542-113486564 CCATTCTTGCAGGAGTGTGGTGG - Intergenic
1089107818 11:116029042-116029064 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1089554975 11:119311248-119311270 GCATCCCTGCAGGGGATGGCAGG - Intronic
1089585565 11:119507897-119507919 CCATCCGGGAGGGAGATGGGGGG - Intergenic
1089825797 11:121275776-121275798 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1090483622 11:127090973-127090995 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1090757790 11:129809030-129809052 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1090927789 11:131264618-131264640 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1091210015 11:133849085-133849107 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1091307470 11:134545796-134545818 CCATGCTTGCAGCAGAGGGAGGG + Intergenic
1091381291 12:62947-62969 CCATTCTTGCAGGAGTTAGGTGG - Intergenic
1091386715 12:100627-100649 CCAACCATGTTGGAGATGGGAGG + Intronic
1091409422 12:229400-229422 CTATCTTTGCAGGAGCTGTGTGG - Intronic
1091701061 12:2663273-2663295 CCATTCTTGCAGGAGGAAGGTGG - Intronic
1092061236 12:5552367-5552389 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1092102359 12:5895587-5895609 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1092214947 12:6674611-6674633 CAATCATTGCAGGAGAGAGGGGG + Intronic
1092303407 12:7274442-7274464 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1092438140 12:8470237-8470259 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1093172787 12:15877964-15877986 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1093218969 12:16396134-16396156 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1093408775 12:18839942-18839964 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1093497488 12:19775095-19775117 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1093533505 12:20195656-20195678 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1093597882 12:20983322-20983344 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1094280746 12:28735091-28735113 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1094396322 12:30009730-30009752 CAATCCTTGGAGGAGATAGATGG - Intergenic
1094576442 12:31690446-31690468 CCATTCTTGCAGGAGTCAGGTGG + Intronic
1094802488 12:34052917-34052939 CCATTCTTGCAGGAGTAAGGAGG - Intergenic
1095115647 12:38348859-38348881 CCATTCTTGCAGGAGGAAGGAGG - Intergenic
1095117820 12:38376803-38376825 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1095178480 12:39120123-39120145 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1095229006 12:39714751-39714773 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1095459520 12:42428060-42428082 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1095531603 12:43192972-43192994 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1095725673 12:45449630-45449652 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1095932521 12:47642158-47642180 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1096032314 12:48430600-48430622 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1096206269 12:49724659-49724681 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1096563274 12:52452075-52452097 CCATGGTTCCAGGAGATGAGAGG + Exonic
1096565426 12:52473734-52473756 CCATGGTTCCAGGAGATGAGAGG + Exonic
1096808498 12:54155211-54155233 CCCTCCTTGGAGCAGCTGGGAGG - Intergenic
1096871058 12:54592395-54592417 GCAGCATTGGAGGAGATGGGTGG + Intergenic
1096961948 12:55588532-55588554 CCATGCTTGCAGGAGTAAGGTGG - Intergenic
1096963949 12:55609480-55609502 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1097028506 12:56075840-56075862 CCATCCGGGAGGGAGATGGGGGG - Intergenic
1097200648 12:57275773-57275795 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1097295954 12:57963218-57963240 CCATTCTTGCAGGAGTATGGTGG - Intergenic
1097760902 12:63462973-63462995 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1097833226 12:64247533-64247555 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1098520965 12:71435237-71435259 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1098653289 12:73001564-73001586 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1098689573 12:73469876-73469898 CCATTCTTGCAGGAGAAAGGTGG - Intergenic
1098786032 12:74756822-74756844 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1098952757 12:76658926-76658948 CCATTCTTGCAGGAGTGGGGTGG - Intergenic
1098960326 12:76733036-76733058 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1099382229 12:81969064-81969086 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1099472563 12:83069384-83069406 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1099581430 12:84451734-84451756 CCATTCTTGCAGGAGTAAGGCGG + Intergenic
1099687186 12:85905430-85905452 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1100139379 12:91597950-91597972 CCATTCTTGCAGGAGTGAGGAGG + Intergenic
1100421722 12:94441471-94441493 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1100558465 12:95722218-95722240 CCTTCCTTCCTGCAGATGGGTGG - Intronic
1100604405 12:96139635-96139657 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1100918959 12:99460700-99460722 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1100920613 12:99481725-99481747 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1100951743 12:99858326-99858348 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1101295088 12:103414172-103414194 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1101298935 12:103457770-103457792 CCCTCCTGGCAGGGGGTGGGGGG + Intronic
1101634778 12:106530131-106530153 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1102365906 12:112334482-112334504 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1102434930 12:112914629-112914651 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1102916228 12:116754675-116754697 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1102998092 12:117365019-117365041 CCATCCATGCAGGGGTTGAGGGG - Intronic
1103029181 12:117598653-117598675 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1103457293 12:121076712-121076734 CCATCCGTGAGGGAGGTGGGGGG + Intergenic
1104181178 12:126382838-126382860 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105243748 13:18629105-18629127 CCATCGTTGCCGGAGACTGGAGG + Intergenic
1105315029 13:19250580-19250602 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1105315361 13:19255077-19255099 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1105464967 13:20631293-20631315 CCATCTCTGAAGGAGAAGGGAGG + Intronic
1105681000 13:22727532-22727554 CCATTCTTGCAGGAGTAAGGCGG - Intergenic
1105728241 13:23186650-23186672 CCATCCTCACAGGGGATCGGGGG + Intronic
1105985788 13:25565416-25565438 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1105989957 13:25609807-25609829 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1106391829 13:29341340-29341362 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1106921209 13:34565411-34565433 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1106959005 13:34975876-34975898 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1107185054 13:37508146-37508168 CCATTCTTGCAGGAGTAGGGTGG - Intergenic
1107456511 13:40560425-40560447 CCATCTTTGCGGCAGATGGCGGG + Exonic
1107498918 13:40955356-40955378 CCATCCGGGAGGGAGATGGGGGG + Intronic
1107498939 13:40955404-40955426 CCATCCGGGAAGGAGGTGGGGGG + Intronic
1107584392 13:41829194-41829216 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1107960895 13:45557127-45557149 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1108469031 13:50749626-50749648 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1108787599 13:53924288-53924310 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1108825992 13:54413249-54413271 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1109474111 13:62855904-62855926 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1109678762 13:65717774-65717796 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1109822495 13:67676440-67676462 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1109824630 13:67702107-67702129 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1110204954 13:72901357-72901379 CCATTCTTGCAGGAGTAAGGGGG - Intronic
1110209682 13:72956967-72956989 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1110217098 13:73035052-73035074 CCATCCCTGGAGGGGGTGGGAGG + Intergenic
1110340229 13:74381695-74381717 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1110470018 13:75848946-75848968 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1110570443 13:76996987-76997009 CCATTCTTGCAGGAGTGAGGCGG + Intronic
1110639428 13:77804919-77804941 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1110657405 13:78016527-78016549 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1111165322 13:84450497-84450519 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1111893119 13:94107841-94107863 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1111988859 13:95094947-95094969 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1112068541 13:95821277-95821299 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1112087956 13:96051779-96051801 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1112249020 13:97761570-97761592 CCTTCCTTTCAGAAGAAGGGAGG + Intergenic
1112529682 13:100188746-100188768 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1112581959 13:100684175-100684197 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1112991505 13:105519326-105519348 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1113194342 13:107784702-107784724 CCATTCTTGCAGGAGAAAGGTGG - Intronic
1113845045 13:113382586-113382608 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1114213439 14:20636083-20636105 CCATTCTTGCAGGAGCAAGGTGG - Intergenic
1114328761 14:21615562-21615584 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1114505026 14:23203918-23203940 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1114691730 14:24588755-24588777 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1115130026 14:30043631-30043653 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1115194997 14:30788088-30788110 CCATTCTTGCAGGAGTAAGGAGG - Intergenic
1115299781 14:31871281-31871303 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1115526747 14:34288094-34288116 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1115959118 14:38815017-38815039 CCATTCTTGCAGGAGTTGGGTGG - Intergenic
1115970300 14:38938133-38938155 CCATTCTTGCAGGAGTCAGGTGG - Intergenic
1116088565 14:40274373-40274395 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1116172037 14:41415577-41415599 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1116406529 14:44573413-44573435 TCATTCTTGCAGGAGTTAGGTGG - Intergenic
1116460894 14:45172048-45172070 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1116754727 14:48932840-48932862 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1116849627 14:49894275-49894297 CTCTCCTTCCAGGGGATGGGTGG - Exonic
1116955426 14:50918134-50918156 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1117110668 14:52450569-52450591 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1117271832 14:54152327-54152349 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1117697396 14:58379358-58379380 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1118166056 14:63337879-63337901 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1118197072 14:63637215-63637237 CCATTCTTGCAGGAGTGTGGTGG - Intronic
1118423319 14:65632413-65632435 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1118531630 14:66712833-66712855 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1118548482 14:66921284-66921306 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1118653601 14:67923914-67923936 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1118679190 14:68221992-68222014 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1119091988 14:71791556-71791578 CCATTCTTGCAGGAGTAGGGTGG + Intergenic
1119483361 14:74973568-74973590 ACAGCCTTGCAGGGGATGTGGGG - Intergenic
1120224024 14:81770015-81770037 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1120355978 14:83434469-83434491 CCATTCTTGCAGGAATAGGGTGG + Intergenic
1120450524 14:84660897-84660919 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1120489906 14:85164415-85164437 CCTTTCTTGCAGGAGTTAGGTGG - Intergenic
1120517200 14:85484871-85484893 CCACCCTTGCAGGAGTAAGGTGG + Intergenic
1121281156 14:92699569-92699591 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1121460322 14:94071308-94071330 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1121516143 14:94551366-94551388 CCATTCTTGCAGGAGTAGGGTGG + Intergenic
1121629733 14:95413500-95413522 CCTGCCTTGCAGGGGATGGGAGG - Intronic
1121749586 14:96339080-96339102 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1122871419 14:104640707-104640729 CCATCCATGCTGGGGATGGGGGG - Intergenic
1123487546 15:20755526-20755548 CCATCGTTGCTGGAGACTGGAGG - Intergenic
1123544038 15:21324584-21324606 CCATCGTTGCTGGAGACTGGAGG - Intergenic
1124253977 15:28126096-28126118 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1124373230 15:29115233-29115255 CCATCCTTGCAGCCTGTGGGTGG + Intronic
1124557569 15:30741303-30741325 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1124673678 15:31664356-31664378 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1124683085 15:31754054-31754076 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1125268919 15:37916319-37916341 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1125378245 15:39057575-39057597 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1125823570 15:42656028-42656050 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1125889204 15:43253171-43253193 CCAGCTTTGCAGGGGATGGGAGG - Intronic
1126184182 15:45814679-45814701 CCATCCTTGCAGAAGTAAGGTGG + Intergenic
1126191005 15:45878768-45878790 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1126460346 15:48908236-48908258 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1126488111 15:49205417-49205439 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1126573529 15:50175651-50175673 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1126642896 15:50845669-50845691 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1126718494 15:51549647-51549669 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1126919113 15:53500714-53500736 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1126997014 15:54455549-54455571 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1127449654 15:59104135-59104157 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1127524692 15:59781005-59781027 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1128415558 15:67442482-67442504 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1128965710 15:72055765-72055787 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1129089394 15:73132835-73132857 CCATTCTTGCAGGAGGAAGGTGG - Intronic
1129096462 15:73213957-73213979 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1129643461 15:77407566-77407588 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1129760677 15:78127649-78127671 CCAGGCATGTAGGAGATGGGAGG - Intronic
1129928626 15:79388781-79388803 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1130344649 15:83031876-83031898 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1130790807 15:87153969-87153991 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1131530468 15:93186822-93186844 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1131879400 15:96846455-96846477 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1132033839 15:98462924-98462946 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1132254191 15:100361011-100361033 CCATTCTTGCAGGAGCAAGGTGG - Intergenic
1202952380 15_KI270727v1_random:51858-51880 CCATCGTTGCTGGAGACTGGAGG - Intergenic
1133415897 16:5606790-5606812 CACTGATTGCAGGAGATGGGGGG + Intergenic
1133961442 16:10497119-10497141 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1134805683 16:17122284-17122306 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1135941224 16:26823705-26823727 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1136602575 16:31304151-31304173 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1137458543 16:48637108-48637130 CCATGCTTCCAGGAGGTGGATGG + Intergenic
1138553230 16:57758439-57758461 CCCTCCTTGAAGGAGAGGGGCGG + Exonic
1138637977 16:58358312-58358334 CCATTCTTGCAGGAGTCAGGCGG + Intronic
1138907254 16:61352260-61352282 CCATTCTTGCAGGAGTGTGGTGG - Intergenic
1139419250 16:66839715-66839737 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1139762798 16:69200392-69200414 CCATCCTTCCACTAGAAGGGTGG + Intronic
1140121300 16:72085207-72085229 CCCTCCCTGCAGGAAAGGGGTGG + Exonic
1140547881 16:75828806-75828828 CCATTCTTGCAGGAGTCAGGTGG + Intergenic
1140552086 16:75877236-75877258 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1142192298 16:88723505-88723527 CCACCCATTCAGGAGTTGGGTGG + Intronic
1142245885 16:88969853-88969875 ACAGCCTTGCAGAAGATCGGGGG - Intronic
1142620462 17:1162416-1162438 CCACCCCAGCAGGAGATGAGAGG + Intronic
1142910361 17:3084239-3084261 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1143135887 17:4711991-4712013 CCAGCCTGGCAGGAGGTGGCTGG + Intronic
1143434944 17:6916922-6916944 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1144376079 17:14643408-14643430 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1144407675 17:14967988-14968010 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1144482370 17:15638684-15638706 CCTTCCTTGCCAGGGATGGGAGG - Intronic
1144916313 17:18726348-18726370 CCTTCCTTGCCAGGGATGGGAGG + Intronic
1145003454 17:19321556-19321578 GCATCCTTGCAGGAGAAAGCAGG + Intronic
1145174906 17:20691417-20691439 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1145723698 17:27097041-27097063 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1146128640 17:30250539-30250561 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1146220411 17:31013891-31013913 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1146400720 17:32498076-32498098 CCAGCACCGCAGGAGATGGGAGG + Intronic
1146555452 17:33819153-33819175 CCATCCTTCCTGGAGCTGAGAGG - Intronic
1146750897 17:35378846-35378868 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1146962668 17:36997527-36997549 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1147172719 17:38631227-38631249 CCATCCGGGAAGGAGGTGGGGGG + Intergenic
1147462691 17:40583785-40583807 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1148120158 17:45204205-45204227 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1148962835 17:51407774-51407796 CCATCCAGCCAGGAGATGAGAGG + Intergenic
1149022588 17:51986810-51986832 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1149024426 17:52010053-52010075 CCATTCTAGCAGGAGTGGGGTGG - Intronic
1149117529 17:53115744-53115766 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1149121973 17:53180066-53180088 CCATACTTGCAGGAGTAAGGCGG + Intergenic
1149142809 17:53454800-53454822 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1149153874 17:53602682-53602704 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1149633093 17:58142738-58142760 CCATCCTGGGGGGAGGTGGGGGG + Intergenic
1149909002 17:60551681-60551703 CCGTCCTGGAGGGAGATGGGGGG + Intergenic
1149960984 17:61109634-61109656 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1150092940 17:62345489-62345511 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1150367370 17:64601501-64601523 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1151201760 17:72473025-72473047 CCATTCCTGCAGGAGTAGGGTGG - Intergenic
1151577858 17:74961985-74962007 CCATCCTTGTAGGAGGAAGGGGG + Exonic
1151598661 17:75093369-75093391 CCAGCCTGGCAGGAGGTGGCAGG - Intronic
1152009759 17:77705141-77705163 CCAGCCTTCCAGCAGATGGAAGG - Intergenic
1152094427 17:78264733-78264755 CCATCCTAGCTGGGGAAGGGAGG + Intergenic
1153406260 18:4743606-4743628 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1153450935 18:5227817-5227839 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1153470397 18:5438100-5438122 CCATCCTTGCAGGTGGTGCTTGG - Exonic
1153532579 18:6063555-6063577 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1153533041 18:6069092-6069114 CCATCTTTGATGGAGATGGCAGG + Intronic
1154084808 18:11293366-11293388 CCAGCCTTGCTGGAGCTGGCAGG + Intergenic
1155067884 18:22283942-22283964 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1155531822 18:26775142-26775164 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1155708300 18:28843738-28843760 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1155887255 18:31223407-31223429 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1155987702 18:32247729-32247751 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1156010831 18:32495753-32495775 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1156081152 18:33338205-33338227 ACATACTTGCAGGAGTTAGGTGG - Intronic
1156178743 18:34578162-34578184 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1156984724 18:43336278-43336300 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1157149473 18:45201948-45201970 CCATTCTTAGAAGAGATGGGTGG - Intergenic
1157721445 18:49928189-49928211 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1158206148 18:54995209-54995231 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1158377167 18:56884193-56884215 CCATTCTTGCAGGAGCAAGGTGG + Intronic
1158588862 18:58763038-58763060 CCAGCCTTGCAGCAGAAGTGTGG - Intergenic
1158881198 18:61781083-61781105 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1159044293 18:63354080-63354102 CCAGCCTGGCAGGAGACTGGAGG + Intronic
1159359234 18:67380097-67380119 CCATCCCTGAATGAGATGGGGGG - Intergenic
1159922555 18:74238944-74238966 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1160180325 18:76629092-76629114 CCATTCTTGCAGGAGTGGGGTGG + Intergenic
1160535368 18:79588769-79588791 CCCTCCGTGCAGGGGCTGGGAGG - Intergenic
1161197764 19:2996536-2996558 ACATTCTAGAAGGAGATGGGAGG - Intergenic
1162009422 19:7803049-7803071 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1163048890 19:14666281-14666303 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1163673957 19:18646020-18646042 TCTTCCTAGCAGGAGCTGGGGGG - Intronic
1164018566 19:21275381-21275403 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1164023036 19:21326016-21326038 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1164677935 19:30114686-30114708 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1164696930 19:30252248-30252270 TCATTCTTGCAGGAGTAGGGTGG - Intronic
1164928196 19:32147870-32147892 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1166090005 19:40502758-40502780 CCATGCCTGCAGGAGATGGGAGG - Exonic
1166416503 19:42598559-42598581 CCATCGTTGCAGGAGAAAGGTGG + Intronic
1167128003 19:47564611-47564633 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1167497051 19:49825902-49825924 CCACCCTGGCTGGGGATGGGGGG - Intronic
1168369159 19:55817136-55817158 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1168387091 19:55973138-55973160 CCATTCTTGCAGGAGTGAGGTGG + Intronic
925037817 2:704711-704733 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
925343500 2:3152975-3152997 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
925505894 2:4563595-4563617 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
925951231 2:8913631-8913653 CCATTCTTGCAGGAGTAAGGTGG - Intronic
926235103 2:11035356-11035378 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
926944768 2:18175377-18175399 CCATTCTTGCAGGAGTAAGGTGG - Intronic
927355742 2:22171140-22171162 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
927913194 2:26915843-26915865 CCATTCATTCAGGAGAGGGGTGG - Intronic
928988904 2:37210078-37210100 CCATTCTTGCAGGAGTAAGGTGG - Intronic
929300914 2:40302894-40302916 CCATTCTTGCAGGAGTAAGGTGG - Intronic
929387144 2:41422878-41422900 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
929599984 2:43198851-43198873 CCAGCCCTGCAGGAGAGGGCAGG - Intergenic
929643006 2:43600469-43600491 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
929722470 2:44384162-44384184 CCATTCTTGCAGGAGTAAGGTGG + Intronic
929806292 2:45148778-45148800 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
930079341 2:47433660-47433682 CCATCCAGGAGGGAGATGGGGGG - Intronic
930080461 2:47442794-47442816 CCATTCTTGCAGGAGTAAGGTGG + Intronic
930423489 2:51182948-51182970 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
930448526 2:51505061-51505083 CCATTCTTGGAGGAGTTAGGTGG + Intergenic
930573901 2:53122385-53122407 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
930765124 2:55077419-55077441 CCATTCTTGCAGGAGTGAGGTGG - Intronic
930858028 2:56039941-56039963 CAATTGTTGCAGGAGGTGGGGGG - Intergenic
931524653 2:63139509-63139531 CCATTCTTGCAGGAGTAAGGTGG + Intronic
931554134 2:63481194-63481216 CCATTCTTGCAGGAGTAAGGTGG - Intronic
931758835 2:65398671-65398693 CCATTCTTGCAGGAGTGAGGTGG - Intronic
932065577 2:68555655-68555677 CCATTCTTGCAGGCGCAGGGTGG - Intronic
932270863 2:70408272-70408294 CCATTCTTGCAGGAGCAAGGTGG - Intergenic
932384364 2:71317597-71317619 CCATTCTTGCAGGAGTAAGGTGG + Intronic
932871126 2:75399394-75399416 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
933494628 2:83033711-83033733 CCATCCTTGCAGGAGTGAGGTGG + Intergenic
933627237 2:84614715-84614737 CCATTCTTGCAGGGGTAGGGTGG + Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934525360 2:95048431-95048453 CAGCCCTTGCAGGTGATGGGAGG - Intronic
934904103 2:98184288-98184310 CCATCCTTGCAGGGCAGCGGAGG + Intronic
935024766 2:99265893-99265915 CCATTCTTGCAGGAGTAAGGTGG + Intronic
935836319 2:107058655-107058677 CCATTCTCGCAGGAGAAAGGTGG + Intergenic
936164883 2:110112535-110112557 CCATTCTTGCAGGAGTAAGGTGG - Intronic
936611447 2:114005734-114005756 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
936633523 2:114230358-114230380 CCATCTTTGCAGGAGTAAGGAGG + Intergenic
936894763 2:117414471-117414493 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
937411223 2:121677816-121677838 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
937529773 2:122814103-122814125 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
937828522 2:126394365-126394387 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
938037562 2:128047952-128047974 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
938311814 2:130295407-130295429 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
938415985 2:131104103-131104125 CCAGCCTAGCAGGGGTTGGGGGG - Intergenic
938597805 2:132806457-132806479 CCATTCTTGCAGGAGTAAGGTGG + Intronic
938947812 2:136229336-136229358 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
938996831 2:136688624-136688646 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
939230222 2:139414588-139414610 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
939769994 2:146303800-146303822 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
939835329 2:147123574-147123596 CCATTCTTGCAGGAGTTAGGTGG + Intergenic
939973091 2:148684049-148684071 CCATTCTTGCAGGAGTAAGGTGG + Intronic
940028299 2:149232403-149232425 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
940028386 2:149233682-149233704 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
940171928 2:150838056-150838078 CCATTCTTGCAGGAGTAAGGGGG + Intergenic
941061091 2:160848174-160848196 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
941230024 2:162900233-162900255 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
941358395 2:164520812-164520834 CCATTCTTGCAGGAGTAAGGTGG - Intronic
941631204 2:167886462-167886484 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
942213425 2:173694360-173694382 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
942434071 2:175951924-175951946 CCATTCTTGCAGGAGTAAGGTGG + Intronic
942478222 2:176352398-176352420 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
942726576 2:179014723-179014745 CCATTCTTGCAGGAGTAAGGTGG - Intronic
943282797 2:185958886-185958908 CCATTCTTGCAGGAGTAGGGTGG + Intergenic
943423939 2:187705909-187705931 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
943739849 2:191398075-191398097 CCGTCCGTGAGGGAGATGGGGGG - Intronic
943858486 2:192828840-192828862 GCCTCCTTGCAGGAGATGAGAGG + Intergenic
943890861 2:193285253-193285275 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
944031934 2:195245126-195245148 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
944072760 2:195691553-195691575 CCATTCTTGCAGGAGTGAGGTGG + Intronic
944140671 2:196452677-196452699 CCCTCCATGCAGGAGAGGAGTGG - Intronic
944421139 2:199531762-199531784 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
944603435 2:201327613-201327635 CCATTCTTGCAGGAGTAAGGTGG - Intronic
944934448 2:204553210-204553232 CCATTCTTGCAGGAGTGAGGTGG - Intronic
945059291 2:205894486-205894508 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
945131568 2:206578928-206578950 CCATTCTTGCAGGAGTAAGGTGG + Intronic
945278306 2:208011034-208011056 CCATTCTTGCAGGAGTAAGGTGG - Intronic
945391472 2:209270392-209270414 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
945480755 2:210342608-210342630 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
945492909 2:210476758-210476780 CCCTCCTGGCAGGAACTGGGCGG - Intronic
945636996 2:212367885-212367907 CCATTCTTGCAGGAGAAAGTTGG - Intronic
945826258 2:214723636-214723658 CCATTCTTGCAGGAGCAAGGTGG - Intergenic
945828640 2:214756283-214756305 CCATTCTTGCAGGAGTAAGGTGG - Intronic
945920613 2:215751316-215751338 CCATCCAGGCAGCAGATGGATGG - Intergenic
946204847 2:218096853-218096875 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
946350428 2:219147626-219147648 ACATTCTTGGAGGAGTTGGGTGG - Intronic
946801895 2:223426313-223426335 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
947048227 2:226013048-226013070 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
947250015 2:228091722-228091744 CCATTCTTGCAGGAGTAAGGTGG - Intronic
947448929 2:230187190-230187212 CCATTCTTGCAGGAGTAAGGTGG + Intronic
947460965 2:230305207-230305229 CCATTCTTGCAGGAGTAAGGTGG - Intronic
947511154 2:230755327-230755349 CCATTCTTGCAGGAGTAAGGTGG + Intronic
947519325 2:230831771-230831793 CCATCCCTGCACCAGATGGAGGG + Intergenic
948258162 2:236583664-236583686 TCAGCCTTGCAATAGATGGGCGG + Intergenic
948577180 2:238961898-238961920 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
948643982 2:239392523-239392545 CCTTGCTTGCAGGATGTGGGTGG - Intronic
948746733 2:240101687-240101709 CCATCCTTGCAGGAGTAAGGTGG - Intergenic
948844510 2:240676739-240676761 CCATCCCTGCAAGAGAAGGCAGG + Exonic
948849350 2:240698140-240698162 CCATCCCTGCAAGAGAAGGCAGG - Exonic
1169067349 20:2701485-2701507 GCAGCCTGGCAGGAGCTGGGGGG + Intronic
1169335647 20:4753853-4753875 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1169401814 20:5288254-5288276 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1169516999 20:6328042-6328064 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1169840780 20:9934626-9934648 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1170108023 20:12773036-12773058 CCATTCTTGCAGGAGTGGGGTGG + Intergenic
1170350389 20:15434472-15434494 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1170375384 20:15694403-15694425 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1170435733 20:16326623-16326645 CCATCCTTGCAGGAGTAAGGTGG - Intronic
1170726450 20:18931844-18931866 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1170741467 20:19061937-19061959 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1170862705 20:20122958-20122980 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1170865073 20:20147433-20147455 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1171166031 20:22972504-22972526 CCATTCTTGCAGGAGTAAGGGGG - Intergenic
1171198152 20:23217827-23217849 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1171375095 20:24687236-24687258 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1172268742 20:33640172-33640194 CCATCCATGCAGGTGCTGGCTGG - Intronic
1172720918 20:37000063-37000085 CCCACATTGCAGAAGATGGGCGG - Intronic
1172850935 20:37963852-37963874 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1172910816 20:38407658-38407680 CCATCCTGGAGGGAGGTGGGGGG + Intergenic
1173183870 20:40824489-40824511 CCCTCCTCTCAGCAGATGGGTGG + Intergenic
1174459537 20:50672829-50672851 CCAGCCCAGGAGGAGATGGGAGG - Intronic
1174477753 20:50808545-50808567 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1174600729 20:51722646-51722668 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1175029830 20:55940830-55940852 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1175232990 20:57486844-57486866 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1175292572 20:57886758-57886780 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1176283917 20:64331887-64331909 CCATTCTTGCAGGAGTTAGGTGG + Intergenic
1176450791 21:6859083-6859105 CCATCGTTGCCGGAGACTGGAGG + Intergenic
1176658227 21:9607805-9607827 CCATTTTTGCAGGAGAAAGGTGG + Intergenic
1176828960 21:13724101-13724123 CCATCGTTGCCGGAGACTGGAGG + Intergenic
1176999784 21:15597906-15597928 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1177367818 21:20160401-20160423 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1177876504 21:26638585-26638607 CCATGCTTGCAGGAGTGAGGTGG + Intergenic
1177958250 21:27628191-27628213 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1178052720 21:28765913-28765935 CCATTCTTGCAGGAGTATGGTGG - Intergenic
1178733346 21:35126104-35126126 CCATTCTTGCAGGAGTTAGGTGG - Intronic
1179229954 21:39492810-39492832 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1179268428 21:39826814-39826836 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1179933491 21:44588329-44588351 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1180251183 21:46590701-46590723 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1180597992 22:16991803-16991825 CCCTCCTTGCTGGAGATTGGAGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1180896888 22:19342256-19342278 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1180921926 22:19525460-19525482 CCATCCTTGCTGGAGGAGGGAGG + Intronic
1181044130 22:20206696-20206718 CCCTCCTGGCTGGAGTTGGGAGG + Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181454718 22:23052049-23052071 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1182970788 22:34574410-34574432 CCATTCTTGCAGGAGCAAGGTGG - Intergenic
1183178406 22:36241093-36241115 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1183958763 22:41398236-41398258 CCATGCTTGCAGGAGAGGGTTGG + Exonic
1185295533 22:50051724-50051746 CCATTCTTGCAGGAGGAAGGTGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949109392 3:240284-240306 CCATTCTTGCAGGAGTCAGGTGG + Intronic
949570492 3:5287488-5287510 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
949658760 3:6253027-6253049 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
949814711 3:8045993-8046015 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
950267281 3:11583732-11583754 CCATCCTTGGCGGAGCTGAGGGG - Intronic
950591942 3:13942863-13942885 CCATTCTTGCAGGAGTAAGGTGG + Intronic
951184288 3:19694188-19694210 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
951268066 3:20592946-20592968 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
951295080 3:20923779-20923801 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
951326406 3:21307538-21307560 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
951434956 3:22651399-22651421 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
951444098 3:22756931-22756953 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
951468225 3:23025786-23025808 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
951571999 3:24073762-24073784 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
951821640 3:26820381-26820403 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
951859259 3:27233344-27233366 CCATTCTTGCAGGAGTAAGGTGG - Intronic
952182835 3:30936457-30936479 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
952393057 3:32897429-32897451 CCATCAATGCAGTAGATGGGTGG + Exonic
952434715 3:33261353-33261375 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
952493193 3:33891816-33891838 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
952689417 3:36187108-36187130 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
952714441 3:36465149-36465171 CCATTCTTGCAGGAGTGAGGTGG + Intronic
952732922 3:36658631-36658653 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
952984418 3:38764895-38764917 CCATTCTTGCAGGAGTAAGGTGG + Intronic
953103540 3:39853445-39853467 CCATTCTTGCAGGAGTAAGGTGG + Intronic
953185766 3:40637056-40637078 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
953523657 3:43668121-43668143 CCATTCTTGCAGGAGTAAGGTGG + Intronic
953639918 3:44697372-44697394 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
953723316 3:45375368-45375390 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
953866970 3:46592637-46592659 CCATTCTTGCAGGAGTAAGGTGG - Intronic
953874177 3:46655993-46656015 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
954162900 3:48734670-48734692 CCATCCTGGAGGGAGGTGGGGGG + Intronic
954196622 3:49000936-49000958 CCATCTTTGCAGGAAATTGGAGG + Intronic
954461675 3:50630340-50630362 ACATGTTTGCAGGAGTTGGGAGG + Intronic
954472566 3:50710463-50710485 CCATTCTTGCAGGAGTAAGGTGG - Intronic
954521647 3:51232563-51232585 CCATTCTTGCAGGAGTAAGGTGG + Intronic
954934571 3:54314595-54314617 CCATTCTTGCAGGAGTAAGGTGG + Intronic
955240372 3:57172682-57172704 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
955638162 3:61053106-61053128 CCTTCCCTGCAGTGGATGGGAGG - Intronic
955848630 3:63195343-63195365 CATTCCTTGGAGGAGGTGGGGGG + Intergenic
956299191 3:67751324-67751346 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
956524424 3:70141984-70142006 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
957015798 3:75063495-75063517 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
957312382 3:78537576-78537598 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
957671672 3:83312986-83313008 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
957721196 3:84001733-84001755 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
958490171 3:94762583-94762605 CCATCCTTGCAGGAGTAAAGTGG + Intergenic
958578023 3:95977411-95977433 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
958646651 3:96883115-96883137 CCATACTTGCAGGAGTAAGGTGG + Intronic
958673030 3:97228908-97228930 CCATTCTTGCAGGAGTAAGGTGG + Intronic
958741297 3:98076377-98076399 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
958808786 3:98837924-98837946 CCATCCGGGAGGGAGATGGGGGG - Intronic
958897132 3:99841786-99841808 CCATTCTTGCAGGAGTAAGGTGG - Intronic
958986423 3:100784330-100784352 CCATTCTTGCAGGAGAAAGGTGG - Intronic
959867590 3:111288954-111288976 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
959878196 3:111411883-111411905 CCATTCTTGCAGGAGTGAGGTGG - Intronic
960105486 3:113791539-113791561 TCATCTTTGTAGGAGATGAGAGG + Intronic
960152606 3:114265497-114265519 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
960535125 3:118807179-118807201 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
960549201 3:118954864-118954886 CCATTCTTGCAGGAGTAAGGTGG - Intronic
960595444 3:119404010-119404032 CCATCCTGAAAGGAAATGGGAGG - Intronic
960778653 3:121292343-121292365 CCATTCTTGCAGGAGAAAGATGG - Intronic
960857130 3:122113542-122113564 CCATTCTTGCAGGAGTAAGGTGG + Intronic
960917350 3:122709728-122709750 CCATTCTTGCAGGAGTAAGGAGG + Intronic
961093372 3:124134829-124134851 CCATTCTTGCAGGAGTAAGGTGG - Intronic
962258279 3:133886952-133886974 CCATCCATTCAGCAGAGGGGTGG + Intronic
962502935 3:136013541-136013563 CCATTCTTGCAGGAGTAAGGTGG + Intronic
962591423 3:136893339-136893361 CCATTCTTGCAGGAGTAAGGTGG + Intronic
962717846 3:138142825-138142847 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
963176693 3:142305259-142305281 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
963623278 3:147639178-147639200 CCATTCTTGCAGGAGTAAGGCGG - Intergenic
963688021 3:148462713-148462735 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
963699667 3:148608625-148608647 CCATTCTTGCAGGAGTAAGGCGG + Intergenic
963816406 3:149836078-149836100 CCATTCTTGCAGGAGTAAGGTGG + Intronic
963832950 3:150028359-150028381 CCATTCTTGCAGGAGTGAGGTGG - Intronic
964115161 3:153128830-153128852 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
964161080 3:153646051-153646073 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
964161483 3:153651057-153651079 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
964537756 3:157743286-157743308 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
964841277 3:160996092-160996114 CCATTCTTGCAGGAGTAAGGTGG - Intronic
964915894 3:161841385-161841407 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
965185392 3:165456045-165456067 CCATTCTTGCAGGAGAAAGGTGG - Intergenic
965345573 3:167545150-167545172 CCATTCTTGCAGGAGTAAGGTGG - Intronic
965712584 3:171570622-171570644 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
965869130 3:173245425-173245447 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
966153836 3:176894496-176894518 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
966172142 3:177094277-177094299 CCATTCTTGCAGGAGTAAGGTGG - Intronic
966281940 3:178241743-178241765 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
966344074 3:178958954-178958976 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
966353085 3:179052448-179052470 CCATTCTTGCAGGAGTAAGGTGG - Intronic
966369331 3:179231487-179231509 CCATTCTTGCAGGAGTAAGGTGG + Intronic
966382332 3:179356244-179356266 CCACCCTTCCTGGAAATGGGTGG - Intronic
966671478 3:182531125-182531147 CCATTCTTGCAGGAGGAAGGTGG - Intergenic
966942457 3:184755652-184755674 TCATCCTTGCCTGACATGGGAGG + Intergenic
967246787 3:187495340-187495362 CCATTCTTGCAGGAGTTAGGTGG - Intergenic
967559315 3:190900000-190900022 CCATTCTTGCAGGAGTCAGGTGG - Intergenic
970151128 4:13091589-13091611 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
970268795 4:14320507-14320529 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
970269624 4:14331155-14331177 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
970469890 4:16367169-16367191 CCATACTTGCAGGAGTAAGGTGG + Intergenic
971042741 4:22772455-22772477 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
971589946 4:28454481-28454503 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
971905503 4:32719679-32719701 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
972013809 4:34218583-34218605 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
972166239 4:36287672-36287694 CCATTCTTGCAGGAGTAAGGTGG + Intronic
972190004 4:36579284-36579306 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
972269575 4:37497568-37497590 CCATTCTTGCAGGAGTAAGGTGG + Intronic
972800302 4:42468030-42468052 CCATTCTTGCAGGAGTAAGGTGG - Intronic
972806962 4:42538710-42538732 CCATTCTTGCAGGAGTAAGGTGG - Intronic
973036882 4:45417876-45417898 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
973037781 4:45427895-45427917 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
973068089 4:45822289-45822311 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
973068729 4:45830654-45830676 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
973113286 4:46422318-46422340 CCATTCTTGCAGGAGTAAGGTGG + Intronic
973161660 4:47025423-47025445 CCATTCTTGCAGGAGTAAGGCGG + Intronic
973237857 4:47925233-47925255 CCATTCTTGCAGGAGTAGGGTGG - Intronic
973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG + Intergenic
973831072 4:54759517-54759539 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
973926296 4:55741888-55741910 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
974011399 4:56610898-56610920 CCATCCTTTCAGGAGTAAGGTGG - Intergenic
974109764 4:57512061-57512083 ACATACTTGCAGGAGGTGGCTGG + Intergenic
974372643 4:61037580-61037602 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
974458129 4:62154994-62155016 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
974879859 4:67741738-67741760 CCATTCTTGCAGGAGTGAGGTGG + Intronic
975027387 4:69567954-69567976 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
975088627 4:70373795-70373817 CCATTCTTGCAGGAGTAAGGTGG + Intronic
975185241 4:71394454-71394476 CCATTCTTGCAGGAGTAAGGTGG - Intronic
975535000 4:75440847-75440869 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
975670497 4:76775360-76775382 CCATTCTTGCAGGAGTAAGGTGG - Intronic
975670564 4:76776156-76776178 CCATTCTTGCAGGAGTAAGGTGG + Intronic
975751247 4:77525835-77525857 CCATCAATTCAGCAGATGGGTGG + Intronic
975868975 4:78757585-78757607 CCACCCTGGCAGGAGAAGTGTGG + Intergenic
976048497 4:80982436-80982458 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
976791678 4:88885967-88885989 CCATTCTTGCAGGAGTAAGGTGG - Intronic
977502521 4:97859082-97859104 CCATTCTTGCAGGAGTAAGGTGG + Intronic
977509630 4:97946084-97946106 CCATTCTTGCAGGAGTGAGGTGG + Intronic
977510916 4:97961660-97961682 CCATTCTTGCAGGAGTAAGGTGG - Intronic
977513504 4:97991793-97991815 CCATTCTTGCAGGAGAAAGGTGG + Intronic
977622541 4:99153828-99153850 CCATTCTTGCAGGAGTAAGGTGG + Intronic
977695440 4:99959859-99959881 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
977747205 4:100563682-100563704 CCATTCTTGCAGGAGTAAGGTGG - Intronic
977904555 4:102460617-102460639 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
978201219 4:106025315-106025337 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
978340814 4:107720003-107720025 CCATCCTTCCAGGAGCGCGGAGG - Intronic
978397739 4:108299738-108299760 CCATTCTTGCAGGAGTGTGGTGG + Intergenic
978538001 4:109783477-109783499 CCATTCTTGCAGGAGTAAGGTGG - Intronic
978670853 4:111245511-111245533 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
978726177 4:111972285-111972307 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
978762253 4:112366503-112366525 CCATTCTTGCAGGAGTAAGGTGG - Intronic
978772442 4:112470873-112470895 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
978947948 4:114521577-114521599 CCATTCTTGCAGGAGTAGGGTGG + Intergenic
978986585 4:115020865-115020887 CCATTCTTGCAGGAGTAAGGTGG - Intronic
979159607 4:117443009-117443031 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
979381653 4:120013381-120013403 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
979479765 4:121202878-121202900 CCATTCTTGCAGGAGTAAGGTGG - Intronic
979497968 4:121406053-121406075 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
979570388 4:122216452-122216474 CCATTCTTGCAGGAGTAAGGTGG + Intronic
979691755 4:123566450-123566472 CCATTCTTGCAGGAGTAGGATGG + Intergenic
979794491 4:124829774-124829796 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
980086761 4:128398829-128398851 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
980152765 4:129068409-129068431 CCATTCTTGCAGGAGTAAGGTGG + Intronic
980286453 4:130783642-130783664 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
980644685 4:135628078-135628100 CCATACTTGCAGGAGTGAGGTGG + Intergenic
980860807 4:138497237-138497259 CTATCCTTGCAGGAGTGAGGTGG + Intergenic
981052971 4:140329753-140329775 CCATACTTGCAGGAGCGAGGTGG - Intronic
981224469 4:142277017-142277039 CCATTCTTCCAGGAGTTAGGTGG + Intronic
981347147 4:143689329-143689351 CCATTCTTGCAGGAGTGAGGTGG - Intronic
981400486 4:144308274-144308296 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
981559845 4:146035191-146035213 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
981680729 4:147394830-147394852 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
981760307 4:148187393-148187415 CCATTCTTGCAGGAGTGAGGTGG + Intronic
981795157 4:148587428-148587450 CCATTATTGCAGGAGTTAGGTGG + Intergenic
981967287 4:150620258-150620280 CCATTCTTGCAGGAGTAGGGTGG - Intronic
982020355 4:151196945-151196967 CCATTCTTGCAGGAGTAGAGGGG - Intronic
982531561 4:156551020-156551042 CCATTCTTGCAGGAGTAGGGTGG + Intergenic
982628563 4:157801391-157801413 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
982640789 4:157957505-157957527 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
982832077 4:160075232-160075254 CCATTCTTGCAGGAGCAAGGTGG - Intergenic
982950979 4:161695648-161695670 CCATTCTTGCAGGAGTTAGGTGG + Intronic
982959731 4:161822118-161822140 CCATTCTTGCAGGAGTAAGGTGG + Intronic
982984995 4:162195753-162195775 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
983175267 4:164580673-164580695 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
983233930 4:165157704-165157726 CCATTCTTGCAGGAGTAAGGTGG - Intronic
983271060 4:165562175-165562197 CTATCCTTGCAGGAGTAAGGTGG + Intergenic
983477554 4:168233162-168233184 CCATCCTTACAGGAGTAAGGTGG - Intronic
983544438 4:168948065-168948087 CCATTCTTGCAGGAGTAAGGTGG + Intronic
983749495 4:171248054-171248076 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
983893975 4:173061713-173061735 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
983962595 4:173772661-173772683 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
984266031 4:177498879-177498901 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
984527100 4:180870519-180870541 CCATTCTTGCAGGAGTATGGTGG + Intergenic
984851771 4:184160339-184160361 CCATTCTTGCAGGAGTAAGGTGG + Intronic
984851843 4:184161343-184161365 CCATTCTTGCAGGAGTAAGGTGG - Intronic
984986626 4:185336849-185336871 CCATTCTTGCAGGAGTAAGGTGG + Intronic
985093349 4:186386895-186386917 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
985150664 4:186944005-186944027 CCAACCTGGCGGGAGAGGGGAGG + Intergenic
985217565 4:187670512-187670534 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
985240277 4:187923823-187923845 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
985326003 4:188770871-188770893 CCATTCTTGCAGGAGTGAGGAGG + Intergenic
985417186 4:189748269-189748291 CCATTTTTGCAGGAGAAAGGTGG - Intergenic
986051553 5:4094815-4094837 CCATCCTTCCAGGAGACATGGGG - Intergenic
986099852 5:4597401-4597423 CCATTCTTGCAGGAGCAAGGTGG - Intergenic
986355292 5:6918281-6918303 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
986362748 5:6997041-6997063 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
986917789 5:12644425-12644447 CCATTCTTGCAGGAGTAAGGGGG - Intergenic
987170469 5:15252063-15252085 CCATTCTTGCAGAAGAAAGGTGG - Intergenic
987185567 5:15414400-15414422 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
987413994 5:17643595-17643617 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
987554707 5:19431958-19431980 CCATTCTTGCAGGAGTTAAGTGG + Intergenic
987911274 5:24149424-24149446 CCATTCTTGCAGGAGTAAGGTGG + Intronic
988148398 5:27341891-27341913 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
988173898 5:27695454-27695476 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
988278063 5:29108598-29108620 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
988367775 5:30323527-30323549 CCATTCTTGCAGGGGTAGGGGGG + Intergenic
988639794 5:33029136-33029158 CCATTCTTGCAGGAGTAAGGCGG - Intergenic
988731436 5:33976619-33976641 CCCTCCCTGCAGGACAGGGGTGG + Intronic
988902675 5:35750647-35750669 CCATTCTTGCAGGAGTAAGGTGG - Intronic
988929285 5:36020119-36020141 CCATCCTTGCAGAAGTGAGGTGG + Intergenic
989028908 5:37096857-37096879 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
989355015 5:40534015-40534037 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
989378849 5:40794180-40794202 CCATTCTTGCAGGAGTGAGGTGG + Intronic
989412078 5:41131473-41131495 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
989561743 5:42859824-42859846 CCATTCTTGCAGGAGGGAGGTGG + Intronic
989645666 5:43629664-43629686 CCATTCTTGCAGGAGTAAGGTGG + Intronic
990104638 5:52243636-52243658 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
990441500 5:55850609-55850631 CCATCCCAACAGCAGATGGGGGG - Intergenic
991007195 5:61840971-61840993 CCATGCTTGCAGGAGGTGAATGG - Intergenic
991418833 5:66419658-66419680 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
991553066 5:67864207-67864229 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
991723481 5:69515286-69515308 CCATCCGGGAAGGAGGTGGGGGG - Intronic
992239830 5:74756339-74756361 CCATTCTTGCAGGAGTAAGGTGG - Intronic
992263578 5:74994667-74994689 CAATCCTGGCAGGAGACTGGAGG + Intergenic
992263601 5:74994847-74994869 AAATCCATGCAGGAGATGAGGGG + Intergenic
992350489 5:75923714-75923736 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
992611929 5:78515523-78515545 CCATCCTTGCAGAAGAAACGGGG - Intronic
992978092 5:82139823-82139845 CCATCCGGGAGGGAGATGGGGGG + Intronic
993277399 5:85878151-85878173 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
993298821 5:86181398-86181420 CCATTCTTGCAGGAGAAAGATGG - Intergenic
993447987 5:88038144-88038166 CCATTCTTGCAGGAGTAAGGCGG + Intergenic
993484331 5:88463786-88463808 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
993608732 5:90028626-90028648 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
993883446 5:93389799-93389821 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
994050879 5:95360701-95360723 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
994069569 5:95585134-95585156 CCATTCTTGCAGGAGTAAGGTGG - Intronic
994164082 5:96590435-96590457 CAACCCTTGGAGCAGATGGGTGG + Intronic
994287662 5:97989873-97989895 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
994347709 5:98706906-98706928 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
994680632 5:102882413-102882435 CCATTCTTGCAGGAGTAAGGTGG + Intronic
994823642 5:104684299-104684321 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
994953748 5:106499485-106499507 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
995134517 5:108666511-108666533 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
995150797 5:108842696-108842718 CCATTCTTGCAGGAGTAAGGAGG - Intronic
995293308 5:110486008-110486030 CCATTCTTGCAGGAGTAAGGTGG + Intronic
995366902 5:111372290-111372312 CCATGGTTGAGGGAGATGGGAGG - Intronic
995375308 5:111467655-111467677 CCATTCTTGCAGGAGTAAGGTGG - Intronic
995431842 5:112088209-112088231 GCATCCTTGCAGGAGAGTGGGGG - Intergenic
995723068 5:115157117-115157139 CCATTCTTGCAGGAGTAAGGTGG - Intronic
995753713 5:115479528-115479550 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
996128684 5:119754784-119754806 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
996325852 5:122272519-122272541 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
996561708 5:124837065-124837087 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
996694570 5:126379594-126379616 CCATTCTTGCAGGAGTAAGGTGG + Intronic
996795885 5:127346395-127346417 CCATTCTTGCAGGAGTAAGGCGG + Intronic
997003590 5:129792049-129792071 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
997775804 5:136603072-136603094 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
997780229 5:136650364-136650386 CCCTCCTTGCAGGAGTGAGGTGG + Intergenic
997876556 5:137553418-137553440 CCATTCTTGCAGGAGTGAGGTGG + Intronic
998128601 5:139639910-139639932 CCATGCTTGCCTGAGATGGCAGG + Intergenic
998523868 5:142825048-142825070 CCAAGCTTGAAGGAGAGGGGAGG - Intronic
998634920 5:143942706-143942728 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
998941310 5:147285742-147285764 CCATTCTTGCAGGAGTAAGGTGG - Intronic
999345191 5:150812209-150812231 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
999490727 5:152048055-152048077 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
999526159 5:152408300-152408322 CCATTCTTGCAGGAGTAAGGTGG + Intronic
999741316 5:154555649-154555671 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
999800844 5:155034039-155034061 CCATTCTTGCAGGAGTAAGGCGG + Intergenic
999819236 5:155208658-155208680 CCATTCTTGCAGGAGGAAGGTGG - Intergenic
999822568 5:155242453-155242475 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
999916126 5:156263288-156263310 CCATTCTTGCAGGAGTAAGGTGG + Intronic
999959538 5:156739511-156739533 CCTACCCTGCAGGAAATGGGAGG - Intronic
1000159479 5:158583341-158583363 CCATCCGGGAAGGAGGTGGGGGG + Intergenic
1000271959 5:159694533-159694555 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1000497876 5:162008480-162008502 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1000688462 5:164283882-164283904 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1000757388 5:165178510-165178532 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1001214972 5:169847383-169847405 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1001291178 5:170462432-170462454 CCATCCTTGCAAGAGTGAGGTGG - Intronic
1001363785 5:171116315-171116337 CCCTCTTTGTAGAAGATGGGAGG - Intronic
1002097781 5:176841875-176841897 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1002209246 5:177586399-177586421 CCATCCTTGCAGGAGTAAGGTGG + Intergenic
1002848972 6:974643-974665 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1003163514 6:3656230-3656252 GCCTCCTTGCAGGAGAAGCGTGG - Intergenic
1003433367 6:6060988-6061010 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1003582456 6:7353342-7353364 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1003675255 6:8198106-8198128 CCATTCTTGCAGGAGTCAGGTGG + Intergenic
1003711547 6:8597651-8597673 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1004081617 6:12400176-12400198 CCATTCTTGCAGGAGTAAGGAGG - Intergenic
1004711509 6:18175175-18175197 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1004778033 6:18870916-18870938 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1004835467 6:19526731-19526753 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1005100164 6:22163444-22163466 CCATTCTTGAAGGAGTAGGGTGG + Intergenic
1005305401 6:24508807-24508829 CCAACCTTGCAGGAGTAAGGTGG + Intronic
1005435620 6:25808154-25808176 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1006287760 6:33110647-33110669 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1006492381 6:34397778-34397800 CCATCCGGGAGGGAGATGGGGGG + Intronic
1007412096 6:41670649-41670671 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1007837700 6:44687050-44687072 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1008095960 6:47339686-47339708 TCATCCTTGCAGGAGTAAGGTGG - Intergenic
1008121254 6:47619757-47619779 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1008313250 6:50004686-50004708 CCATTCTTGCAGGAGTCAGGTGG - Intergenic
1008416183 6:51243525-51243547 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1008774927 6:55026783-55026805 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1008926899 6:56896648-56896670 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1008973124 6:57393343-57393365 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1009162030 6:60294882-60294904 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1009625014 6:66127500-66127522 CCATCTTTGCAAGGGGTGGGAGG + Intergenic
1010015114 6:71095947-71095969 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1010458746 6:76088601-76088623 CCATTCTTGCAGGAGAAAGATGG + Intergenic
1010517954 6:76797546-76797568 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1010596984 6:77775879-77775901 CCATTCTTGCAGGAGCAAGGTGG + Intronic
1010817114 6:80371177-80371199 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1010880222 6:81158568-81158590 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1011016353 6:82760064-82760086 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1011093064 6:83628558-83628580 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1011196709 6:84787984-84788006 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1011297313 6:85838896-85838918 CCATCCGGGAGGGAGATGGGGGG + Intergenic
1011320720 6:86089620-86089642 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1011373042 6:86660292-86660314 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1011589539 6:88958662-88958684 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1011618898 6:89223731-89223753 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1011653066 6:89524916-89524938 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1011789245 6:90880180-90880202 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1011817201 6:91206290-91206312 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1011896074 6:92227513-92227535 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1012156331 6:95824236-95824258 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1012207963 6:96484441-96484463 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1012273311 6:97241488-97241510 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1012320411 6:97837992-97838014 CCATTCTTGCAGGAGTAAGGCGG - Intergenic
1012536459 6:100303815-100303837 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1012547701 6:100438414-100438436 CCATCCTTGCAGGTGTAAGGTGG - Intronic
1012738261 6:102978794-102978816 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1012745021 6:103075619-103075641 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1012923186 6:105241012-105241034 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1013256473 6:108391318-108391340 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1013438069 6:110133578-110133600 CCATTCTTGCAGGAGCAAGGTGG + Intronic
1013450164 6:110272656-110272678 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1013553689 6:111235373-111235395 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1013793767 6:113860946-113860968 CCATATATGAAGGAGATGGGTGG + Exonic
1013913458 6:115306628-115306650 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1014036978 6:116777929-116777951 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1014285488 6:119492640-119492662 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1014304409 6:119722514-119722536 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1014481632 6:121945982-121946004 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1014581794 6:123146959-123146981 CCATCCTTGCAGGAGTAAGGTGG - Intergenic
1014592064 6:123285977-123285999 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1014604331 6:123453561-123453583 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1015361930 6:132349810-132349832 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1015582888 6:134745664-134745686 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1015718965 6:136221091-136221113 TCATTCTTGCAGGAGTAGGGTGG + Intergenic
1015900344 6:138058721-138058743 TCATCCTTGCAGGAGTAAGGTGG - Intergenic
1015914387 6:138201122-138201144 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1016365964 6:143318929-143318951 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1016496649 6:144670314-144670336 CCATTCTTGCAGGAGTAAGGGGG + Intronic
1017056245 6:150438473-150438495 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1017375583 6:153763981-153764003 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1017534830 6:155335774-155335796 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1017944437 6:159082383-159082405 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1018010088 6:159661885-159661907 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1018157088 6:160995136-160995158 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1018349216 6:162938689-162938711 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1018353217 6:162984697-162984719 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1018383106 6:163278024-163278046 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1018597191 6:165494121-165494143 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1018778361 6:167039793-167039815 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1019282160 7:205993-206015 CCAGCCCTGCAGGAGATGGCGGG - Intronic
1019304262 7:325417-325439 CCATCGTGGAAGGAGAAGGGTGG - Intergenic
1019465402 7:1185480-1185502 CCATCCTTTCAGGGCATGGCAGG - Intergenic
1019865372 7:3704393-3704415 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1020041907 7:5010530-5010552 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1020331912 7:7027179-7027201 CCATTCTTGCAGGAGTAAGGCGG + Intergenic
1020348612 7:7192842-7192864 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1020374879 7:7473489-7473511 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1020788761 7:12599708-12599730 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1021045174 7:15913933-15913955 CTATCCTTGCAGGAGTAAGGTGG - Intergenic
1021978256 7:26029845-26029867 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1022295798 7:29051549-29051571 CCATCCTTGCAGGAGTGAGGTGG - Intronic
1022777512 7:33543148-33543170 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1023023042 7:36027961-36027983 CCCTCCGTGCTGTAGATGGGAGG - Intergenic
1023355683 7:39364956-39364978 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1023537477 7:41228697-41228719 CCATTCTTGCAGGAGGGAGGTGG + Intergenic
1023709724 7:42979158-42979180 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1023748481 7:43346183-43346205 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1024090306 7:45933968-45933990 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1024351432 7:48369091-48369113 CCATTCTTGCAGGAGTAGAGTGG + Intronic
1024668851 7:51572494-51572516 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1024776646 7:52795381-52795403 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1024782706 7:52870393-52870415 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1024840358 7:53578546-53578568 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1024854600 7:53763648-53763670 CCATGCTTGCAGGAGTGAGGTGG - Intergenic
1024917675 7:54521719-54521741 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1025155940 7:56606003-56606025 CCTTCCTTGCATGAGGTGGGGGG - Intergenic
1025762178 7:64405145-64405167 CCATCCTTGCACAAGGTGGGGGG + Intergenic
1025772120 7:64519292-64519314 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1026445941 7:70484935-70484957 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1026761332 7:73128466-73128488 CCATGATTACAGGAGATGTGAGG - Intergenic
1027037675 7:74937260-74937282 CCATGATTACAGGAGATGTGAGG - Intergenic
1027085889 7:75264194-75264216 CCATGATTACAGGAGATGTGAGG + Intergenic
1027295866 7:76769495-76769517 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1027417363 7:77987282-77987304 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1027650614 7:80863301-80863323 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1027732782 7:81897266-81897288 CCATTCTTGCAGGAGGAAGGAGG + Intergenic
1027982292 7:85241119-85241141 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1028059131 7:86287864-86287886 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1028182587 7:87743505-87743527 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1028198223 7:87932190-87932212 CCATCCTTGCAGGAGTAAGGTGG - Intergenic
1028490163 7:91402238-91402260 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1028496875 7:91471348-91471370 CCATTCTTGCAGGAGCAAGGTGG + Intergenic
1028506387 7:91575344-91575366 CCATTCTTGCAGGAACAGGGTGG + Intergenic
1028703283 7:93808699-93808721 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1028760535 7:94491161-94491183 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1028823090 7:95235473-95235495 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1028961781 7:96756845-96756867 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1029152995 7:98494282-98494304 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1029308256 7:99638207-99638229 CTCTCCTTCCAGGGGATGGGTGG + Intergenic
1029507007 7:100968705-100968727 CCATCCTTGCAAAAGGTGGCTGG - Intergenic
1029787234 7:102804983-102805005 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1029811828 7:103056849-103056871 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1029884313 7:103850788-103850810 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1030326194 7:108221150-108221172 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1030425684 7:109374285-109374307 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1030533732 7:110740710-110740732 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1031006139 7:116474795-116474817 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1031611535 7:123833268-123833290 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1031625651 7:123989834-123989856 CCATTCTTGCAGGAGTCAGGTGG + Intergenic
1031709680 7:125030122-125030144 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1031728711 7:125269904-125269926 CCATTCTTGCAGGAGCAAGGTGG + Intergenic
1031760670 7:125709526-125709548 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1032075935 7:128836237-128836259 CTATCTTTTCAGGAGATGAGGGG - Intronic
1032289132 7:130571501-130571523 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1032290478 7:130585769-130585791 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1032394003 7:131575965-131575987 CCATCACTGCAGGAGCTGGGAGG + Intergenic
1032953607 7:136944937-136944959 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1032999616 7:137489479-137489501 GCATCTTTGCAGGAAATGGAAGG + Intronic
1033078710 7:138273861-138273883 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1033182414 7:139193835-139193857 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1033462626 7:141561456-141561478 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1033530648 7:142259806-142259828 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1033577771 7:142702530-142702552 CCATCTAGGAAGGAGATGGGTGG + Intergenic
1033615957 7:143014243-143014265 CCATTCTTGCAGGAGCTCTGGGG + Intergenic
1033628544 7:143134549-143134571 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1033828905 7:145227888-145227910 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1033980951 7:147165186-147165208 CCATTCTTGCAGGAGTAAGGGGG + Intronic
1034002343 7:147429271-147429293 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1034208071 7:149335861-149335883 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1034216295 7:149408905-149408927 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1034268117 7:149790954-149790976 CCAGCCTGGGAGGAGCTGGGGGG - Intergenic
1034376693 7:150651190-150651212 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1034432103 7:151046178-151046200 CCAGCACTGAAGGAGATGGGAGG + Intronic
1034682755 7:152941995-152942017 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1034715969 7:153241852-153241874 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1035151752 7:156879805-156879827 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1035255655 7:157625033-157625055 CCATTCTTGCAGGAGGAAGGTGG - Intronic
1035412624 7:158657512-158657534 ACATCCTTGAGGGAGGTGGGGGG + Intronic
1035470902 7:159107935-159107957 TCATCCTTCCAGCAGGTGGGAGG - Intronic
1035741323 8:1930374-1930396 CCATCCAGGCGGGAGCTGGGCGG - Intronic
1035840916 8:2811175-2811197 CCACCCTTTCAGGAGATGGCTGG - Intergenic
1035852136 8:2931115-2931137 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1037307819 8:17524057-17524079 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1037320389 8:17635811-17635833 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1037353557 8:17992436-17992458 CCATTCTTGCAGGAGTAGGATGG + Intronic
1037358544 8:18048817-18048839 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1037560448 8:20069241-20069263 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1037686165 8:21141431-21141453 AGATCCTAGCAGGAGATGGAGGG + Intergenic
1038030183 8:23631652-23631674 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1038143757 8:24874763-24874785 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1039091324 8:33832745-33832767 CCATCCTTGCAGGAGTAAGGTGG - Intergenic
1039198394 8:35059037-35059059 CCATTCTTGCAGGAGTTAGGTGG + Intergenic
1039572104 8:38595079-38595101 CCATCCTTGCAGGAGTAAAGTGG - Intergenic
1039643720 8:39255416-39255438 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1039653573 8:39373011-39373033 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1039710102 8:40047415-40047437 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1039728109 8:40243739-40243761 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1039748056 8:40450008-40450030 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1039810073 8:41039029-41039051 CCATGCTTGCAGGAGTAAGGTGG + Intergenic
1040018442 8:42719341-42719363 ACATCCTGGCAGGAATTGGGTGG + Intronic
1040809780 8:51439377-51439399 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1040843878 8:51814854-51814876 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1041212484 8:55566644-55566666 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1041228206 8:55721806-55721828 CCATTCTTGCAGGAGAGATGTGG - Intronic
1041577570 8:59417519-59417541 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1041832436 8:62169990-62170012 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1041885111 8:62799498-62799520 CCATTCTTGCAGGAGTTAGGTGG - Intronic
1042089038 8:65138906-65138928 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1042095182 8:65207549-65207571 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1042122344 8:65501789-65501811 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1042161005 8:65895396-65895418 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1042188449 8:66160706-66160728 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1042212240 8:66392340-66392362 CTATCCTTCTAGGAGAAGGGAGG - Intergenic
1042214257 8:66413589-66413611 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1042313766 8:67404183-67404205 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1042429432 8:68688080-68688102 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1042608402 8:70570733-70570755 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1042616562 8:70655888-70655910 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1042897302 8:73685290-73685312 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1042995970 8:74699061-74699083 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1043377036 8:79661323-79661345 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1043628042 8:82289022-82289044 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1043671916 8:82896920-82896942 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1043691674 8:83161003-83161025 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1044228094 8:89742307-89742329 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1044271788 8:90253248-90253270 CTCTCCTTGCAGGAGGTTGGGGG - Intergenic
1044656743 8:94556264-94556286 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1044787813 8:95814086-95814108 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1045613535 8:103877236-103877258 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1046016383 8:108610242-108610264 TCATCCTTCCCCGAGATGGGGGG + Intronic
1046369530 8:113283532-113283554 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1047006966 8:120630533-120630555 GGATCCTGGCAGGAGATGGATGG - Intronic
1047175727 8:122538599-122538621 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1047593168 8:126348933-126348955 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1047798373 8:128282377-128282399 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1048040796 8:130726521-130726543 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1048257881 8:132919142-132919164 ACATGCTTGTAGGAGATGAGAGG - Intronic
1049353257 8:142175453-142175475 GCATCCCTGCAGGTGCTGGGTGG - Intergenic
1049491918 8:142909422-142909444 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1050428980 9:5542640-5542662 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1050789678 9:9450454-9450476 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1050806111 9:9680689-9680711 CAATCCTAGGAGGAGATGGTGGG - Intronic
1050999186 9:12259181-12259203 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1051600941 9:18873009-18873031 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1051700660 9:19819661-19819683 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1051881627 9:21846539-21846561 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1052053213 9:23873199-23873221 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1052053494 9:23876629-23876651 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1052247405 9:26352758-26352780 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1052253984 9:26432139-26432161 CCGTTCTTGCAGGAGTTAGGTGG - Intergenic
1052306987 9:27021520-27021542 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1052347003 9:27420108-27420130 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1052537598 9:29767055-29767077 CCATTCTTGCAGGAGTAGGGGGG - Intergenic
1052708609 9:32023807-32023829 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1052951310 9:34214929-34214951 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1053043976 9:34898362-34898384 CCATTCTTGCAGGAGTAAGGCGG + Intergenic
1055061275 9:72071663-72071685 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1055139634 9:72861305-72861327 CCATTCTTGCAGGAGTTACGTGG + Intergenic
1055186726 9:73465484-73465506 CCATTCTTGCGGGAGTAGGGTGG + Intergenic
1055335057 9:75224999-75225021 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1055656830 9:78459018-78459040 CCATTCTTGCAGGAGTAGGATGG - Intergenic
1056309854 9:85329470-85329492 CCATTCTTGCAGGAGGAAGGTGG - Intergenic
1056322281 9:85447017-85447039 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1056456927 9:86769249-86769271 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1056511748 9:87313069-87313091 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1056698595 9:88881930-88881952 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1056819868 9:89832314-89832336 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1056948541 9:91023095-91023117 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1057284991 9:93744897-93744919 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1057450374 9:95153515-95153537 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1057644043 9:96855944-96855966 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1057873858 9:98738539-98738561 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1058156234 9:101519002-101519024 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1058276450 9:103047492-103047514 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1058307975 9:103466434-103466456 CCATTCTTGCAGTAGAAAGGTGG + Intergenic
1058348566 9:103994243-103994265 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1058572729 9:106365074-106365096 CCATTCTTGCAGGAGTTAGCTGG + Intergenic
1058644406 9:107117199-107117221 CCATCCTCGAAAGAGAAGGGTGG - Intergenic
1058721021 9:107764002-107764024 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1058771189 9:108233963-108233985 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1058832139 9:108828281-108828303 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1059074992 9:111183369-111183391 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1059397240 9:114043737-114043759 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG + Exonic
1059499715 9:114741096-114741118 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1059666191 9:116448425-116448447 CCCTCACTGCAGGAGATGGGAGG - Intronic
1060383310 9:123197992-123198014 CCATTCTTTCAGGAGTAGGGTGG + Intronic
1060801077 9:126546214-126546236 CCATCCATGTGGGAGGTGGGAGG + Intergenic
1060940341 9:127539797-127539819 CCCTGTTTGCAGGTGATGGGGGG - Intronic
1061377524 9:130235132-130235154 CCATCCCTGCAGGATGTTGGTGG - Exonic
1061656550 9:132095895-132095917 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1062515649 9:136933881-136933903 GCAGCCTTGCAGGAGCTGTGGGG + Intronic
1203518390 Un_GL000213v1:25434-25456 CCATCGTTGCCGGAGACTGGAGG - Intergenic
1203635957 Un_KI270750v1:111380-111402 CCATTTTTGCAGGAGAAAGGTGG + Intergenic
1185581459 X:1213418-1213440 CCATCCATGGAGGGGAGGGGAGG - Intergenic
1185852598 X:3503176-3503198 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1186551689 X:10512641-10512663 CCATCTTTGCAGGTGTTGGAAGG - Intronic
1186621757 X:11248720-11248742 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1186941529 X:14513718-14513740 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1187218717 X:17302499-17302521 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1187499507 X:19828008-19828030 CCCTCCTGGCGGGGGATGGGGGG - Intronic
1187695704 X:21917621-21917643 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1187849124 X:23573984-23574006 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1187994017 X:24905959-24905981 CCATCCTTGCAGCAGTAAGGTGG - Intronic
1188367558 X:29333538-29333560 CCATCCTGGAGGGAGGTGGGGGG - Intronic
1188699698 X:33242784-33242806 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1188737778 X:33739906-33739928 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1188799314 X:34507555-34507577 ACATTCTTGCAGGAGTAGGGTGG + Intergenic
1188909681 X:35831193-35831215 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1189130940 X:38497551-38497573 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1189133608 X:38526255-38526277 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1189174891 X:38946291-38946313 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1189489815 X:41461720-41461742 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1189531537 X:41889337-41889359 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1189544799 X:42030382-42030404 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1189836086 X:45024325-45024347 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1189896308 X:45659885-45659907 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1189927929 X:45976386-45976408 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1189945579 X:46174233-46174255 CCATTCTTGCAGGAGTTAGGTGG + Intergenic
1190034220 X:47005610-47005632 CCATCTTTGCTGGAGAAGGTTGG - Intronic
1190449384 X:50563172-50563194 CCATACTTGCAGGAGTAAGGTGG - Intergenic
1190631705 X:52393498-52393520 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1190933788 X:54974907-54974929 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1190960123 X:55238086-55238108 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1190975106 X:55391514-55391536 CCATTTTTGCAGGAGTAGGGTGG - Intergenic
1191012990 X:55780277-55780299 CCATTCTTGCAGGAGCAAGGTGG - Intergenic
1191164493 X:57373414-57373436 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1191770032 X:64745143-64745165 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1191806596 X:65142191-65142213 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1191872010 X:65754574-65754596 CCATTCTTGCAGGAGTAGGGTGG - Intergenic
1191944852 X:66521873-66521895 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1192068668 X:67913726-67913748 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1192155402 X:68742540-68742562 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1192251839 X:69420271-69420293 CCATCCTGACACAAGATGGGGGG - Intergenic
1192686682 X:73314228-73314250 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1192820683 X:74642125-74642147 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1192904400 X:75535044-75535066 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1192932469 X:75822281-75822303 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1192985022 X:76388923-76388945 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1193015781 X:76732564-76732586 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1193063029 X:77226574-77226596 CCATTCTTGCAGGAGTAAGGCGG - Intergenic
1193077374 X:77369230-77369252 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1193102085 X:77625699-77625721 CCATGCTTGCAGGAGTAAGGTGG - Intronic
1193119546 X:77808840-77808862 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1193185950 X:78512952-78512974 CCATACTTGCAGGAGTAAGGTGG - Intergenic
1193189553 X:78553373-78553395 CCATCCTTGCAGGAGGAAGGTGG - Intergenic
1193208262 X:78774581-78774603 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1193354358 X:80500523-80500545 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1193397872 X:81006802-81006824 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1193405374 X:81094644-81094666 CCATTCTTGCAGGAGTAGGGTGG - Intergenic
1193638194 X:83979097-83979119 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1193688518 X:84609686-84609708 CCATTCTTGCAGGATTAGGGTGG - Intergenic
1193690815 X:84640291-84640313 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1193694002 X:84684353-84684375 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1193778617 X:85675679-85675701 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1193863844 X:86704700-86704722 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1193877458 X:86878272-86878294 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1193964321 X:87966033-87966055 CCATTCTTGCAGGATTTAGGTGG - Intergenic
1193989647 X:88290609-88290631 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1194028025 X:88778092-88778114 CCATTCTTGCAGGAGCAAGGTGG + Intergenic
1194031144 X:88817131-88817153 CCATCCTTGCAGGAGTAAGGTGG - Intergenic
1194081079 X:89465936-89465958 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1194104181 X:89747844-89747866 CCATACTTGCAGGAGTAAGGTGG + Intergenic
1194213891 X:91104572-91104594 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1194225683 X:91254175-91254197 CCATTCTTGCAGGAGCAAGGTGG + Intergenic
1194239522 X:91427266-91427288 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1194353470 X:92851848-92851870 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1194354304 X:92862170-92862192 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1194412031 X:93569067-93569089 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1194469870 X:94280408-94280430 CCATTCTTGCAGCAGTTAGGTGG + Intergenic
1194471056 X:94297360-94297382 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1194544894 X:95221053-95221075 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1194557311 X:95376391-95376413 CCATCCTTGCAGGAGTAAGGTGG - Intergenic
1194601759 X:95930016-95930038 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1194633557 X:96316252-96316274 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1194669378 X:96711367-96711389 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1194906491 X:99582917-99582939 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1194907201 X:99592986-99593008 CCATTCTTGCAGGAGTAGGGTGG - Intergenic
1194932399 X:99903485-99903507 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1194967776 X:100308832-100308854 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1194968949 X:100321457-100321479 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1195018951 X:100806905-100806927 CCATTCTTGCAGGAGTAAGGAGG + Intergenic
1195135275 X:101899992-101900014 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1195653995 X:107316928-107316950 AAACCCTTGCAGGAGATGGCTGG - Intergenic
1195734436 X:107998043-107998065 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1195824184 X:108979408-108979430 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1195838679 X:109148711-109148733 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1195972327 X:110486546-110486568 CCATTCTTGCAGGAGGGAGGTGG + Intergenic
1196024574 X:111027621-111027643 CCATTCTTGCAGGAGTGAGGTGG - Intronic
1196090314 X:111733842-111733864 CCATTCTTGCAGGAGCGAGGCGG + Intronic
1196179532 X:112674739-112674761 CCATTCTTGCAGGAGAAAGGTGG - Intronic
1196260706 X:113577155-113577177 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1196372001 X:114989678-114989700 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1196478481 X:116116720-116116742 ACATTCTTGCAGGAGTTAGGTGG - Intergenic
1196531159 X:116788300-116788322 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1196946881 X:120835840-120835862 CCATCCTTGCATGAGTAAGGTGG + Intergenic
1197048776 X:122032721-122032743 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1197102923 X:122677959-122677981 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1197120516 X:122885580-122885602 CCATCCTTGCAGGAGTGAGGTGG - Intergenic
1197130456 X:122999798-122999820 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1197286097 X:124596975-124596997 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1197392894 X:125890296-125890318 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1197519361 X:127478164-127478186 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1197583673 X:128316411-128316433 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1197679297 X:129365191-129365213 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1198133175 X:133720009-133720031 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1198262763 X:134980452-134980474 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1198267954 X:135028042-135028064 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1198411670 X:136375573-136375595 CCATTCTTGCAGGAGTAAGGTGG + Intronic
1198569142 X:137936868-137936890 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1198616937 X:138468651-138468673 CCATCCTTGCAGGAGTAAGGTGG - Intergenic
1198668652 X:139053441-139053463 CCATTCTTGCAGGAGTAAGGAGG + Intronic
1198724269 X:139660275-139660297 CCATCCTGGAAGAAAATGGGAGG - Intronic
1198796713 X:140404480-140404502 CCATTCTTGCAGGAGTGAGGTGG + Intergenic
1198987241 X:142469325-142469347 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1199150144 X:144422376-144422398 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1199437821 X:147832689-147832711 CATTCCAGGCAGGAGATGGGAGG + Intergenic
1199498633 X:148484232-148484254 CCATTCTTGCAGGAGTGAGGTGG - Intergenic
1199521065 X:148736305-148736327 CCATTCTTGCAGGAGTGAGGTGG + Intronic
1199613711 X:149638918-149638940 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1199640039 X:149850987-149851009 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1199821498 X:151453416-151453438 CCATCCTTGTTGGGCATGGGAGG + Intergenic
1199914080 X:152320026-152320048 CCATCCTTTCAGGAGCTAGGTGG - Intronic
1199928244 X:152492165-152492187 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1200073359 X:153539593-153539615 CCGTCCCTGCAGCAGATGGCAGG + Intronic
1200284696 X:154809120-154809142 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1200317662 X:155150514-155150536 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1200340054 X:155386744-155386766 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1200415431 Y:2905183-2905205 CCATTCTTGCAGGAGTAAGGTGG - Intronic
1200456134 Y:3395653-3395675 CCATACTTGCAGGAGTAAGGTGG + Intergenic
1200562226 Y:4719062-4719084 CCATTCTTGCAGGAGCAAGGTGG + Intergenic
1200661829 Y:5968922-5968944 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1200662657 Y:5979203-5979225 CCATTCTTGCAGGAGTAAGGTGG - Intergenic
1200738108 Y:6822408-6822430 CCATTCTTGCAGGAGTAAGGTGG + Intergenic
1201408969 Y:13679288-13679310 CCATTCTTTCAGGAGTTTGGTGG - Intergenic
1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202224298 Y:22585515-22585537 CTTTCCTTGCTGGAGATGGAGGG - Intergenic
1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202551952 Y:26059912-26059934 CTTTCCTTGCTGGAGATGGAGGG - Intergenic