ID: 1073477340

View in Genome Browser
Species Human (GRCh38)
Location 10:103762932-103762954
Sequence ATTGGCTCTTGGGGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073477340_1073477346 -9 Left 1073477340 10:103762932-103762954 CCATCTGTCCCCCAAGAGCCAAT 0: 1
1: 0
2: 1
3: 28
4: 324
Right 1073477346 10:103762946-103762968 AGAGCCAATGAGCCCTGTCTGGG No data
1073477340_1073477352 10 Left 1073477340 10:103762932-103762954 CCATCTGTCCCCCAAGAGCCAAT 0: 1
1: 0
2: 1
3: 28
4: 324
Right 1073477352 10:103762965-103762987 TGGGTCAGCTTCTCCAGGGATGG No data
1073477340_1073477350 5 Left 1073477340 10:103762932-103762954 CCATCTGTCCCCCAAGAGCCAAT 0: 1
1: 0
2: 1
3: 28
4: 324
Right 1073477350 10:103762960-103762982 CTGTCTGGGTCAGCTTCTCCAGG No data
1073477340_1073477345 -10 Left 1073477340 10:103762932-103762954 CCATCTGTCCCCCAAGAGCCAAT 0: 1
1: 0
2: 1
3: 28
4: 324
Right 1073477345 10:103762945-103762967 AAGAGCCAATGAGCCCTGTCTGG No data
1073477340_1073477351 6 Left 1073477340 10:103762932-103762954 CCATCTGTCCCCCAAGAGCCAAT 0: 1
1: 0
2: 1
3: 28
4: 324
Right 1073477351 10:103762961-103762983 TGTCTGGGTCAGCTTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073477340 Original CRISPR ATTGGCTCTTGGGGGACAGA TGG (reversed) Intronic
902688858 1:18097035-18097057 ATTGGGTTTTGGAGGGCAGAAGG - Intergenic
903528988 1:24014994-24015016 ATTGGATTTAGGGGAACAGACGG + Intergenic
906252495 1:44321459-44321481 AATGCTTCTTGGGGAACAGAAGG - Intronic
906360742 1:45156008-45156030 ATAGGTTTTTGGGGAACAGATGG - Intronic
906801119 1:48737858-48737880 ATGGCCTCTGTGGGGACAGAGGG + Intronic
906892379 1:49730934-49730956 AATGGCTCTGGAGGGACAAATGG - Intronic
909191023 1:72552184-72552206 AGTGGCTCTTTGGGTCCAGAGGG - Intergenic
911011606 1:93287165-93287187 CTGTGCTCTTGGGGGAGAGAAGG + Intergenic
911847390 1:102771743-102771765 ATAGGCTATTGGGGTACAGGTGG - Intergenic
913430957 1:118789840-118789862 ATTGTCATTTGGAGGACAGAGGG - Intergenic
913587554 1:120290488-120290510 ATAGGTTATTGGGGAACAGATGG + Intergenic
913620631 1:120607881-120607903 ATAGGTTATTGGGGAACAGATGG - Intergenic
914569572 1:148902372-148902394 ATAGGTTATTGGGGAACAGATGG + Intronic
914603256 1:149227884-149227906 ATAGGTTATTGGGGAACAGATGG - Intergenic
916331169 1:163618884-163618906 ATAGGTTTTTGGGGAACAGATGG + Intergenic
916849501 1:168689164-168689186 ATTGCCTCTGGAGGGAGAGATGG - Intergenic
917649074 1:177058706-177058728 ATTGATTTTTGGGGAACAGATGG + Intronic
918049910 1:180964943-180964965 AAGGGCTCCTGGGGGAGAGAGGG - Intergenic
918097661 1:181348180-181348202 ATGGGGTCTCGGTGGACAGATGG + Intergenic
918466233 1:184824223-184824245 AATGGGGCTTGGGGGACAGTGGG - Intronic
921058120 1:211559911-211559933 ATCAGCTCTTGCAGGACAGAAGG - Intergenic
922448765 1:225719655-225719677 CTTGGCTCATGGGGGAAGGAGGG - Intergenic
922870116 1:228895861-228895883 ATAGGCTTTTGGGGAACAGGTGG - Intergenic
923078042 1:230627239-230627261 ATTGGCACTTGAGGGAAAGCAGG - Intergenic
923865746 1:237937824-237937846 ATTAGTTCTTGTGGGGCAGAAGG + Intergenic
924470417 1:244338235-244338257 ATAGGTTATTGGGGAACAGATGG + Intergenic
924512957 1:244742852-244742874 ATAGGTTATTGGGGAACAGATGG + Intergenic
924879660 1:248146315-248146337 ATAGGTTTTTGGGGAACAGATGG + Intergenic
1062926234 10:1317701-1317723 ATGGGCTTTTGGGGGACCCAGGG - Intronic
1063069948 10:2651336-2651358 ATTGGCTTTTGGGGAACAGGTGG + Intergenic
1066284905 10:33956195-33956217 ATAGGTTATTGGGGTACAGATGG + Intergenic
1068789208 10:61008907-61008929 ATTGGCACTTGTTGGACAGTGGG - Intergenic
1069211356 10:65764069-65764091 ATTGGCTAGTGTGGGACATAAGG + Intergenic
1070271853 10:74964165-74964187 ATTGGGGGTTGGGGGAAAGAAGG + Intronic
1070618494 10:77988024-77988046 CTGGGCTCCTGGGAGACAGACGG - Intronic
1071070974 10:81693592-81693614 ATTGGCTTTTGGGGAACAGGTGG - Intergenic
1071207551 10:83298797-83298819 ATTTGCTCTTGAGGAAAAGAAGG + Intergenic
1071261863 10:83927371-83927393 AATGGCAGGTGGGGGACAGATGG - Intergenic
1071441540 10:85701939-85701961 ATTGGTTGTTGGGGAACAGGTGG - Intronic
1073142564 10:101258520-101258542 AATGGCTGCTGGGGGACAGGAGG + Intergenic
1073473701 10:103739439-103739461 ATTGGCCAGTGGGGGAGAGAGGG + Intronic
1073477340 10:103762932-103762954 ATTGGCTCTTGGGGGACAGATGG - Intronic
1074039766 10:109776791-109776813 ATTGCCTCTTGGTGGATAGATGG - Intergenic
1075886988 10:125908723-125908745 ATAGGTTTTTGGGGAACAGATGG - Intronic
1076338054 10:129723139-129723161 ATAGGTTTTTGGGGAACAGATGG + Intronic
1076932502 10:133542060-133542082 ATAGGTTCTTGGGGAACAGGTGG + Intronic
1078429903 11:11280775-11280797 ATTGGCACTTTGGGGCCACATGG + Intronic
1078577886 11:12517087-12517109 ATTGGCTAGAGTGGGACAGAGGG - Intronic
1078724199 11:13914175-13914197 ATAGGTTTTTGGGGAACAGATGG + Intergenic
1078911574 11:15737575-15737597 CCTGGCTCTTGGGGGAAAGAAGG - Intergenic
1080021743 11:27568658-27568680 ATAGGTTATTGGGGAACAGATGG - Intergenic
1081569317 11:44279667-44279689 ATTGGATCTTGGAGGTCAGCTGG - Intronic
1081870078 11:46379397-46379419 GATGGCCCTTGGGAGACAGATGG + Intronic
1083068978 11:59956573-59956595 ATTGGTTATTGGGGTACAGGAGG + Intergenic
1083092040 11:60209809-60209831 ATTGGCTCTTCCGCAACAGAGGG - Intronic
1083100910 11:60305021-60305043 ATTGGCTCTTCTGCAACAGAGGG + Intronic
1083862741 11:65432706-65432728 AATGGCTTTTGGGGTACAAATGG + Intergenic
1083862821 11:65433756-65433778 AATGGCTTTTGGGGTACAAATGG + Intergenic
1084272552 11:68036946-68036968 GATGGCTCTTGGGAGACAGGAGG - Intergenic
1084478178 11:69400731-69400753 TTTGGCTCCTGGGGAACTGAAGG - Intergenic
1085149134 11:74234076-74234098 ATTGGATGTTGGGAGAGAGACGG + Intronic
1085353652 11:75816358-75816380 ATCTCCCCTTGGGGGACAGAAGG - Intronic
1086498274 11:87426063-87426085 ATTTGCACTTTGGGGGCAGAAGG + Intergenic
1086525973 11:87726404-87726426 ATTGGCTAGTGGGGGAAGGAAGG - Intergenic
1087967096 11:104429696-104429718 ATAGGTTATTGGGGGACAGGTGG + Intergenic
1088837211 11:113587868-113587890 ACTGACTCTGGGTGGACAGAGGG + Intergenic
1089302539 11:117507354-117507376 ATGGGCTCTGGGGGCAAAGACGG + Intronic
1090048160 11:123354473-123354495 ATTTGCCCTGGGGAGACAGAAGG + Intergenic
1090142747 11:124282382-124282404 ATAGGTTATTGGGGTACAGATGG - Intergenic
1090221102 11:125026755-125026777 AATAGCTGTTGGGGAACAGATGG + Intronic
1090541150 11:127707614-127707636 GGTGGCTCTTGGTGGATAGATGG + Intergenic
1090595604 11:128318067-128318089 AATAGCTTTTGGGGAACAGATGG + Intergenic
1090783508 11:130028248-130028270 GTCTGCACTTGGGGGACAGATGG - Intergenic
1091078791 11:132646252-132646274 ATAGGCTTTTGGGGCACAGGTGG - Intronic
1096318457 12:50589736-50589758 GATTGCTCTTGGGGGCCAGAGGG + Intronic
1097350961 12:58548531-58548553 CTTGGGACTTGGGGAACAGAAGG + Intronic
1097861489 12:64522844-64522866 ATAGGCTCCTGGGGGAAAGGTGG + Intergenic
1098707496 12:73708880-73708902 GTTGGCTGTTGGGGGGCATAGGG + Intergenic
1099382104 12:81967735-81967757 ATAGGCTTTTGGGGAACAGGTGG + Intergenic
1099441514 12:82705306-82705328 ATAGGTTATTGGGGAACAGATGG - Intronic
1099919641 12:88941333-88941355 ATTGGTTTTTGGGGAACAGGTGG - Intergenic
1100221544 12:92509489-92509511 ATTGGCTCTTGGTGTAAAGTTGG - Intergenic
1102984344 12:117266126-117266148 ATAGGCTTTTGGGGAACAGGTGG + Intronic
1103642355 12:122361915-122361937 ATAGGTTTTTGGGGAACAGATGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1105786003 13:23749955-23749977 ATTGCCACTTGGGGGAGGGAGGG - Intronic
1106078695 13:26482765-26482787 TTTGCCTCCTGGTGGACAGAGGG - Intergenic
1106383475 13:29262845-29262867 CTTGGGTCTTGTGGGACAGATGG + Intronic
1106497336 13:30292380-30292402 ATTGGGGCTTGGGGAACTGATGG - Intronic
1107796872 13:44061977-44061999 ACTAGATCTTGGGTGACAGAAGG + Intergenic
1108695995 13:52902918-52902940 ATTGGTACTTGCAGGACAGATGG - Intergenic
1108762298 13:53583199-53583221 ATAGGTTCTTGGGGAACACATGG + Intergenic
1108832132 13:54492754-54492776 ATGGGTTTTTGGGGAACAGATGG - Intergenic
1108975614 13:56440304-56440326 ATTGGTTCAAGGGGGACGGATGG - Intergenic
1108996735 13:56743751-56743773 ATGGGTTATTGGGGAACAGATGG + Intergenic
1110675099 13:78233171-78233193 ATAGGTTTTTGGGGAACAGATGG - Intergenic
1111894140 13:94119783-94119805 ATCAGCTCTTGGGGGAATGAAGG + Intronic
1111950513 13:94705621-94705643 CTTGCCTCGTGGGGGACAGGAGG + Intergenic
1112814647 13:103257879-103257901 ATAGGTTTTTGGGGAACAGATGG + Intergenic
1114286488 14:21249240-21249262 AATTGCTCTTGGGGAAGAGAAGG - Intronic
1114549104 14:23523064-23523086 TCAGGCTCTTGGGGGAAAGAAGG - Intronic
1116429412 14:44828699-44828721 ATTGGGTATTGTGGGAAAGAAGG - Intergenic
1116494209 14:45540838-45540860 ATAGGTTTTTGGGGAACAGATGG - Intergenic
1117520267 14:56544577-56544599 ATTGGCTCTTAAGAGAGAGAGGG - Intronic
1118189277 14:63565758-63565780 ATAGGTTTTTGGGGAACAGATGG - Intergenic
1119098976 14:71862103-71862125 ATAGGTTATTGGGGTACAGATGG - Intergenic
1119294638 14:73522966-73522988 ATTGGCTCTTGCGGTGTAGACGG + Exonic
1119431997 14:74574635-74574657 GTAGGCTCTGGGAGGACAGAAGG + Intronic
1121373191 14:93379831-93379853 AATAGCTTTTGGGGAACAGATGG - Intronic
1202871124 14_GL000225v1_random:165286-165308 ATAGGTTTTTGGGGAACAGATGG + Intergenic
1124358297 15:29015466-29015488 TGTGGCTCCTGGGGGACAGCAGG - Intronic
1124696407 15:31868028-31868050 ATTAGCTCTTGTGGGCCAGCAGG - Intronic
1124801090 15:32833466-32833488 ATTAGATCATGGGGGTCAGAAGG - Intronic
1126937993 15:53733107-53733129 AGTGGCACTCTGGGGACAGAAGG - Exonic
1127196180 15:56588324-56588346 ATTGGCTCTAGCTGGGCAGAGGG + Intergenic
1128009913 15:64283133-64283155 ATAGGTTATTGGGGTACAGATGG - Intronic
1128889485 15:71318057-71318079 AGTGGCTTTTGGGGGGCAGTAGG + Intronic
1130406365 15:83605809-83605831 CTTTTCTCTTTGGGGACAGAGGG - Intronic
1131150776 15:90046072-90046094 ATGGTCTCTGGGGGGACACAGGG + Intronic
1131424147 15:92331854-92331876 ATTGGGTCTGGAGGGACAAATGG - Intergenic
1131778207 15:95825464-95825486 ATTTGCTCTTTGGAGCCAGATGG - Intergenic
1132154910 15:99488841-99488863 ATAGGTTTTTGGGGAACAGATGG - Intergenic
1133168577 16:3965903-3965925 ACGGTCTCTTGGGGGACAGGTGG + Exonic
1133439128 16:5805916-5805938 AGTGGATCTGGGGGGACAAATGG + Intergenic
1136461106 16:30410643-30410665 AAAGGCAGTTGGGGGACAGAGGG + Intronic
1138141823 16:54575189-54575211 ATTGGCTTTTGGTGCAAAGAAGG + Intergenic
1138670356 16:58609433-58609455 ATAGGTTATTGGGGGACAGGTGG - Intronic
1139031177 16:62882765-62882787 ATTGGCACTTAGTGGGCAGAGGG - Intergenic
1139094600 16:63690393-63690415 ATTGGCTGAAGGGGAACAGAGGG - Intergenic
1140679766 16:77373689-77373711 ATAGGTTTTTGGGGGACAGATGG - Intronic
1141864490 16:86740798-86740820 ATTGGTTTTTGGGGAACAGGTGG - Intergenic
1142127707 16:88418418-88418440 ATTGGCCTTTGTGGCACAGAGGG + Intergenic
1143376382 17:6470046-6470068 ATTGGCTCCTGGGTGGCTGACGG - Intronic
1143968981 17:10778822-10778844 AGTGGGTGTTGGGGGACAGTGGG - Intergenic
1144013614 17:11172909-11172931 ATTCCAGCTTGGGGGACAGAGGG + Intergenic
1144855862 17:18267490-18267512 TTTGGCTCTTGCGGGTGAGAGGG - Intergenic
1146443383 17:32916569-32916591 ATTGGCTCTCAGGGAAAAGAAGG - Intergenic
1148568770 17:48649638-48649660 TTTGGCTCTTGGTGGACTTAAGG + Intergenic
1149392886 17:56209686-56209708 ATAGGCTTTTGGGGAACAGGTGG + Intronic
1149960875 17:61108626-61108648 ATAGGCTTTTGGGGAACAGGTGG + Intronic
1150235629 17:63590645-63590667 ATGTGCTCTTGGGGGAAAGTTGG + Exonic
1150284208 17:63946293-63946315 CCTGGCTCTGGGGGGTCAGAGGG + Intronic
1151216971 17:72583688-72583710 ACTGGCCCTGGGGGGACAGATGG - Intergenic
1151552788 17:74831673-74831695 ATAGGCTCTTGGGGAACTGCAGG + Intronic
1151954652 17:77374213-77374235 ATCGGGCCGTGGGGGACAGAAGG + Intronic
1153012598 18:553022-553044 ATAGGTTATTGGGGAACAGATGG - Intergenic
1154222086 18:12464894-12464916 ACTGGCTCTTCAGGGAAAGAGGG + Exonic
1155879953 18:31133200-31133222 ATGGGTTCTTTGGGGTCAGAGGG + Intronic
1156730350 18:40186760-40186782 ATTGGATCTTGGGGAAAAGTTGG - Intergenic
1156851288 18:41729965-41729987 ATAGGCTTTTGGGGAACAGATGG + Intergenic
1157045062 18:44092660-44092682 ATAGGCTTTTGGGGAACAGGTGG - Intergenic
1159262577 18:66034439-66034461 ATAGGTTATTGGGGAACAGATGG + Intergenic
1159349982 18:67259839-67259861 ATTGTCTCTCCTGGGACAGATGG - Intergenic
1159409288 18:68050560-68050582 ATTGGCTTTTGGAGAACAGGTGG + Intergenic
1161906847 19:7163175-7163197 ATTGGATCCAGGGGCACAGAGGG + Exonic
1164511757 19:28903222-28903244 ATGAGCTCTTGGGGGATATACGG + Intergenic
1165783989 19:38450308-38450330 ATTGGCTGTGGGGTGAGAGAAGG + Intronic
1166193952 19:41194124-41194146 GTGGGGTCTTGGGGGAGAGATGG + Intronic
1166962605 19:46507869-46507891 AATGGCTCTGGGGGGCCGGAGGG + Intronic
1168048130 19:53808791-53808813 ATTGACACTTTGGGGCCAGAGGG + Intronic
931725031 2:65101383-65101405 ATAAGCTCTGGGGGCACAGAGGG - Intronic
932716349 2:74102718-74102740 CTTGGCTCTCGAGGGGCAGATGG - Exonic
934579757 2:95428529-95428551 CCTGGCTCTTGGGGGCCAGCAGG - Intergenic
934599690 2:95648196-95648218 CCTGGCTCTTGGGGGCCAGCAGG + Intergenic
935007615 2:99095369-99095391 ATAGGTTTTTGGGGAACAGATGG - Intronic
936614564 2:114035301-114035323 ATAGGTTTTTGGGGAACAGATGG + Intergenic
937483662 2:122291121-122291143 ATAGGTTCTTGGGGAACAGGTGG - Intergenic
938311842 2:130295649-130295671 ATTGGTTTTTGGGGAACAGGTGG - Intergenic
938809592 2:134840781-134840803 ATAGGCTATTGGGGAACAGGTGG + Intronic
939087302 2:137736895-137736917 ATAGGTTATTGGGGAACAGATGG - Intergenic
939998690 2:148945571-148945593 ATAGGCTATTGGGGTACAGGTGG + Intronic
943526592 2:189024076-189024098 ATAGGTTATTGGGGAACAGATGG - Intergenic
943752682 2:191526060-191526082 ATAGGTTATTGGGGTACAGATGG - Intergenic
944693419 2:202179276-202179298 TTTGGCTCTTCGGGTAAAGATGG + Intronic
945015435 2:205509877-205509899 ACTGGCCCTTGGGCCACAGAGGG - Intronic
947144203 2:227049698-227049720 ACTGGCTCCTGCGGGACATAGGG + Intronic
947238603 2:227970207-227970229 TTGGGCACTGGGGGGACAGAAGG - Intergenic
947266657 2:228289713-228289735 ATTGGCTCTTGGGTGACTCTTGG - Intergenic
949003727 2:241633390-241633412 ATGGGCTCTCGGGGGACAGATGG + Exonic
1169252529 20:4071544-4071566 GTGGGCTCCTGGGGGAGAGAAGG + Intronic
1169344346 20:4818489-4818511 ATTGGCACTTGGGAGCCAGTAGG - Intronic
1170629392 20:18055254-18055276 CTGGGCAATTGGGGGACAGAGGG + Intronic
1170731643 20:18981085-18981107 ATTGCCTCTAGGGGGAGAAAAGG - Intergenic
1170950990 20:20935917-20935939 ATAGGCTTTTGGGGAACAGGTGG + Intergenic
1171031061 20:21676738-21676760 AATGGCTCTTGGGGAGAAGAAGG - Intergenic
1171371225 20:24663529-24663551 CTGGGCTCTGGGGGGACAGGAGG - Intronic
1171444121 20:25191567-25191589 ATTGGTCCTCTGGGGACAGAAGG + Intergenic
1171968919 20:31551266-31551288 CTTGGCTCTTGGTGAAGAGAGGG - Intronic
1173075812 20:39818218-39818240 ATTAGCTCATTGGGAACAGAGGG + Intergenic
1173277677 20:41598655-41598677 ATTGGTACCTGGAGGACAGATGG - Intronic
1174656837 20:52178721-52178743 ATTGGCTTTTGGGAGAAAGACGG - Intronic
1176061207 20:63173733-63173755 ATTGGCCCCTGGGGAACAAAAGG + Intergenic
1176705957 21:10120115-10120137 ATGTGCTCTTGGGGGACATCAGG - Intergenic
1177708302 21:24737752-24737774 GTGAGCTCTTGGAGGACAGAGGG + Intergenic
1177882164 21:26707228-26707250 AATGGGTCTTGGGGGAGGGAGGG - Intergenic
1179229880 21:39492101-39492123 ATAGGTTTTTGGGGGACAGGTGG + Intronic
1179241177 21:39594335-39594357 ATTGGTTATTGGGGAACAGGTGG - Intronic
1180161873 21:46001803-46001825 ATTGGCTCTGGGTGCACAGAGGG - Intronic
1180704982 22:17803907-17803929 ATTGGGTATGGGGGGACAGGAGG - Intronic
1181978491 22:26749616-26749638 ATTGGTTTTTGGGGAGCAGATGG + Intergenic
1182265927 22:29115407-29115429 ATAGGTTCTTGGGGAACAGGTGG - Intronic
1185293691 22:50041911-50041933 GTTGGGTATTGGGGCACAGAGGG - Intronic
949490970 3:4588659-4588681 TTTAGCTCTTGGGAGACAGATGG - Intronic
951967627 3:28405003-28405025 ATTGGTTATTGGGGAACAGGTGG - Intronic
953077239 3:39581924-39581946 GTTGGGACTGGGGGGACAGATGG + Intergenic
953742019 3:45546201-45546223 CATGGCTCTTGGGTGACAGTTGG + Intronic
954832476 3:53434184-53434206 AATGGCTTTTGGGGAACAGGTGG + Intergenic
955091978 3:55761684-55761706 ATTGGATCATGAGGGACACATGG + Intronic
955146662 3:56326682-56326704 ATTGGGTCATGTGGGACAGCAGG - Intronic
955380621 3:58435091-58435113 TTTGGCCCTTGGGGGTCAGATGG + Intergenic
955609270 3:60739691-60739713 TTTGGCTCTTGAGAGACATATGG - Intronic
956893638 3:73637925-73637947 AATGGCTATTGGGGGACAATTGG - Intergenic
958092543 3:88894857-88894879 TTGGGCTCTTGGGGGAAAGGTGG - Intergenic
958256022 3:91325709-91325731 ATTGTCTCTTGGTGAACAGAGGG - Intergenic
959604756 3:108230276-108230298 ATAGGCTATGGGGGTACAGAGGG - Intergenic
960244568 3:115386081-115386103 ATTGGCTGATGGGCGGCAGATGG - Intergenic
961669867 3:128521175-128521197 ATTGGCTCTTCAAGGTCAGAAGG - Intergenic
962864356 3:139435024-139435046 ATTGCCTCCTGGAGGCCAGAGGG - Intergenic
963176791 3:142306209-142306231 AATGGATTTTGGGGGTCAGAGGG + Intergenic
963391819 3:144674365-144674387 ATTGCCTCTTGGTTCACAGATGG - Intergenic
964707110 3:159630842-159630864 ATAGGCTTTTGGGGAACAGGTGG - Intronic
964840212 3:160985187-160985209 ATAGGATTTTGGGGAACAGATGG + Intronic
965296163 3:166949469-166949491 ATAGGTTTTTGGGGAACAGATGG + Intergenic
965454357 3:168879364-168879386 ATAGGTTTTTGGGGAACAGATGG - Intergenic
966122867 3:176542527-176542549 ATTGGTTTTTGGGGAACAGGTGG - Intergenic
966686498 3:182701516-182701538 ATAGGTTTTTGGGGAACAGATGG + Intergenic
969593401 4:8134361-8134383 AGTGCCTCCTTGGGGACAGAAGG - Intronic
971737767 4:30478788-30478810 ATTGTATGTTGGGGGAGAGAAGG + Intergenic
971900507 4:32651956-32651978 ATTGGCTCTTGTGGAACCGAAGG + Intergenic
972682380 4:41318776-41318798 ATGGGCTCTTTGTGGACAAATGG - Intergenic
974856509 4:67467145-67467167 AGTGGCTTTTGGGGTACAAATGG - Intergenic
975841032 4:78474410-78474432 ATTGGAACTTGGGGGAAAAAAGG + Intronic
976965670 4:91037188-91037210 ATTGTGTGTTGGGGGACAGAAGG - Intronic
977714131 4:100162171-100162193 ATTGGCTTTTGGGGGGCAGCTGG - Intergenic
977779524 4:100964383-100964405 ATAGGGTTTTGGGGGACAGGTGG - Intergenic
979790232 4:124771428-124771450 AATGGCTTTTGGGGAACAGGTGG + Intergenic
980086605 4:128397112-128397134 ATAGGCTTTTGGGGAACAGGTGG + Intergenic
980661827 4:135870619-135870641 ATTGGCTGTTGAGAAACAGATGG - Intergenic
981537676 4:145816624-145816646 CTAGGCTGGTGGGGGACAGATGG + Intronic
981940748 4:150279278-150279300 ATTGGCTTTTGGAGGAGGGAGGG - Intronic
983353526 4:166625541-166625563 ATTTTCTATTGGGAGACAGAGGG - Intergenic
984499512 4:180541434-180541456 ATTGACTCTTAGGGGAAAGCAGG - Intergenic
987733400 5:21806688-21806710 ATAGGCTCTTGGGCCACAAAAGG - Intronic
988729807 5:33960733-33960755 ATAGGCTATTGGGGAACAGGTGG - Intronic
988846623 5:35134153-35134175 ATAGGTTTTTGGGGAACAGATGG - Intronic
989338149 5:40342977-40342999 ATAGGTTCTTGGGGAACAGGTGG - Intergenic
989396831 5:40966129-40966151 ATAGGTTTTTGGGGAACAGATGG + Intronic
990250667 5:53911553-53911575 ATAGGCTTTTGGGGGACAGGTGG + Intronic
990538847 5:56752008-56752030 ATTGGCTTTCTGGGGACACAAGG - Intergenic
990628229 5:57638372-57638394 ATTGGCTCATGGTTCACAGACGG - Intergenic
991031705 5:62088435-62088457 ATTCACACTTGGGTGACAGAAGG + Intergenic
991064804 5:62413244-62413266 ATTTGCCCTTGGGGGATAGGTGG + Intronic
991577625 5:68121866-68121888 AATGGCTCTGGGGGAATAGATGG + Intergenic
995252797 5:110013766-110013788 ATTGCTTTTTGCGGGACAGAAGG - Intergenic
995254315 5:110028992-110029014 ATGGGCCCTTGCAGGACAGATGG + Intergenic
998002176 5:138634099-138634121 ATTGGCCCTTGGGAAACATATGG + Intronic
999126687 5:149251253-149251275 ACTGGCGCTTGTGGGACATAGGG - Intronic
999318120 5:150597096-150597118 GTTGGCTAGTGGGGGACAGTGGG + Intergenic
999510105 5:152241209-152241231 ATTGGTTATTGGGGTACAGGTGG - Intergenic
999620576 5:153468467-153468489 ATGGGGTGTTGGGGAACAGAAGG - Intergenic
1002058461 5:176612038-176612060 ATGAGCTCTGGGGGGAAAGAGGG + Intergenic
1004469321 6:15915282-15915304 ATTTTCTCTTGGGGGACTGTGGG - Intergenic
1004887217 6:20062752-20062774 CTTGACTCTTGGGGAACAGGAGG + Intergenic
1005715907 6:28548168-28548190 ATAGGTTTTTGGGGAACAGATGG - Intergenic
1005792689 6:29322279-29322301 ATAGGTTTTTGGGGAACAGATGG + Intergenic
1006307287 6:33231058-33231080 ATAGGCTTTTGGGGAACAGGTGG + Intergenic
1006503523 6:34473414-34473436 ATTGGACCTTGTGGGACAGGTGG + Intronic
1008426954 6:51369868-51369890 ACTGGATCTTGGGGGTTAGAAGG + Intergenic
1008999317 6:57695463-57695485 ATTGTCTCTTGGTGAACAGAGGG + Intergenic
1009187806 6:60594868-60594890 ATTGTCTCTTGGTGAACAGAGGG + Intergenic
1009445076 6:63733045-63733067 AGTGGCTCTTTGAGGATAGAGGG + Intronic
1009750099 6:67871257-67871279 ATTGGGACTTAGGGGACAGGCGG - Intergenic
1009750414 6:67873104-67873126 ATTGGGACTTAGGGGACAGGCGG + Intergenic
1010709297 6:79153879-79153901 ATTGGCACTTGGAAGAAAGAAGG - Intergenic
1013575641 6:111482318-111482340 AGCGGCACTTGGGGGACACAAGG + Intronic
1013857077 6:114585848-114585870 ATAGGTTTTTGGGGAACAGATGG - Intergenic
1014022318 6:116605342-116605364 ATAGGCTTTTGGGGCACAGGTGG - Intergenic
1014315579 6:119860727-119860749 ATTTTCGCTTGGAGGACAGAAGG - Intergenic
1014572279 6:123024511-123024533 ATTGGCTCTGGGTGGACTAAAGG + Intronic
1015594686 6:134855196-134855218 TTTCTCTCTTGGGGGAAAGAAGG + Intergenic
1016053548 6:139554937-139554959 AGTCTCTCTTGGGGGACTGAGGG - Intergenic
1017650461 6:156576623-156576645 ATGGACTCTTGGGGAAAAGAAGG - Intergenic
1017822381 6:158059113-158059135 TTTGGGTCATGGGGGACAGCTGG + Intronic
1019685543 7:2379978-2380000 ATGGGCACATGTGGGACAGAAGG + Intronic
1019919720 7:4155797-4155819 CTTGGCTCTTGGGATACAGCAGG + Intronic
1020348536 7:7192160-7192182 ATAGGCTTTTGGGGAACAGGTGG + Intronic
1020648276 7:10842844-10842866 ATTGGCTATTGGGAGTGAGAAGG - Intergenic
1021235907 7:18142369-18142391 ATTGCCACTGGGGGGACAGAAGG - Intronic
1021958172 7:25847358-25847380 AATGGCTCTTTTGTGACAGAAGG + Intergenic
1022421935 7:30231410-30231432 ATTGTCTCTTGGGCAACAGATGG + Intergenic
1023565207 7:41517209-41517231 GCTGGCTCTTGATGGACAGATGG - Intergenic
1023705004 7:42932155-42932177 TTTGGCTCTTCGGGTAAAGATGG - Exonic
1024126926 7:46308355-46308377 ATAGGTTATTGGGGAACAGATGG - Intergenic
1026569389 7:71516098-71516120 TTGGACTCTTGGTGGACAGAGGG + Intronic
1027491847 7:78837192-78837214 ATTGGCACTTGGGCGGCTGAGGG - Intronic
1027734395 7:81914519-81914541 CCTGTCTCTTGGGGCACAGATGG + Intergenic
1028760602 7:94491904-94491926 ATAGGCTTTTGGGGAACAGGTGG - Intergenic
1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG + Intronic
1029714762 7:102319882-102319904 TTTGGCTCTGCAGGGACAGAGGG + Intronic
1030270293 7:107662098-107662120 AGTGCCTCTTGGGGTACAGTGGG + Intronic
1031011673 7:116530583-116530605 ATTGGGTCATGGAGGACAGATGG + Intronic
1031483907 7:122306568-122306590 CTTGGCTCTTGGGGCAGAGGCGG - Intronic
1031529479 7:122858917-122858939 TTTGGCCCTTGGGGAACAGATGG + Intronic
1031575061 7:123405634-123405656 ATAGGTTATTGGGGAACAGATGG + Intergenic
1032289211 7:130572216-130572238 ATAGGCTTTTGGGGAACAGGTGG - Intronic
1034275722 7:149823025-149823047 ATTGGCAGATGGGAGACAGAGGG - Intergenic
1037560510 8:20069899-20069921 ATAAGTTATTGGGGGACAGATGG - Intergenic
1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG + Intronic
1038256713 8:25957190-25957212 ATTTGCTCTTGGGGGGGAAATGG - Intronic
1038266691 8:26043785-26043807 ATCGGCTCTTTGGGGGTAGAAGG + Intronic
1042540230 8:69900802-69900824 GTGGGTTCTTGGGGTACAGAGGG - Intergenic
1043348978 8:79336203-79336225 ATAGGCTTTTGGGGAACAGGTGG - Intergenic
1045656633 8:104393823-104393845 ATAGGCTTTTGGGGAACAGGTGG + Intronic
1045671563 8:104559585-104559607 ATAGGCTTTTGGGGAACAGATGG - Intronic
1046829477 8:118728565-118728587 ATAGGTTATTGGGGAACAGATGG - Intergenic
1047041105 8:120996654-120996676 ATTGCCTCTTGAGTGACTGAAGG - Intergenic
1047683608 8:127280382-127280404 ATTGGCTCTTCATAGACAGAAGG - Intergenic
1048334051 8:133490087-133490109 ATTTGCTCTTTGGGCAGAGAAGG + Intronic
1049346512 8:142142092-142142114 ATTGGCTGCTGGGGCACAGCTGG + Intergenic
1050096593 9:2073735-2073757 ATTGGCCTTTGGGTGACAGCTGG + Intronic
1050162685 9:2734529-2734551 AATGGCTGTGGGAGGACAGAGGG - Intronic
1051303589 9:15681669-15681691 AGTGGCCTTTGGGGGAAAGAAGG + Intronic
1053672870 9:40386585-40386607 ATAGGTTATTGGGGAACAGATGG - Intergenic
1054383981 9:64526649-64526671 ATAGGTTATTGGGGAACAGATGG - Intergenic
1054511755 9:65989698-65989720 ATAGGTTATTGGGGAACAGATGG + Intergenic
1054712948 9:68529770-68529792 TTTTGCTTTTGGGGGATAGAGGG + Exonic
1057873919 9:98739096-98739118 AGTGGACTTTGGGGGACAGAGGG + Intronic
1058012761 9:99996547-99996569 ATTGGTTATTGGGGTACAGGTGG + Intronic
1058094686 9:100846382-100846404 ATAGGTTTTTGGGGAACAGATGG + Intergenic
1058583745 9:106485241-106485263 ATTCCCTCTTGAGGGACAGCAGG - Intergenic
1059537364 9:115093904-115093926 ATTGGCTCATGGTGGTCTGAGGG + Intronic
1062096193 9:134705206-134705228 ATGCGCCCTTGAGGGACAGAGGG + Intronic
1062705954 9:137942937-137942959 ATAGGTTATTGGGGAACAGATGG - Intronic
1203733331 Un_GL000216v2:111301-111323 ATAGGTTTTTGGGGAACAGATGG - Intergenic
1185949688 X:4418954-4418976 ATAGGTTATTGGGGAACAGATGG - Intergenic
1185978334 X:4747168-4747190 ATAGGTTTTTGGGGAACAGATGG + Intergenic
1187277585 X:17829414-17829436 TTGGGCTCTTGGGAGTCAGATGG - Intronic
1187392179 X:18893399-18893421 AGGGGATCTTGGGGGACAGAAGG + Exonic
1188466530 X:30487831-30487853 ATTGGCTCTTGGGGACCAGCAGG + Intergenic
1188605293 X:32021423-32021445 TTTGGCTCTGGGGGGAAGGAAGG + Intronic
1189643909 X:43105558-43105580 CTTGGAGCCTGGGGGACAGAGGG - Intergenic
1190440855 X:50472803-50472825 ATGGCCTCTTGGGTTACAGATGG + Intergenic
1190743385 X:53305748-53305770 CTTGGCTCTGGGATGACAGAAGG - Intronic
1191199835 X:57768519-57768541 AATAGCTCTTGGGGTACAGGTGG + Intergenic
1193792123 X:85827552-85827574 ATTGGTTATTGGGGAACAGATGG - Intergenic
1194373688 X:93106864-93106886 ATAGGCTTTTGGGGAACAGGTGG + Intergenic
1195226750 X:102803314-102803336 ATAGGTTCTTGGGGAACAGGTGG + Intergenic
1195303350 X:103554483-103554505 ATTTGTTATTGGGAGACAGATGG - Intergenic
1196055814 X:111353788-111353810 AATGGCTCTTTGAGGACAGAAGG - Intronic
1196896396 X:120341051-120341073 ATAGGTTTTTGGGGGACAGGTGG - Intergenic
1198437383 X:136630481-136630503 CTGGGCTCTGGGGGGCCAGAAGG - Intergenic
1199468113 X:148163140-148163162 AATGGCTCTTGGGAAACATATGG + Intergenic
1200681717 Y:6220897-6220919 ATAGGCTTTTGGGGAACAGGTGG + Intergenic
1202627680 Y:56877124-56877146 ATAGGTTTTTGGGGAACAGATGG + Intergenic