ID: 1073477112

View in Genome Browser
Species Human (GRCh38)
Location 10:103761638-103761660
Sequence CTGTGTGGGTGGCAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 853
Summary {0: 1, 1: 1, 2: 14, 3: 77, 4: 760}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073477112_1073477124 26 Left 1073477112 10:103761638-103761660 CCAGCCACCTGCCACCCACACAG 0: 1
1: 1
2: 14
3: 77
4: 760
Right 1073477124 10:103761687-103761709 TGACAGCCCGAGGGAGAGGCTGG No data
1073477112_1073477123 22 Left 1073477112 10:103761638-103761660 CCAGCCACCTGCCACCCACACAG 0: 1
1: 1
2: 14
3: 77
4: 760
Right 1073477123 10:103761683-103761705 GCAATGACAGCCCGAGGGAGAGG No data
1073477112_1073477121 16 Left 1073477112 10:103761638-103761660 CCAGCCACCTGCCACCCACACAG 0: 1
1: 1
2: 14
3: 77
4: 760
Right 1073477121 10:103761677-103761699 GAGATAGCAATGACAGCCCGAGG No data
1073477112_1073477122 17 Left 1073477112 10:103761638-103761660 CCAGCCACCTGCCACCCACACAG 0: 1
1: 1
2: 14
3: 77
4: 760
Right 1073477122 10:103761678-103761700 AGATAGCAATGACAGCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073477112 Original CRISPR CTGTGTGGGTGGCAGGTGGC TGG (reversed) Intronic
900012777 1:131252-131274 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
900042840 1:487239-487261 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
900064278 1:722230-722252 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
900123160 1:1058205-1058227 CTGTGTGCCTGGCAGGTGTCAGG + Intergenic
900126674 1:1071852-1071874 CTGTGCTGGTGGCCGGGGGCCGG + Exonic
900226248 1:1534871-1534893 CAGGGTGGGGTGCAGGTGGCTGG - Intergenic
900230608 1:1555144-1555166 CTGTGTGTGTGGCAGGGGCATGG - Intronic
900399073 1:2465587-2465609 CCCGGCGGGTGGCAGGTGGCGGG - Intronic
900738659 1:4316911-4316933 CAGTGTGAGTGGGTGGTGGCTGG + Intergenic
900802016 1:4743135-4743157 CTTTGAGGGTAGCAGTTGGCAGG - Intronic
902117096 1:14130242-14130264 GTGTGGGGAGGGCAGGTGGCTGG + Intergenic
902289910 1:15429065-15429087 ATGTGTGGAGGGCAGGCGGCAGG - Exonic
902786040 1:18733383-18733405 CTGCCTGGGAGGCAGGAGGCTGG - Intronic
902818315 1:18928519-18928541 CTGTGTGGGTGGCAGTGTTCTGG - Intronic
903163735 1:21507103-21507125 GTTTGAGGGTGGAAGGTGGCAGG + Intergenic
903572754 1:24318580-24318602 GTGTGTTGGTGGCAGGGGGTGGG - Intergenic
903609087 1:24596983-24597005 CTGTGGTTCTGGCAGGTGGCTGG + Intronic
904043448 1:27597143-27597165 GGGGGTGGGGGGCAGGTGGCAGG + Intronic
904115734 1:28160556-28160578 GTGTGTGTGTGGGGGGTGGCGGG - Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905206251 1:36344342-36344364 AAGTGAGGGTGGCAGGTGGAGGG - Intronic
905222090 1:36455158-36455180 CTGTGTGGATGGTAGATGGGAGG - Intergenic
905473501 1:38209829-38209851 CTGGCGGGGTGGGAGGTGGCGGG + Intergenic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
905973491 1:42157918-42157940 CCGTGTGGCTGGCACATGGCAGG - Intergenic
906429150 1:45740506-45740528 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
908444238 1:64186888-64186910 GTGGGTGAGTGGCAGGTAGCTGG - Intergenic
908470983 1:64443726-64443748 GTGTGTGTGTGTCGGGTGGCGGG - Intergenic
908508289 1:64827980-64828002 CTGTGATGGTAGCAGCTGGCAGG - Intronic
909001469 1:70221941-70221963 CTGCTTGAGTGGCTGGTGGCTGG + Intronic
909039004 1:70628314-70628336 CTGATGGGGTGGCAGGTAGCTGG - Intergenic
909466352 1:75978288-75978310 CTGTCTGGTTGCCATGTGGCAGG - Intergenic
909657566 1:78047570-78047592 CTCTAGGGGAGGCAGGTGGCAGG + Intronic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
911308763 1:96266482-96266504 ATGGGAGGGTGGCAGGTGGAAGG + Intergenic
911746272 1:101445137-101445159 TTGTGTGGGTGGGAGGTAGGGGG - Intergenic
913114360 1:115682928-115682950 TTGAGTGGGTGGCAGGAGGCTGG + Intronic
913486663 1:119337826-119337848 CTGTGTTGGTTGAAGGTGGGTGG + Intergenic
914775190 1:150728987-150729009 CTGTCCGGGAGGCAGGTGGGGGG - Intergenic
914826653 1:151142423-151142445 CTGTGTGGGAGGCAAGGTGCAGG - Intronic
915020525 1:152775036-152775058 CTATGTGGGTGTCGGGAGGCAGG + Intronic
915307556 1:154989367-154989389 GTGGCTGGGTGGCAGATGGCAGG + Intronic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915528050 1:156488162-156488184 CCTTGTGGGTGGCAGGGGGTTGG + Intronic
915656768 1:157367093-157367115 ATGTGAGAGAGGCAGGTGGCAGG - Intergenic
916133635 1:161632427-161632449 CTCTGTGTGTGGCAGGGGGAGGG - Intronic
916854702 1:168737570-168737592 CTGTGTGGGTGGTGTGTGACAGG - Intergenic
917375733 1:174349462-174349484 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
918180438 1:182082288-182082310 CTGTCTGGGTGGTGGGTGGGAGG - Intergenic
918513059 1:185332531-185332553 CTATTTGGGGGGCAGGGGGCTGG + Intergenic
919604652 1:199667061-199667083 GTGGGTGAGTGGCAGGTAGCTGG + Intergenic
920037329 1:203074847-203074869 GGGTGAGGGGGGCAGGTGGCAGG + Intronic
920069237 1:203290546-203290568 GGCGGTGGGTGGCAGGTGGCGGG - Intergenic
920232627 1:204480679-204480701 CTGTGTGGGTGGTGGGCTGCCGG + Intronic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
921053017 1:211524595-211524617 CTGTGCCGGTGGCAGGCAGCTGG + Intergenic
922099178 1:222468248-222468270 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
922130470 1:222772239-222772261 TTGTGTGGGGGGCGGGGGGCGGG + Intergenic
922261215 1:223947742-223947764 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
922337405 1:224628940-224628962 AAGTGGGGGTGGCAGGTGGTTGG - Intronic
922407855 1:225336855-225336877 ATGTGTGGTTGGCAGTTGGTAGG + Intronic
922668123 1:227490140-227490162 CTGCATGGGAGGCAGGTGGTGGG - Intergenic
922729133 1:227940929-227940951 CGGGCAGGGTGGCAGGTGGCTGG - Intronic
922792168 1:228316603-228316625 CTGCGTGGGTGGGAGGGGTCTGG - Intronic
922792850 1:228319704-228319726 ATGGGTGGATGGCAGGTGGATGG - Intronic
923014129 1:230112780-230112802 CAGTGTGTGTGGCAGGGGGGTGG + Intronic
923042184 1:230327333-230327355 TTGTGGGGGTGGGAGGGGGCTGG - Intronic
923378279 1:233388610-233388632 TTGGGTGGGTGGGAGGTGTCAGG + Intergenic
923523583 1:234755614-234755636 CTGAGTGGGTGCCACGTGACCGG - Intergenic
924172667 1:241357516-241357538 GTGGGTGGGTGGTAGGTGGGTGG + Intergenic
924342382 1:243049922-243049944 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
924378087 1:243434276-243434298 CTGAGGTGGTGGCAGGAGGCAGG - Intronic
924565882 1:245198055-245198077 ATGTGTGGGTGGTAGGAGGAAGG - Intronic
1063352280 10:5366625-5366647 GTGTGTGAGTGGCTGGGGGCTGG - Intronic
1064109064 10:12522922-12522944 CCGTCTGGGAGGCAGGTGGGGGG - Intronic
1064273330 10:13884745-13884767 TTGTGAAGATGGCAGGTGGCAGG - Intronic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1064680153 10:17803195-17803217 CTGAGTGGGTAGGAGGTGGCTGG + Intergenic
1065888949 10:30104177-30104199 CTGAGAGGGTTGCAGGTGGGAGG + Intronic
1066064099 10:31750030-31750052 CTGTGTGTGTGCCAGGCGCCAGG - Intergenic
1066255169 10:33671526-33671548 CTGTGTGTCAGGCAGGTGACAGG - Intergenic
1066734094 10:38455633-38455655 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1067030411 10:42875744-42875766 CTCTGGGTGTGGCAGGAGGCTGG + Intergenic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1067927529 10:50525386-50525408 CTGTCTGGGTGGCATTTGGAAGG - Intronic
1067963261 10:50880384-50880406 CTATGTGCCTGGCATGTGGCAGG + Intronic
1068005921 10:51392815-51392837 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1069334038 10:67327747-67327769 CATAGTGGGTGGCAGGTGCCAGG + Intronic
1069693365 10:70369203-70369225 GTGTGTGGGTGGGAGAAGGCGGG + Intronic
1069735590 10:70652033-70652055 GTGACTGGGTGGCAGGTAGCTGG - Intergenic
1069959732 10:72072695-72072717 GTGTGGGGGAGGCAGCTGGCAGG - Intronic
1070312472 10:75283648-75283670 CGGAGAGGGTGGCAGGAGGCTGG - Intergenic
1070540048 10:77409315-77409337 CTGTGTGTGTGGTAGTTGGGTGG - Intronic
1072075373 10:91967074-91967096 CTGTGTGGCTGACAGTTGGGTGG + Intronic
1072248747 10:93565582-93565604 AGGTGTGGGTGGCAGGAGGGTGG + Intergenic
1072554060 10:96501330-96501352 CTCTGTGGGTGGGAGGGGTCCGG - Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1072664998 10:97386096-97386118 CTGTGTGGGGGGCATGTGTGAGG - Intronic
1073421050 10:103423916-103423938 CTGTGTGGGTAGGGAGTGGCTGG + Intronic
1073458322 10:103651073-103651095 GAGAGAGGGTGGCAGGTGGCAGG + Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1073585851 10:104709159-104709181 CTGTGTGTTTGGGAGGAGGCGGG + Intronic
1074056258 10:109924778-109924800 TTGTGTGCGTGGGTGGTGGCAGG - Intergenic
1075096963 10:119478354-119478376 CTGTGTGTGTGGCAGGGGCGTGG + Intergenic
1075676555 10:124299948-124299970 CTTGGTGGGTGGCAGGAGGCTGG - Intergenic
1075687236 10:124372757-124372779 CTGTGTGGATGCCAGGTTGGGGG + Intergenic
1075730079 10:124630835-124630857 CAGTCTGGCTGGCATGTGGCAGG - Intronic
1075745260 10:124723149-124723171 CTGTAGGGGTGGCAGCTTGCTGG - Intronic
1075762437 10:124866832-124866854 CTGTGTGGCTGGCACATGGGAGG - Intergenic
1075838644 10:125477877-125477899 GTGAGTGGGTGGGAGGAGGCTGG - Intergenic
1076695686 10:132246277-132246299 CAGTGGGGGTGGCTGGTGCCTGG - Intronic
1076699170 10:132261205-132261227 CTGTGGAGTTGCCAGGTGGCTGG + Intronic
1076705282 10:132298054-132298076 GTGTGATGCTGGCAGGTGGCAGG + Intronic
1076843934 10:133059915-133059937 CTGTGTGTGTGGCCGGGGCCGGG + Intergenic
1076856925 10:133121346-133121368 CTGTGTGTGTGGAATGTGCCAGG + Intronic
1076931314 10:133533674-133533696 CTGTGGAGCTGGGAGGTGGCTGG + Intronic
1076969113 11:123456-123478 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077085590 11:748258-748280 CTCCGTGGGCGGCAGGTGCCCGG + Intronic
1077213516 11:1384345-1384367 GTGGGTGGGTGGCAGGGGGAGGG - Intergenic
1077281523 11:1748245-1748267 GGGTGGGGGAGGCAGGTGGCAGG - Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077373584 11:2194998-2195020 CTTGGTGGGTGGCAGGTGGCAGG + Intergenic
1077408721 11:2393770-2393792 TGGTGGGTGTGGCAGGTGGCGGG + Intronic
1077504755 11:2924793-2924815 CTGGGCGGGTGGCAGGGGGTGGG + Intronic
1077506895 11:2933754-2933776 GTATGTGGTTGGCAGGAGGCAGG - Intergenic
1077539932 11:3141784-3141806 CTGGGTGGGAGGCGGGTGGGGGG - Intronic
1078341239 11:10499105-10499127 CTGTCTGTGAGGCAGCTGGCGGG + Intronic
1079073530 11:17368464-17368486 GTGTGTGGGTGGCATGTGCAGGG + Intronic
1080451847 11:32384488-32384510 GTGTGTGGGTGGGTGGTGGTCGG - Intergenic
1080464358 11:32482893-32482915 GTGTGTGTGTCGCAGGGGGCAGG + Intergenic
1080563595 11:33487341-33487363 CTAGGTGGGGGGCAGGTTGCTGG + Intergenic
1083148216 11:60773999-60774021 CTGTGTGGAAGGCAGTTGGCTGG + Intronic
1083154631 11:60815362-60815384 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1083271628 11:61575824-61575846 GTGTGCGGGTGGCAGCTGGATGG - Intronic
1083891044 11:65595859-65595881 CTGTGTGGGTGGCTGGGACCCGG + Exonic
1083919669 11:65775538-65775560 CTTTGTGGGTGTCAGGAGGCAGG + Intergenic
1084357724 11:68651042-68651064 GGTGGTGGGTGGCAGGTGGCCGG + Intergenic
1084575652 11:69986360-69986382 CTGTGTCGGTCACAGGTCGCTGG + Intergenic
1084594405 11:70108471-70108493 CTCTGTGGGAGGCAGGCAGCCGG + Intronic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1084973403 11:72783412-72783434 ATGAGTAGGTGGCAGGGGGCTGG + Intronic
1085255826 11:75172410-75172432 ATGGGTGGGTGCCTGGTGGCTGG + Exonic
1085397235 11:76212811-76212833 CTGAGTAGCTGGCAGGTGGCAGG - Intergenic
1085532311 11:77199178-77199200 CTGTGTGCCTGGCATGTGTCTGG - Intronic
1086430589 11:86732506-86732528 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1087215036 11:95484426-95484448 TTGGTTGGGTGGCAGGGGGCAGG - Intergenic
1088303511 11:108384277-108384299 CTGAGTGGGTGGCAGTGAGCTGG + Intronic
1088777627 11:113100731-113100753 GGGGGTGGGTGGCACGTGGCAGG + Intronic
1089015891 11:115165002-115165024 TGGTGTGTGTGGGAGGTGGCAGG - Intergenic
1089123729 11:116161529-116161551 CTGTGTGGCAGGCATGTGCCTGG + Intergenic
1089190829 11:116651969-116651991 ATGTCAGGGAGGCAGGTGGCTGG + Intergenic
1089565935 11:119371805-119371827 ATGTGTGGGTGGTGGGTGGGTGG - Intronic
1089565957 11:119371868-119371890 CATTGTGGGAGGCACGTGGCAGG + Intronic
1089625821 11:119750168-119750190 GTGGGGTGGTGGCAGGTGGCAGG + Intergenic
1090247092 11:125224263-125224285 CTCTGTGGCTGGCAGGTGCCAGG + Intronic
1090266896 11:125359019-125359041 CTGGGTGGGAGGCAGGTTGCAGG + Intronic
1090942612 11:131400968-131400990 GTGTGTGTGTGGCAGGTGGCAGG - Intronic
1090989312 11:131801888-131801910 CTGTGTGGGTGGCACAGGGCTGG - Intronic
1091321657 11:134656506-134656528 CTGTGAGTGTGGGAGGTGCCCGG + Intergenic
1091321677 11:134656590-134656612 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321683 11:134656618-134656640 CTGTGAGTGTGGGAGGTGCCCGG + Intergenic
1091321691 11:134656646-134656668 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321705 11:134656702-134656724 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321713 11:134656730-134656752 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321721 11:134656758-134656780 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321737 11:134656814-134656836 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321745 11:134656842-134656864 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321761 11:134656898-134656920 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321773 11:134656954-134656976 CTGTGAGTGTGGGAGGTGCCCGG + Intergenic
1091321785 11:134657010-134657032 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321793 11:134657038-134657060 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091395612 12:152692-152714 CTGTGTGTGTGTGGGGTGGCAGG - Intronic
1091820222 12:3470577-3470599 CTGGGTGGGGGGCATGGGGCAGG + Intronic
1091949407 12:4580537-4580559 CTGGGAGGGAGGGAGGTGGCTGG - Intronic
1091991665 12:4960688-4960710 TTGGGTGGGTGGCAGGAGGCCGG + Intergenic
1092001824 12:5039031-5039053 CTGTGCTGGGGACAGGTGGCTGG - Intergenic
1092159657 12:6309364-6309386 CCCTGTAGTTGGCAGGTGGCAGG - Intergenic
1092231613 12:6778728-6778750 CACTGTGGGTGGAAGGTGGGTGG - Intergenic
1092843869 12:12566267-12566289 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1093506033 12:19867345-19867367 CTATGTGGGTGGCAGCTTCCAGG + Intergenic
1094057225 12:26279786-26279808 CTTTGTGAGAGGCAGGTGGTAGG - Intronic
1094251041 12:28361865-28361887 CTGTGTGTGTGGGAGGGGGGCGG + Intronic
1094294575 12:28889875-28889897 GTGTTTGTGTGGCAGGGGGCAGG - Intergenic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1094447753 12:30550180-30550202 CTGTCTCAGTGGCAGGAGGCAGG - Intergenic
1095750267 12:45702675-45702697 CTTAGAGGGTGGCAGGTGGGAGG + Intergenic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096514450 12:52148358-52148380 CTGTGTGTGTGGGATGGGGCAGG + Intergenic
1096801437 12:54113077-54113099 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1097178331 12:57156460-57156482 CTGAGTGGGTGGATGGGGGCTGG - Intronic
1098461313 12:70735833-70735855 CACAGTGGTTGGCAGGTGGCAGG + Intronic
1099218693 12:79885493-79885515 CACTTTTGGTGGCAGGTGGCAGG + Intronic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1101092642 12:101303554-101303576 CTGTGGGGGTGGTGGGTGCCTGG + Intronic
1101159287 12:101956909-101956931 CTCTGTGAGTGCCATGTGGCAGG + Intronic
1101496981 12:105263888-105263910 CTGTGATGGTGACAAGTGGCGGG - Intronic
1101848963 12:108387224-108387246 CTGTGTGGGAGGCAGGGGTGGGG - Intergenic
1102186303 12:110950951-110950973 CCGTCTGGGAGGCAGGTGGGGGG - Intergenic
1102217184 12:111169850-111169872 CTGCTGGGGTGGCTGGTGGCAGG + Intronic
1102277867 12:111597847-111597869 CGGTGCTGGTGGCAGGGGGCGGG - Intronic
1102541303 12:113621243-113621265 AGGTGAGGGTGACAGGTGGCTGG + Intergenic
1102585692 12:113921385-113921407 GGGTGTGGGTGGAAGGTGGGGGG - Intronic
1102756123 12:115342472-115342494 CGGGGTGGGGGGCAGGTGGGGGG - Intergenic
1103740590 12:123088534-123088556 GTGTGGGGGTGGCAGGAGGGTGG + Intronic
1103743579 12:123107455-123107477 AGGTGGGGGTGGCAGGTGGTGGG - Intronic
1103962990 12:124621181-124621203 CTGTCTGGGTGGAGGCTGGCTGG + Intergenic
1104065273 12:125300366-125300388 CTGTCAGGGTGTCAGGTGGTCGG - Intronic
1104097959 12:125576882-125576904 GTGTGTGTGTGGCAGGGGGGTGG + Intronic
1104449048 12:128854280-128854302 CTGTGCGGGTGGGAGGCGGCGGG - Intronic
1104503647 12:129310213-129310235 GAGGGTGGGTGGGAGGTGGCAGG + Intronic
1104913024 12:132249042-132249064 CTGGGTGTCTGGAAGGTGGCGGG + Intronic
1104947010 12:132419804-132419826 GTGTGTGGGCGGCAGAGGGCTGG - Intergenic
1104963308 12:132498240-132498262 CTGTGTCGGGGGCATGGGGCCGG + Intronic
1105367931 13:19779715-19779737 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1105725027 13:23154959-23154981 GTGGCTGGGTAGCAGGTGGCTGG + Intergenic
1105812126 13:24004828-24004850 ATGTGGGGGTCTCAGGTGGCTGG - Intronic
1106998660 13:35518826-35518848 CGGTGTGGGGGGAAGGTTGCAGG + Intronic
1108003544 13:45925839-45925861 CTGTGTGTGTGGTAAGGGGCTGG + Intergenic
1108164208 13:47675278-47675300 CTGTGTGGGAGACAGGTGAATGG - Intergenic
1108642527 13:52395934-52395956 GTGGGTGGCTGGCAGATGGCTGG + Intronic
1108788048 13:53930912-53930934 GGGGGTGGGTGGCAGGTGGGTGG - Intergenic
1108795721 13:54027568-54027590 ATTTGAGGGTGGCAGGTGGGAGG + Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109308047 13:60662162-60662184 GGGTGGGGGTGGCAGGGGGCGGG - Intergenic
1110136528 13:72074085-72074107 CTGTCTAGTTGGCAGGTAGCAGG + Intergenic
1110383027 13:74876253-74876275 GTGTGTGGGTGGTGGGTGGGGGG - Intergenic
1111227568 13:85294460-85294482 GTGTGTGAGTGGCAGGTAGCTGG + Intergenic
1112447373 13:99476574-99476596 GTGTGTGGGGGGGGGGTGGCGGG - Intergenic
1112579838 13:100669203-100669225 CTGTGTGTGTGGCAGGGGAGAGG + Intronic
1112855463 13:103764450-103764472 CTGTGTGTGTGGCTGGGGGGTGG - Intergenic
1113427570 13:110222101-110222123 CTGTGTGGGTCGCAGGTGCCTGG - Intronic
1113473679 13:110564486-110564508 GTGTGTGTGTGGCGGGGGGCAGG - Intergenic
1113902439 13:113804500-113804522 CAGTGTGACTAGCAGGTGGCGGG + Intronic
1114231360 14:20785863-20785885 CTGTGGCTGAGGCAGGTGGCTGG + Intergenic
1117016124 14:51519167-51519189 CCGTTGGGGTGGCAGGGGGCGGG - Intronic
1117803976 14:59470936-59470958 GTGTGGGGGTGGCTGGGGGCGGG + Intronic
1117881178 14:60315051-60315073 CTGTGAGTGTGGCAGGTGCTCGG + Intergenic
1117895813 14:60485702-60485724 CTGTGAGGGTGGGAGTCGGCCGG - Intronic
1117895862 14:60485857-60485879 GTGCGTGGGTGGGAGGGGGCTGG - Intronic
1118751559 14:68811386-68811408 CTGTGTGGGTGGGAGGACGCAGG + Intergenic
1119140758 14:72265364-72265386 CTGTGTCTGAGCCAGGTGGCAGG - Intronic
1119263145 14:73250093-73250115 CTGTGTGGATGGCAGCTGCCGGG + Exonic
1119554891 14:75545755-75545777 GTGTGTGGGTGGGAGGTGGCGGG - Intronic
1119616071 14:76099921-76099943 CTGTGTGGGTGGCACCAGCCTGG + Intergenic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1120927682 14:89814275-89814297 GTGTGTTGCTGGCAGGCGGCAGG - Intronic
1121013827 14:90536419-90536441 CTGAGGGGGAGGCAGCTGGCTGG - Exonic
1121615820 14:95312747-95312769 AAGTGTGGGAGGCACGTGGCAGG + Intronic
1122273535 14:100579430-100579452 CTGTGTGGGGTGCAGTGGGCAGG - Intronic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122738045 14:103855157-103855179 CACTGTGGGTGCCAGGTTGCAGG - Intergenic
1202897760 14_GL000194v1_random:19992-20014 CTGTGTGGGTGCCAGGTCCAAGG + Intergenic
1124139973 15:27068448-27068470 CTGTATGGGTGGCAGCGGTCTGG + Intronic
1124259680 15:28177502-28177524 CTGTGAATGTTGCAGGTGGCCGG - Exonic
1124496331 15:30189690-30189712 CTGTGTAGCAAGCAGGTGGCAGG - Intergenic
1124673205 15:31659664-31659686 CTGCCTGGGAGGCAGGTGGTTGG + Intronic
1124747243 15:32348955-32348977 CTGTGTAGCAAGCAGGTGGCAGG + Intergenic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1128291998 15:66485116-66485138 ATGTTTGGGTGCCAGGTGGAAGG + Exonic
1128489615 15:68134369-68134391 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1128496073 15:68199439-68199461 CAGTTTGAGGGGCAGGTGGCAGG - Intronic
1128788103 15:70413131-70413153 CTGTGTCCCTGGCAGTTGGCTGG - Intergenic
1128878638 15:71223077-71223099 CAGTGTGTCTGGCAGGTGGAAGG - Intronic
1128940344 15:71782940-71782962 CCGTGGGTGAGGCAGGTGGCTGG + Exonic
1129150654 15:73685485-73685507 GTGTGTGTGTGGCGGGTGGGGGG + Intronic
1129878608 15:78993001-78993023 CTGTGTGTGTGCCATGTGGGTGG + Intronic
1130652069 15:85767888-85767910 CTGGGTGGGCAGCAGGTGGCTGG - Intronic
1131359388 15:91776471-91776493 CTGGGTGGGTGGTTGGAGGCAGG + Intergenic
1131699335 15:94917222-94917244 CTGTATGTGTGGCCGGTGGCTGG + Intergenic
1132508108 16:322653-322675 CTCTGTGGGACTCAGGTGGCTGG - Intronic
1132573767 16:655638-655660 CCGTGTGGGGAGCAGGCGGCGGG - Exonic
1132585489 16:704376-704398 CAGTTGGGGTGGCAGGGGGCAGG + Intronic
1132885768 16:2181310-2181332 CGGGGTGGGTGGCAGGTGGCTGG + Exonic
1132885834 16:2181600-2181622 CTGAGTGGGGCGCAGGGGGCAGG + Intronic
1132885883 16:2181717-2181739 CTGGGCTGGTGGCTGGTGGCTGG + Intronic
1132953536 16:2578469-2578491 GTGGCTGGGAGGCAGGTGGCAGG + Intronic
1132960816 16:2621698-2621720 GTGGCTGGGAGGCAGGTGGCAGG - Intergenic
1133238720 16:4402532-4402554 CTGGGCGGGTGGCCGGTCGCTGG - Intronic
1133276325 16:4640454-4640476 CTGGGTGGCTTGCAGGTGTCCGG - Intronic
1133467003 16:6036990-6037012 CTGTGTGTGTTGGAGGTGGGGGG + Intronic
1134189712 16:12111700-12111722 TGGTGTGGGTAGCAGGTGGCAGG + Intronic
1134197502 16:12170275-12170297 GTGTGTGGGTGACAGGGAGCGGG + Intronic
1135131934 16:19860284-19860306 CTGTGTGTGTGGCAGGGGAGGGG + Exonic
1135189564 16:20343933-20343955 CCCTGTGGGTGGCAGTTGACAGG + Intronic
1135348104 16:21706408-21706430 CTCTGAGGGTGGCACCTGGCAGG - Intronic
1136124278 16:28166186-28166208 CTGTAGGGGTGGCAGGAGGTGGG - Intronic
1136518777 16:30783472-30783494 CTGTGTGGGTGGCCTGGTGCTGG + Exonic
1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG + Intronic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138467279 16:57201161-57201183 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138467298 16:57201241-57201263 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138614663 16:58155793-58155815 GTGTGTGTGTGGCTGGGGGCTGG + Intergenic
1139349774 16:66327763-66327785 CTGGGTGGGTGGCAGGGGTGAGG - Intergenic
1139423836 16:66866554-66866576 CTCTGGGGGTGGAAGGTGGGGGG + Intronic
1139936085 16:70572186-70572208 CTCTGTGGGAGGAAGGAGGCAGG + Exonic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140313658 16:73872853-73872875 GCGGGTGGGTGGCAGGTGGTGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140825421 16:78701601-78701623 GTGTGGGGGAGGCAGGTGGGTGG - Intronic
1141594294 16:85088032-85088054 CTGTGGGGCAAGCAGGTGGCTGG - Intronic
1141616923 16:85214962-85214984 CTCTGCGGGTGGCGGGTGGGTGG + Intergenic
1141936858 16:87245806-87245828 CTTTGTGGGTCGCAGGTTTCCGG - Intronic
1142012481 16:87722904-87722926 GAGGGTGGGTGGCGGGTGGCAGG + Intronic
1142034063 16:87853003-87853025 CTGTGTGGGTGGCCCGTGCTGGG - Intronic
1142266268 16:89065311-89065333 CTGGGTGGGTGGCAGCAGGCAGG - Intergenic
1142307711 16:89294859-89294881 CTGTGTGGAGGGCAGGGAGCAGG - Intronic
1142409863 16:89910493-89910515 CTGCGAGGGAGGCAGCTGGCAGG + Intronic
1142451562 16:90175666-90175688 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1142502274 17:339777-339799 CTGGGTGTGTGGCAGGTGCTCGG - Intronic
1142598197 17:1039774-1039796 CTGTGAGGGTGGCAAGCAGCAGG + Intronic
1142804592 17:2364800-2364822 CTGGGTAGGAGGCAGATGGCTGG - Intronic
1142878117 17:2864592-2864614 CGGTGTGGGGAGCAGGAGGCTGG + Intronic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143121082 17:4607305-4607327 CTGTGGGGCTGGCTGATGGCTGG + Intronic
1144946255 17:18971094-18971116 GTCTGTACGTGGCAGGTGGCAGG - Exonic
1145092401 17:19996773-19996795 GTGTGTGAGTGGCAGGATGCAGG - Intergenic
1145684356 17:26638649-26638671 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145684546 17:26639080-26639102 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145864208 17:28229525-28229547 CTGTGTGGGTGGGGAGTGGGAGG + Intergenic
1146208147 17:30922234-30922256 CGGTGTGGGTGGGAGGGGTCGGG - Intronic
1146968599 17:37054166-37054188 CAGTGGGGGTGGCTGGTGGGGGG + Intronic
1147178979 17:38673417-38673439 CTGTGGAGGTGGCAGATGGGGGG - Exonic
1147267383 17:39243095-39243117 GTATGTGGCTGACAGGTGGCAGG + Intergenic
1147326393 17:39671719-39671741 CTGTGAGGTTTGCAGGAGGCGGG + Exonic
1148201799 17:45754135-45754157 GTGTGGGGGTGGTAGGAGGCTGG - Intergenic
1148345973 17:46903965-46903987 GTGTGTGGGTGGATGGTGGCTGG + Intergenic
1148487450 17:47999916-47999938 CTCAGTGGGTGGCAGGAGGATGG + Intergenic
1148670894 17:49409265-49409287 CTGGGAGGGTGCCAGGTGGCAGG - Intronic
1149324832 17:55519359-55519381 GTGTGTGGGTGGAATGTGGCGGG + Intergenic
1149550350 17:57535058-57535080 CTCTGTTGTTGGCAGGAGGCCGG + Intronic
1150281096 17:63930055-63930077 ATGGGTGTGTGCCAGGTGGCTGG - Exonic
1150435094 17:65147483-65147505 CTGCCTGAGTGACAGGTGGCAGG + Intronic
1151218073 17:72591585-72591607 CTGAATAGGTGGGAGGTGGCAGG - Intergenic
1151374790 17:73680126-73680148 CTGTGTTTATGGCAGGTGGGAGG + Intergenic
1151694265 17:75706110-75706132 CCATGTGTGTGGCAGGAGGCAGG - Intronic
1152201883 17:78952195-78952217 CTGTGTGGGGTGCTGGGGGCGGG - Intergenic
1152500629 17:80706403-80706425 CTGGCTGGGTGGCAGGATGCTGG - Intronic
1152515428 17:80820812-80820834 CTGTGTGGGTGGTGGAGGGCAGG - Intronic
1152640567 17:81447614-81447636 CTGGGTGGGTGGCTGTTGTCGGG - Exonic
1152721485 17:81926018-81926040 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1153304409 18:3619066-3619088 CTCTGTGGCTTGCGGGTGGCTGG - Intronic
1153538543 18:6130249-6130271 GTGTGTGTGTGGCGGGTGGGGGG - Intronic
1155185437 18:23383205-23383227 CTCTGTGAGCAGCAGGTGGCTGG + Intronic
1155347831 18:24876157-24876179 CTGAATGGGTGGCAGGAGTCAGG - Intergenic
1155762775 18:29588371-29588393 CTGTGTGGCTCTCAGGTGGCAGG - Intergenic
1155929313 18:31689320-31689342 CTATGGGGGTGGAAGGTGGGAGG + Intergenic
1156487773 18:37477476-37477498 CTGGGTGGTTTGCAGGTGGTGGG + Intronic
1157407832 18:47438391-47438413 CTGTGTGGGTGAGTGGTGGAAGG - Intergenic
1157632901 18:49117716-49117738 CAGTGGGTGTGGCAGGTAGCAGG - Intronic
1158196007 18:54885798-54885820 CTGTATGGGAAGCATGTGGCTGG + Intronic
1158408234 18:57179400-57179422 GTGTGTAGGTGGGAGGTGGCAGG + Intergenic
1159114995 18:64104169-64104191 CACTGTGAGCGGCAGGTGGCGGG + Intergenic
1159613068 18:70547639-70547661 CTGTGGTGGTGGCTGGTAGCAGG + Intergenic
1159948916 18:74464969-74464991 GTGTGTGTGTGGCAAGTGGGGGG + Intergenic
1160246878 18:77166246-77166268 CTCTGTGGGAGGAAGGTGGGAGG - Intergenic
1160645919 19:193382-193404 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1160687014 19:441648-441670 ATGTGTGGGTGCCAGGAGCCGGG + Intronic
1160952490 19:1674397-1674419 CTGTGTGGGTGGCCAGGGCCAGG - Intergenic
1161090544 19:2357883-2357905 GTGGGTGGGTGGAAGGTGGGTGG - Intergenic
1161770067 19:6226206-6226228 ATGTGTGGGTGGCAGGCACCGGG + Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161859680 19:6788693-6788715 TTGTGGAGGTGGGAGGTGGCTGG + Intronic
1163266983 19:16227463-16227485 CGGGGTGGGTTGCAGGTGGTAGG + Intronic
1163365240 19:16872392-16872414 GTCCATGGGTGGCAGGTGGCTGG - Intronic
1163945290 19:20529994-20530016 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1164105827 19:22107278-22107300 CTGTCCGGGTGGGAGGTGGGGGG - Intergenic
1164298408 19:23937143-23937165 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1164620857 19:29695295-29695317 ATGTCTGGGTGTCAGGTGTCTGG - Intergenic
1164620864 19:29695326-29695348 GTGTCTGGGTGTCAGGTGTCCGG - Intergenic
1164620887 19:29695449-29695471 GTGTCTGGGTGTCAGGTGTCTGG - Intergenic
1164620931 19:29695665-29695687 GTGTCTGGGTGTCAGGTGTCCGG - Intergenic
1164620943 19:29695727-29695749 GTGTCTGGGTGCCAGGTGTCTGG - Intergenic
1164620949 19:29695750-29695772 CTGTCTGGGTGCCAGGTGTCTGG - Intergenic
1164620993 19:29695983-29696005 GTGTCTGGGTGTCAGGTGTCAGG - Intergenic
1164621006 19:29696052-29696074 GTGTCTGGGTGTCAGGTGTCGGG - Intergenic
1164621078 19:29696453-29696475 GTGTCTGGGTGTCAGGTGTCAGG - Intergenic
1164621081 19:29696468-29696490 GTGTCTGGGTGTCAGGTGTCTGG - Intergenic
1164621102 19:29696576-29696598 GTGTCTGGATGTCAGGTGGCTGG - Intergenic
1164621111 19:29696622-29696644 GTGTCTGGGTGTCAGGTGTCTGG - Intergenic
1164621121 19:29696660-29696682 GTGTCTGGGTGTCAGGTGTCTGG - Intergenic
1165093315 19:33397590-33397612 CAGTGTGGGTGGTAGGTGTGGGG + Intronic
1165159294 19:33806427-33806449 CTGGGTGTGTGGCTGTTGGCCGG + Intronic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1165788274 19:38475354-38475376 GCGTGGGGGTGGCCGGTGGCTGG - Exonic
1166053901 19:40277454-40277476 CTGTGTGGGAGAGAGCTGGCTGG - Intronic
1166180159 19:41103090-41103112 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1166197724 19:41218020-41218042 CTGTGTGTTTGGCACGTGGAGGG - Intergenic
1166284299 19:41814302-41814324 CTCTGTGGGTGGGAAGTGGTGGG - Intergenic
1166294144 19:41880795-41880817 CTCTGGGGGTGGCTGGGGGCAGG + Intronic
1166367984 19:42286877-42286899 CTGGGTGGCTGGCAGGTTGCTGG - Exonic
1167158177 19:47751708-47751730 CTGTGCTGGAGCCAGGTGGCTGG + Intronic
1167308309 19:48721322-48721344 GTGGGTGGGTGGCTGGTGGAGGG + Intronic
1167445517 19:49534958-49534980 CTGTGTGTGTGGCAGGGTGTGGG - Intronic
1167619893 19:50554941-50554963 GTGTGTGGGGGGCAGGGTGCAGG + Intronic
1167670731 19:50851835-50851857 CTCTACGGTTGGCAGGTGGCTGG - Intergenic
1167706240 19:51082801-51082823 CTCTGCGGGCGGCAGGTGGGAGG + Exonic
1168114056 19:54211123-54211145 GTGTGTGTGTGGCAGGGGGTGGG + Intronic
1168293893 19:55369696-55369718 CTGATTGGCTGGCGGGTGGCCGG - Intronic
1168398016 19:56065432-56065454 CTGTGTGTGTGTGTGGTGGCGGG + Intergenic
1168400203 19:56081171-56081193 CTGTGTGGGAGGCGGGTCCCAGG + Intergenic
925156908 2:1655758-1655780 CTGTGTAGGTGGCATGTGTCAGG - Intronic
925201194 2:1968847-1968869 ATATGTGGATGGCAGGTGGGCGG + Intronic
926162170 2:10496694-10496716 GTGGGTGGGTGGCAGGTGGCAGG - Intergenic
926162374 2:10498044-10498066 CTGGGTGGGTGACAGGCAGCCGG + Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926740059 2:16103195-16103217 CAGTCTGGGTGCCAGGGGGCCGG - Intergenic
927152491 2:20203976-20203998 CTGTGGGGGTGGGAGGTGGCGGG + Exonic
927228509 2:20795934-20795956 GTGTGTGTGTGGCAGGTTTCGGG - Intronic
927514329 2:23663063-23663085 CCGAGAGGGTGGCAGGTGGGAGG + Intronic
927930093 2:27038367-27038389 CTCTGTGGGTGGTAGGTGGAGGG + Intronic
928178171 2:29049242-29049264 CTGTGGGGGTCCCAGGTGGGTGG - Intronic
928243390 2:29606016-29606038 CAGTGGGGGTGGGAGGTGGAAGG - Intronic
928688383 2:33773684-33773706 GTGTGTGGGTGGCGGGGGGTGGG + Intergenic
929428539 2:41868411-41868433 GTGAGTGGGTGGGAGGTAGCTGG + Intergenic
929861850 2:45684865-45684887 CTGTGTGGCTGGCAGGGGGCTGG + Intronic
929886979 2:45887705-45887727 CTTTGTGGGTTCCAGGAGGCAGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934663155 2:96153807-96153829 GTGTGTGTGTGGCAGGTGTGTGG - Intergenic
934856296 2:97732492-97732514 CTCTGTGGATGGCAAGTGTCTGG + Intronic
935237285 2:101150001-101150023 GTGAGTGGGTGGGAGTTGGCAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936343075 2:111654840-111654862 CAGTGTGGGAGGAAGGTGTCAGG - Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936896192 2:117430522-117430544 CTGTGTCGTTGACAGGTGGCAGG - Intergenic
937231047 2:120398429-120398451 CTATGTGGGAGGCAGGAGGCAGG + Intergenic
937861507 2:126714969-126714991 CAGTGTGGATGGCAAGTGGGAGG - Intergenic
938828795 2:135033248-135033270 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
939882893 2:147650199-147650221 CTGGGTGTGTGTCATGTGGCAGG - Intergenic
939933488 2:148259577-148259599 GTGGGTGAGTGGCAGGTAGCAGG + Intronic
940003859 2:148993902-148993924 GTGTGTGTGTGGCATGTGGTGGG + Intronic
940354640 2:152726292-152726314 CAGTCTGGGTTGCAGGTGGTCGG + Intronic
940652394 2:156451749-156451771 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
941047328 2:160691194-160691216 CAGTGGGGGTGGGAGGTGGAGGG + Intergenic
941423367 2:165312144-165312166 CTGGATGAGTGGGAGGTGGCAGG - Intronic
942512996 2:176722687-176722709 CAGTGGGGATGGCAGGTGGGAGG + Intergenic
943005842 2:182386784-182386806 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
943482856 2:188443186-188443208 CTGTGGGGGTGGGGGTTGGCGGG + Intronic
943714297 2:191133458-191133480 GTGTGTGGGTGGGTGGGGGCAGG + Intronic
945746314 2:213723239-213723261 CTGTGTGGATGGCATGTGGCTGG + Intronic
946037364 2:216754785-216754807 ATGTGTAGGAGGGAGGTGGCAGG + Intergenic
946187660 2:217990280-217990302 GTGTGTGGATGGTATGTGGCTGG - Intronic
946187705 2:217990561-217990583 GTGTGTGGATGGCATGTGGCTGG - Intronic
946292718 2:218757507-218757529 CACAGTGGGTGTCAGGTGGCTGG + Intergenic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946378225 2:219327170-219327192 CAGTGTGGCTGGGATGTGGCTGG + Intergenic
946400765 2:219467248-219467270 CTGTTTGAGTGCCTGGTGGCGGG + Exonic
947402465 2:229743190-229743212 CCGTCTGGGAGGGAGGTGGCGGG + Intergenic
947407147 2:229790507-229790529 CTGTGGTGGCGGCAGGGGGCAGG + Intronic
947798016 2:232906328-232906350 CCGTGTGGGAGGGAGGTGGGGGG + Intronic
947798094 2:232906504-232906526 CCGTGTGGGAGGGAGGTGGGGGG + Intronic
948150545 2:235740948-235740970 TTGTGTGTGTGGCAGGTGGCAGG + Exonic
948154138 2:235767687-235767709 CTGTGGGGTTGGCAGTGGGCTGG + Intronic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948174466 2:235932212-235932234 CTGCCTGGCTGGCAGGTGGCGGG - Intronic
948454848 2:238100221-238100243 GTGTGAGGGTGCCAGGTGCCTGG - Exonic
948578700 2:238970116-238970138 ATTTGTGGGTGTCAGGTGGGAGG + Intergenic
948791889 2:240383503-240383525 CTGTGTGGATGGGGAGTGGCAGG - Intergenic
948894402 2:240921606-240921628 AAGTGTGGGTGCCAGGAGGCTGG + Intronic
948908634 2:240991937-240991959 CCGTCACGGTGGCAGGTGGCTGG + Intronic
948918335 2:241049750-241049772 CTGTGCGGGCGGCAAGAGGCTGG - Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
949082945 2:242119972-242119994 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1168862523 20:1056062-1056084 CTGTGTGGCTGGAGGGTGACAGG - Intergenic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169404298 20:5310610-5310632 CTGTACAGGTGGCAGGTGGTAGG - Intronic
1169409236 20:5353119-5353141 CTATGTGCCTGGCAAGTGGCAGG - Intergenic
1171018666 20:21564302-21564324 CTGGATGGGTGGGAGGTGGCGGG + Intergenic
1171795256 20:29561389-29561411 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1171853200 20:30322876-30322898 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1172760217 20:37316164-37316186 CCGTGTGGGTGGTAGGTCCCGGG + Intronic
1172777782 20:37417402-37417424 CCATCTGGGTGGCCGGTGGCTGG - Intergenic
1172872825 20:38146606-38146628 GAGTGTTGGTGGCAGGGGGCAGG + Intronic
1173174450 20:40753856-40753878 GAGTGTGGGTGGCGGGAGGCGGG + Intergenic
1173353691 20:42267698-42267720 CTTTGTTGGGGGCCGGTGGCAGG - Intronic
1174077223 20:47946253-47946275 CTGTGGGGGTGGCAGGGAGCAGG + Intergenic
1174168117 20:48599210-48599232 CTGGGTGGGTGTCAGGGTGCAGG - Intergenic
1174365261 20:50052992-50053014 ATGTGGGGGTGGGAGGGGGCGGG - Intergenic
1174452936 20:50630918-50630940 AGGTGTTGGTGGAAGGTGGCTGG - Intronic
1175361183 20:58413829-58413851 CTATCTGGGAGGGAGGTGGCGGG - Intronic
1175361254 20:58414005-58414027 CTATCTGGGAGGGAGGTGGCGGG - Intronic
1175913100 20:62413911-62413933 CTGGGTGGGTGGCTCGGGGCTGG + Exonic
1175936829 20:62517921-62517943 CTGTGTGGGGGGCATGGGGGAGG - Intergenic
1176012555 20:62907042-62907064 GTGTGGGGGTGGCAGGTGTAGGG - Intronic
1176098562 20:63354824-63354846 CTGGGTGGCTTGCAGGGGGCAGG + Intronic
1176279586 20:64292834-64292856 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1176617445 21:9035981-9036003 CTGTGTGGGTGCCAGGTCCAAGG + Intergenic
1177178303 21:17720144-17720166 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1177819632 21:26016925-26016947 CTTTGTGGGGGGCGGGGGGCGGG + Intronic
1178077497 21:29025074-29025096 ATGGGTGGGTGGCGCGTGGCAGG + Intronic
1179255320 21:39710843-39710865 CTGTGTGGGAGGGAGGGAGCAGG + Intergenic
1179428659 21:41303875-41303897 GTGTGTGTGTGGCAGGGGGGGGG + Intergenic
1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG + Intergenic
1180051754 21:45334900-45334922 CTGTGGGGGTGGCTAGTGGGGGG + Intergenic
1180248111 21:46562064-46562086 CTGGGTGGGTGGCAGGCCTCAGG + Intronic
1181487213 22:23238871-23238893 GGGGGTGGGGGGCAGGTGGCGGG + Intronic
1182122307 22:27796109-27796131 CTGTGGGGGTTGCAGGAGGCAGG - Intronic
1182426304 22:30274746-30274768 CTGGGAGGGTGCCAGGAGGCGGG - Intergenic
1182427994 22:30285000-30285022 CTGTGTAGCTGGCTGGGGGCTGG - Intergenic
1182509293 22:30807574-30807596 CTGTGTGAGAGGCAGGGAGCTGG - Intronic
1182616390 22:31592185-31592207 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182616590 22:31592637-31592659 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182821308 22:33218869-33218891 CTGCCTGGATGCCAGGTGGCTGG - Intronic
1183516358 22:38268989-38269011 CAGTGTGGCTGTCACGTGGCTGG - Intronic
1183670408 22:39269438-39269460 CTGAGGGGGTGGGAGGTGGCTGG - Intergenic
1183727582 22:39598054-39598076 CTGTGTGTGTGGTGGGTTGCGGG + Intronic
1183751448 22:39723311-39723333 GTGTGTGTGTGTCAGGTGGGTGG - Intergenic
1184102414 22:42347749-42347771 GTGGGCGGGTGGCAGGTGGCGGG + Intergenic
1184273479 22:43397759-43397781 TTGTGCAGGGGGCAGGTGGCAGG + Intergenic
1184281595 22:43440630-43440652 CTCTGTGACTGGCAGGTGCCAGG + Intronic
1184642137 22:45878374-45878396 CGGAGTGGGTCCCAGGTGGCAGG + Intergenic
1184744093 22:46446107-46446129 CTGGGTGTGTGGCTGGGGGCTGG - Intronic
1184918096 22:47587053-47587075 CAGTGAGGCAGGCAGGTGGCTGG + Intergenic
949268826 3:2190612-2190634 CTGCATGGGTGGTAGGTGGGAGG + Intronic
949712321 3:6885577-6885599 CTGGGTGTGTGGTAGGAGGCAGG - Intronic
950152119 3:10695990-10696012 CAGAGTGGGTGGCTGGGGGCTGG - Intronic
950520115 3:13493160-13493182 CTGTGGGTGGGGCAGGTGGGGGG - Intronic
950649376 3:14397712-14397734 GTCTGTGGGTGGCAAGTGCCTGG - Intergenic
950891108 3:16405170-16405192 CTGTGTGGCTGGCAGGTCCGTGG - Intronic
951954412 3:28239257-28239279 CTGTGTGGCAGGCATGTGGTGGG - Intergenic
952428733 3:33201629-33201651 GTGTGTGGGTGGCAGGTGAGGGG + Intronic
952753343 3:36843587-36843609 CTCTGGGGGATGCAGGTGGCAGG - Intronic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
953125253 3:40086585-40086607 CTGAGTGTGAGGCAGGAGGCAGG - Intronic
953383177 3:42489608-42489630 CTGAGTGGCTGGCATGTGCCAGG + Intronic
953845604 3:46423610-46423632 GTGGGTGGGTGGCAGGTAACTGG + Intergenic
954059585 3:48056648-48056670 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
954222347 3:49162476-49162498 GTGTGTGTGTGGCTGCTGGCAGG - Intergenic
954656229 3:52195914-52195936 CTGTGGGGGTGGCGGTTGGGGGG - Intergenic
954784879 3:53085290-53085312 CTGTGAGGCTGGCAGGGGCCAGG - Intronic
955047470 3:55373622-55373644 GTTTGTGGGTGGAAGGTGGGAGG + Intergenic
955193700 3:56785401-56785423 CAGTGTTGGTGGCAGTGGGCGGG - Intronic
957538386 3:81535536-81535558 CTATGAGGGTAGCAAGTGGCTGG - Intronic
959726468 3:109548369-109548391 CTGTATGGTTGGCAGGTGCAGGG + Intergenic
960294555 3:115927432-115927454 GTGTGTGGGAGGCAGGTAGGAGG - Intronic
960982962 3:123249219-123249241 CTGGGTGGGTGCCATGTGCCAGG - Intronic
961135195 3:124503540-124503562 ATCTGTGGTAGGCAGGTGGCTGG + Intronic
961752836 3:129107456-129107478 GTGTTTGGGTGGCAGCAGGCTGG - Intronic
962083436 3:132165211-132165233 CTATGTGGCTGGCAGACGGCAGG + Intronic
962250894 3:133835510-133835532 AGGTGTGGGTGGCAGGGGACAGG + Intronic
962301153 3:134244246-134244268 CTGTGAAGGTGGCATATGGCTGG - Intronic
962814748 3:138987929-138987951 CTGTGAGGCTGGCAGGTGCCAGG - Intergenic
963827676 3:149971559-149971581 TTGTGGGGGCGGCTGGTGGCAGG + Intronic
965047359 3:163597015-163597037 CTTTGTGGGTGGCTGATTGCAGG - Intergenic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
966018277 3:175171908-175171930 TTGTTTGGGTGGCAGTTGGGGGG + Intronic
967693153 3:192500438-192500460 GTGTGTGTGTGGCGGGTGGGGGG - Intronic
967983327 3:195078325-195078347 CAGTGTGAGGGACAGGTGGCCGG - Intronic
968371762 3:198226144-198226166 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
968619997 4:1599754-1599776 GCGTGTGGCTGGCAGGTGGCGGG - Intergenic
968771730 4:2511805-2511827 CTCTGTGGGTGGGAGGAGGGTGG + Intronic
968978438 4:3834052-3834074 AGGTGTGGGAGGCAGGGGGCAGG - Intergenic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
968983224 4:3861736-3861758 GTGTGGACGTGGCAGGTGGCAGG + Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969441557 4:7220137-7220159 CTGTGTGCTGGGCTGGTGGCAGG + Intronic
969575808 4:8035068-8035090 GTGAGTGGGTGGCAGGTAGGTGG + Intronic
970346984 4:15161924-15161946 TTGTGTGTGTGGCAGGGGGTGGG + Intergenic
971713002 4:30141323-30141345 GTGTGTGTGGGGCAGGGGGCAGG + Intergenic
972079955 4:35138221-35138243 GTGTGTGGGAGGGAGGTGGCTGG + Intergenic
972583124 4:40412715-40412737 ATGTGTTGAAGGCAGGTGGCTGG - Intergenic
973593597 4:52465313-52465335 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
974103861 4:57445643-57445665 CTGTTTGGGTGGCAGGCAGGAGG + Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
978112152 4:104976384-104976406 CTGTTTGTGTGGCAGGAGCCTGG + Intergenic
978560739 4:110031035-110031057 GTGTGTGTGTGGGAGGGGGCTGG + Intergenic
978980396 4:114937879-114937901 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
979260448 4:118638622-118638644 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
980343750 4:131584581-131584603 GTGGGTGAGTGGCAGGTAGCTGG + Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
981127257 4:141120896-141120918 CTGTATGGGCAGCAGATGGCAGG + Intronic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
981677482 4:147358048-147358070 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
982536581 4:156614426-156614448 CTGTGTGTGAAGCAGGAGGCGGG + Intergenic
982740788 4:159054821-159054843 CTATGTGAGTGGCAAGGGGCAGG - Intergenic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
984303246 4:177951622-177951644 GTGTGTGAGTGGCAGGTGTTGGG - Intronic
984533561 4:180945067-180945089 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
985428621 4:189855999-189856021 TTCTGTGTGTGGCAGGCGGCAGG + Intergenic
985524259 5:394148-394170 CTGTCTGGGTGGCAGGAGGGAGG + Intronic
985567082 5:624425-624447 CTGTGCAGGTGGCAAGCGGCGGG - Intronic
986082619 5:4410020-4410042 CTGTGGTGGTGGCAGGGGCCGGG + Intergenic
986284912 5:6351919-6351941 TTGTGTGGGTGGCAGTGGGAGGG - Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986672467 5:10154902-10154924 CATTGTGGGTGGGAGGTGGAGGG - Intergenic
986966175 5:13274573-13274595 TTGTGTGGCTGCCCGGTGGCTGG - Intergenic
987536529 5:19196396-19196418 GTGTGTGAGTGGGAGGAGGCGGG + Intergenic
990289539 5:54334352-54334374 CTGTGTTGGTAGCAGTGGGCAGG - Intergenic
990325767 5:54673921-54673943 CTGTGTGTGTAGTAGGTGGGTGG - Intergenic
990560794 5:56981093-56981115 GTGGGTGGGTGACAGGTGCCAGG - Intergenic
990870987 5:60431176-60431198 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
990888734 5:60624892-60624914 CTGTGTGGGGGGTCGGGGGCAGG - Intronic
991123981 5:63048815-63048837 ATGTTTGGGTGTCAGGTGTCAGG - Intergenic
991932357 5:71766229-71766251 CTTTGTGAGTGGGAGGAGGCAGG + Intergenic
991936588 5:71808046-71808068 CTTTGTTAGTGGCTGGTGGCAGG + Intergenic
992175078 5:74142151-74142173 CAGTTTGGGTCACAGGTGGCAGG + Intergenic
992481765 5:77158609-77158631 CTGGGTGGGTGGCCTGTGGGTGG + Intergenic
992603681 5:78433482-78433504 CTGTGGTGGGGGCAGGTGTCAGG + Intronic
992782478 5:80140725-80140747 CTAAGTGGGTGGCAGGGGGGTGG - Exonic
994452209 5:99956385-99956407 CTGCATGGGTGGCAGGAGCCAGG - Intergenic
994788176 5:104189430-104189452 GTGGGTGAGTGGCAGGTAGCTGG - Intergenic
994833749 5:104820814-104820836 TTGTGTTGGTGGCAGTGGGCTGG - Intergenic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
997626395 5:135334058-135334080 CCGTGCAGGTGGCATGTGGCAGG - Exonic
997874738 5:137537757-137537779 CCGTCTGGGAGGGAGGTGGCGGG - Intronic
998113504 5:139519666-139519688 GTGTGTTGGTGGTAGATGGCTGG + Intergenic
998164443 5:139834998-139835020 CTGTGTGGGTGACGGGTGAATGG - Intronic
999095137 5:148971149-148971171 TTCAGTGGGTGGCATGTGGCTGG - Intronic
999154771 5:149450420-149450442 CTGGGAGGGTGGCTGGAGGCAGG - Intergenic
1000159455 5:158583292-158583314 CTGTCCGGGAGGCAGGTGGGGGG + Intergenic
1000288745 5:159850213-159850235 CAGGGAGGGTGTCAGGTGGCTGG - Intergenic
1001507125 5:172288481-172288503 GTGTGTTGGCGGCGGGTGGCGGG - Intergenic
1001778154 5:174344646-174344668 CTGTGTTGGAGGCAGGTAACAGG - Intergenic
1001778525 5:174347501-174347523 GTGTGTAGGTGGCAGATGGGAGG + Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002197780 5:177510416-177510438 GAGTGTGGGTGGCAGGTCCCAGG + Intronic
1002321344 5:178377819-178377841 CTGTGTGTGTGGCAGGAGCTGGG + Intronic
1002731003 5:181331690-181331712 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1002753532 6:142414-142436 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1005158926 6:22836939-22836961 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1005593149 6:27348995-27349017 CAGTGTTGGTGGCAGTGGGCTGG - Intergenic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006272549 6:32975138-32975160 CAGAGTGGGTGGGAGGTGGGTGG + Intronic
1006376316 6:33673499-33673521 CTTTATGGGGGGCAGGGGGCAGG - Intronic
1006509348 6:34513517-34513539 CAGTGTGGGTGGTGGGTGGCAGG - Intronic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1006954510 6:37855673-37855695 CTTTTTGGGGGGCAGGTGGTGGG + Intronic
1007720975 6:43885328-43885350 CTGAGTGGGTGGCAGCAGGTGGG + Intergenic
1007724476 6:43906748-43906770 GTGTGTGGGAGGCGGGGGGCAGG + Intergenic
1007913428 6:45538348-45538370 ATGAGGGGGTGGGAGGTGGCGGG - Intronic
1007934629 6:45721919-45721941 CTGTTTGTGTGTCAGGTGCCAGG - Intergenic
1010374791 6:75155191-75155213 CCTTGTGGGTGCCAGCTGGCAGG - Intronic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1011427596 6:87247258-87247280 GTGTGTGTGTTGCGGGTGGCAGG - Intronic
1013244663 6:108275080-108275102 GTGTGTGTGTGGCAGGGGGTGGG + Intergenic
1014645056 6:123962911-123962933 GTGGGTGAGTGGCAGGTGGCTGG - Intronic
1015640126 6:135322861-135322883 CTGTGCATGAGGCAGGTGGCAGG + Intronic
1016681367 6:146833187-146833209 TTGGGTGGGTGGCAGGGGGAAGG - Intergenic
1017156705 6:151328888-151328910 TTGTGTGTGTGGCAGGGGGGAGG - Intronic
1017954994 6:159169853-159169875 CTGTGTGGGTGGCGGGAGCGGGG + Intronic
1018176230 6:161181491-161181513 CGGTGGGGGTAGCAGGGGGCGGG + Intronic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018771012 6:166971462-166971484 GTGGGTGTGTGGCAGGTGTCCGG - Intergenic
1018789038 6:167131908-167131930 TTGTGGGGGTGGCACATGGCTGG - Intronic
1018926436 6:168209932-168209954 CTCTGTGGGGAGCAGGAGGCCGG - Intergenic
1018926815 6:168212549-168212571 GTGCGTGGGGGGCAGGGGGCAGG + Intergenic
1019070612 6:169341895-169341917 GTGTGGGTGTGACAGGTGGCAGG - Intergenic
1019173738 6:170149283-170149305 GTGGAGGGGTGGCAGGTGGCAGG - Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019442745 7:1055693-1055715 CTCTGTGGGGTGAAGGTGGCCGG + Intronic
1019643360 7:2116267-2116289 CTGTGTGTGTGCCAAGTGCCGGG + Intronic
1019941836 7:4298079-4298101 CTGAGCTGGTGGGAGGTGGCAGG + Intergenic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1019982649 7:4632786-4632808 TTTTGTGGGGGGAAGGTGGCAGG + Intergenic
1019994879 7:4717515-4717537 CTGGCTGGGAGGCACGTGGCTGG + Intronic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1020792362 7:12642639-12642661 CTTTGTTTGTGGCATGTGGCAGG - Intronic
1021098001 7:16554892-16554914 ATGTGTGGTTGGCAGGTAACTGG + Intronic
1021303110 7:18996831-18996853 GTGTGTGGCTGGGAGGTGGGGGG - Intronic
1021535691 7:21701907-21701929 CTGTGTGGGTTGTAGCTGGACGG + Intronic
1021710141 7:23407934-23407956 ATTTGTGGGGGGCAGGGGGCGGG + Intronic
1022528368 7:31052519-31052541 CTGTGTGGCCGGCTGGCGGCCGG - Exonic
1022975948 7:35557134-35557156 CTGTGTTGTTTGCAGATGGCCGG - Intergenic
1023259268 7:38341808-38341830 GTGTGTGTGTGGCGGGGGGCGGG + Intergenic
1023861455 7:44219793-44219815 CTGGGTGGGTTGCAGGTGGATGG - Intronic
1024076146 7:45818852-45818874 CTGAGTGACTGGCAGGTTGCCGG + Intergenic
1024324957 7:48102222-48102244 GTGTGAGGGTGGCAGGTGCAGGG + Intronic
1024647457 7:51382438-51382460 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1025008208 7:55371917-55371939 GTGTGTGTGTGTCAGGTGGAAGG + Intronic
1025051291 7:55736933-55736955 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1025060059 7:55798188-55798210 CTGAGTGTCTGGCAGGTTGCTGG - Intronic
1025128255 7:56362600-56362622 CTGAGTGACTGGCAGGTTGCCGG - Intergenic
1025176637 7:56805481-56805503 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1025248962 7:57338871-57338893 CTGGGTTGGTGGCAGGTTGGGGG + Intergenic
1025695155 7:63770905-63770927 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027233438 7:76284662-76284684 CTGAGTGGGTGCCAGGTGGAAGG - Intronic
1027308632 7:76929452-76929474 GTTTGTGGGTGGTAGGTGGTGGG - Intergenic
1027943483 7:84715518-84715540 GTGTGTGTGTGGCGGGTGGGGGG + Intergenic
1028899242 7:96077267-96077289 GTGTGTGTGTGGGAGGGGGCAGG + Intronic
1029159428 7:98541157-98541179 CAGGAGGGGTGGCAGGTGGCTGG - Intergenic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029743366 7:102503514-102503536 CTCTGGGGGTGGCAGGGGGGTGG + Intronic
1029761355 7:102602675-102602697 CTCTGGGGGTGGCAGGGGGGTGG + Intronic
1029788261 7:102815508-102815530 GTGTTTGGGAGGCAGGGGGCAGG - Intronic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1030655453 7:112162540-112162562 GTGTGTGGGTGGCAGGGAGAGGG - Intronic
1032052679 7:128658615-128658637 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1032197890 7:129799730-129799752 CTGGATGGGGGGCAGGTGGTAGG + Intergenic
1032416936 7:131743036-131743058 CAGCGTGGGTGACAGGTGGGTGG - Intergenic
1032500620 7:132396998-132397020 CTGTCAGAGTGGCAGGTGTCTGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1033324022 7:140362926-140362948 CTGTCCGGGAGGGAGGTGGCGGG + Intronic
1034313631 7:150110892-150110914 CTGCGAGGCTGGCAGGTGGCAGG + Intergenic
1034343122 7:150370379-150370401 TTGTGTGGGTGGAAGAGGGCAGG + Intronic
1034535851 7:151725218-151725240 GTGTGTGGGTGGCGGGTGGCAGG - Intronic
1034793267 7:153989904-153989926 CTGCGAGGCTGGCAGGTGGCAGG - Intronic
1034843642 7:154422741-154422763 ATGGGTGGGTGGGAGGTGGGTGG + Intronic
1035133369 7:156676001-156676023 CTGTGGGGGTGGCATGTCGGGGG + Intronic
1035251869 7:157603148-157603170 CAGTGATGGTGGCAGGTGGCGGG - Intronic
1035438853 7:158879088-158879110 CTCTGTGGGAGCGAGGTGGCTGG + Intronic
1036155636 8:6339519-6339541 CTGTTCGGGTGGCATGTGGGTGG + Intergenic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1036246909 8:7125755-7125777 CTTTGCTGGTGGCAGTTGGCTGG + Intergenic
1036638205 8:10565609-10565631 GTGTGTCGGGGGCAGGTGGGAGG - Intergenic
1036663788 8:10726027-10726049 TGGAGTGGGTGGTAGGTGGCCGG + Exonic
1037508946 8:19562115-19562137 CTGTGGGGGTGGCAGGATGGTGG - Intronic
1037583679 8:20261894-20261916 CTGAGTGGGAGGGAGGAGGCAGG - Intronic
1037973509 8:23192152-23192174 CTCTGTGGATGGGAGGTGGGTGG - Intronic
1038147475 8:24912750-24912772 CTGTCAGGTTGGCAGGGGGCAGG - Intergenic
1038383593 8:27119902-27119924 CTTTCTGTGTGGCAAGTGGCAGG + Intergenic
1038650824 8:29401779-29401801 CTGTGTGTGTGGCGGGGGGGCGG - Intergenic
1038700042 8:29841367-29841389 CTGTGTGGCTGGCAGGAGAGAGG - Intergenic
1038711767 8:29953462-29953484 CAGTCTGGGTGCCAGGTGCCTGG - Intergenic
1038720248 8:30028539-30028561 ATGTTTGGGTGCCAGGTGGAGGG + Intergenic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1039886854 8:41659701-41659723 GTGTGAGGGTGGCAGGGGGGTGG - Intronic
1040038872 8:42896864-42896886 CGGTGTGGGCGGCCGGGGGCGGG + Intronic
1041617716 8:59927736-59927758 GTGTATGGGGTGCAGGTGGCGGG + Intergenic
1042077335 8:65010455-65010477 GTGTGTGGGTGGCAGGGAGTAGG - Intergenic
1042199701 8:66269450-66269472 CTGTGTGGTTTCCTGGTGGCTGG + Intergenic
1042467080 8:69140543-69140565 CGGTGGAGGTGGCAGGGGGCAGG + Intergenic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042722680 8:71842505-71842527 CTGTGATCGTGACAGGTGGCGGG - Exonic
1044569490 8:93700866-93700888 GTGGGTGGGTGGCAGCCGGCCGG - Intronic
1044832934 8:96267878-96267900 ATGTGTGGGCAGGAGGTGGCGGG - Intronic
1045426007 8:102066451-102066473 CTGTGTGAGTGGCACGGTGCTGG + Intronic
1045872199 8:106939754-106939776 ATGTGTCGGTGGCTGGTGGAGGG + Intergenic
1047100444 8:121669716-121669738 GACTGTGGGAGGCAGGTGGCTGG + Intergenic
1048423259 8:134297908-134297930 AGGTGGGGGTGGCAGGTGGTTGG + Intergenic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1049033110 8:140051537-140051559 CTGTGTGGGTGCCATGGGGTGGG - Intronic
1049217356 8:141414393-141414415 CTGTAGTGGTGGAAGGTGGCTGG + Intronic
1049234876 8:141507487-141507509 CTGTGTGGGTGGCAGGTCCCGGG + Intergenic
1049376639 8:142292474-142292496 CTGTGGAGGTGGTGGGTGGCGGG + Intronic
1049502480 8:142974818-142974840 CTGTGCGGGGGGCGGGGGGCGGG - Intergenic
1049507084 8:143008570-143008592 CAGTGTGGGAGGCAGTGGGCAGG + Intergenic
1049526909 8:143131493-143131515 CTGTGTGGGCCGCATGTGCCCGG + Intergenic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1049582748 8:143420284-143420306 CTGTGTGGATGGCCGATGGGAGG + Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049750408 8:144280460-144280482 CTCTGGGAATGGCAGGTGGCAGG - Intronic
1049808610 8:144553012-144553034 CTGTGGGGCTGGCATGGGGCTGG + Intronic
1050733926 9:8741509-8741531 CTGTTTGAGTGGAAAGTGGCTGG - Intronic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1051877374 9:21806517-21806539 CAGAGTGGGTGGCAGGTTGAGGG + Intronic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1053539517 9:38959078-38959100 CGGTGGGGGTGGGAGGTGGTTGG - Intergenic
1053790994 9:41686175-41686197 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1054154156 9:61628597-61628619 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054179340 9:61897869-61897891 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1054349880 9:64012060-64012082 CTGTGTGGGTGCCAGGTCCAAGG + Intergenic
1054473944 9:65559717-65559739 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054626624 9:67404840-67404862 CGGTGGGGGTGGGAGGTGGTTGG + Intergenic
1054658198 9:67682952-67682974 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1055237723 9:74144067-74144089 CTGTGTTGGGGACAGGTGGGAGG - Intergenic
1055242248 9:74198004-74198026 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1055609730 9:78009299-78009321 TGGTGGTGGTGGCAGGTGGCGGG - Intronic
1056186876 9:84143587-84143609 CTGTGTGTGTGGGAAATGGCAGG + Intergenic
1056470941 9:86903931-86903953 GTGTGTGTGTGGCAGGGGGTGGG - Intergenic
1056564128 9:87758444-87758466 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056564280 9:87758826-87758848 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056897950 9:90568392-90568414 CTGTGTGGGTGGGAGAGGTCTGG - Intergenic
1056964114 9:91152002-91152024 CTGTGTGGGAGGCAGGGAGTGGG - Intergenic
1056976251 9:91257453-91257475 CTGTTGGGGTGGGAGGAGGCTGG - Intronic
1057198285 9:93127122-93127144 CTGGGAGGTTGGGAGGTGGCAGG - Intronic
1057299664 9:93870577-93870599 CTGTGTGAGTGGCTGTGGGCAGG - Intergenic
1057972343 9:99570178-99570200 CTGTGAGGGAGGCAGAGGGCAGG - Intergenic
1058142884 9:101376655-101376677 GTGCGTGAGTGGGAGGTGGCAGG - Intronic
1059121070 9:111641385-111641407 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1059734589 9:117088510-117088532 CTGTGTGTGTTGGAGGTGGGAGG + Intronic
1060668513 9:125447957-125447979 ATGTGTGGCAGGCAGGTGGGAGG + Intronic
1060687310 9:125624191-125624213 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1060717416 9:125945384-125945406 CTATGTGTTTGGCAGGGGGCAGG - Intronic
1060766881 9:126300831-126300853 GTCTGTGGGTGGGAGGTAGCCGG + Intergenic
1060859250 9:126940347-126940369 ATGTTGGGGTGGCAGGTGGCAGG - Intronic
1060974247 9:127755187-127755209 CGGTGTGGGGGGGCGGTGGCCGG + Intronic
1061277851 9:129579682-129579704 CTGAGAGGCTGGCAGGTGCCAGG + Intergenic
1061505983 9:131032161-131032183 CTCTGTGGGCGGCAGGTAGGAGG + Exonic
1061672062 9:132194371-132194393 CTGAGTGGGTAGCAGGTGCTGGG - Intronic
1061680263 9:132239572-132239594 CTGTGACTCTGGCAGGTGGCAGG + Intronic
1061685682 9:132275897-132275919 CTGTGTGGATGGCAGCTGCTCGG - Intronic
1061926653 9:133809178-133809200 ATGTGCAGGTGGCAGGTGGCCGG - Intronic
1062044257 9:134417875-134417897 CTGTTGGGGTGGGAGGGGGCAGG - Intronic
1062200285 9:135299237-135299259 CTATGGGGCAGGCAGGTGGCAGG - Intergenic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1062315087 9:135963164-135963186 CAGTGTGGGTGGCAGAGTGCAGG + Intergenic
1062385446 9:136309184-136309206 CTGGGTGGGTGGCAGGGTGGGGG + Intergenic
1062397908 9:136359921-136359943 CTGGGTGGGCGGCAGCAGGCTGG - Intronic
1062586300 9:137251458-137251480 CAGTGTGGGGGGCAGGTTGCTGG + Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062755408 9:138284197-138284219 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1203405794 Un_KI270539v1:836-858 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1203579322 Un_KI270745v1:28369-28391 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1185455470 X:308157-308179 CTGGGTGGGTGGGTGGTGGTTGG - Intronic
1185463038 X:341077-341099 CGGTGGGGGCGGCAGGGGGCAGG - Intronic
1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG + Intergenic
1186148406 X:6648607-6648629 TTGTGTGTGTGGCAGGGGGATGG + Intergenic
1186194874 X:7100040-7100062 GTGGGTGGGTGGTAGGGGGCCGG - Intronic
1186593782 X:10959125-10959147 ATGGGGGGGTGGCAGGTGGGTGG - Intergenic
1186638041 X:11427421-11427443 CTGAGGGGGTGGCGGGTGGCCGG - Intronic
1186808232 X:13161482-13161504 GTGTGTGTGTGGCGGGTGGGGGG + Intergenic
1187247632 X:17567338-17567360 GTGAGTGGGTGCCAGGAGGCTGG - Intronic
1187397617 X:18931864-18931886 CTGTGCAGGTGCCAGGAGGCTGG + Intronic
1188370020 X:29358404-29358426 CTGTGTGTGTGGCGGGGGGTGGG - Intronic
1188907096 X:35802168-35802190 CCTTGTGGGTGGCAGTAGGCAGG - Exonic
1189444382 X:41067148-41067170 CTGTGGGAGTGGCAGCTTGCAGG + Intergenic
1189883529 X:45515977-45515999 CTGTGTGGGTGAAAGGGAGCAGG + Intergenic
1190262808 X:48808360-48808382 CTGTAAGGGTGGGAGGTGGCTGG - Intronic
1190598204 X:52066832-52066854 GTGTGGAGGTGGCAGGGGGCAGG + Intronic
1190610620 X:52187241-52187263 GTGTGGAGGTGGCAGGGGGCAGG - Intronic
1192361965 X:70445859-70445881 CTCTGTGTCTGGCAGGGGGCGGG + Intronic
1192842590 X:74872436-74872458 GTGTGTGGGTGGGGGGTGGTGGG + Intronic
1193207402 X:78765295-78765317 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1195112123 X:101659118-101659140 CTGTGTGGGCCGGAGGTGTCTGG + Exonic
1195687840 X:107601963-107601985 GTGTCTGGGTGGCTTGTGGCCGG - Exonic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196819551 X:119692316-119692338 CAGTGTGGGGTGCAGTTGGCTGG - Intronic
1197281671 X:124544028-124544050 CTGTGTGGGTCGCATTTTGCCGG + Intronic
1197328192 X:125120463-125120485 CCGTGTGGGGGGCAGGTTGGGGG - Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1199766787 X:150947158-150947180 CTGAGTGGGAGGTAGGGGGCAGG + Intergenic
1200064942 X:153499784-153499806 CTGGGAGAGTGGCAGGGGGCAGG + Intronic
1200081810 X:153580696-153580718 CTGTGTGGTGGGCAGGGGGCTGG + Exonic
1200184920 X:154175922-154175944 CTGGGTGGCTCGCAGTTGGCTGG + Intergenic
1200190573 X:154213060-154213082 CTGGGTGGCTCGCAGTTGGCTGG + Intergenic
1200196324 X:154250862-154250884 CTGGGTGGCTCGCAGTTGGCTGG + Intergenic
1200201979 X:154287980-154288002 CTGGGTGGCTCGCAGTTGGCTGG + Exonic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1200252731 X:154562342-154562364 CTGTGTGTGTCTCAGGGGGCTGG + Intronic
1200265036 X:154642074-154642096 CTGTGTGTGTCTCAGGGGGCTGG - Intergenic
1201150841 Y:11094818-11094840 CTGTGTGGGTGCCAGGTCCAGGG + Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic
1202381928 Y:24280991-24281013 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1202488856 Y:25389134-25389156 CTGAGTGACTGGCAGGTTGCTGG - Intergenic