ID: 1073479803 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:103779371-103779393 |
| Sequence | CGGGGGTATCAGGAGGATGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6034 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 62, 4: 5971} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073479803_1073479815 | 17 | Left | 1073479803 | 10:103779371-103779393 | CCAGCATCCTCCTGATACCCCCG | 0: 1 1: 0 2: 0 3: 62 4: 5971 |
||
| Right | 1073479815 | 10:103779411-103779433 | CTTGTGAACTTCCCTCCCTTTGG | No data | ||||
| 1073479803_1073479816 | 25 | Left | 1073479803 | 10:103779371-103779393 | CCAGCATCCTCCTGATACCCCCG | 0: 1 1: 0 2: 0 3: 62 4: 5971 |
||
| Right | 1073479816 | 10:103779419-103779441 | CTTCCCTCCCTTTGGTCCCTAGG | No data | ||||
| 1073479803_1073479806 | -9 | Left | 1073479803 | 10:103779371-103779393 | CCAGCATCCTCCTGATACCCCCG | 0: 1 1: 0 2: 0 3: 62 4: 5971 |
||
| Right | 1073479806 | 10:103779385-103779407 | ATACCCCCGTGTGCCAGCCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073479803 | Original CRISPR | CGGGGGTATCAGGAGGATGC TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||