ID: 1073479803

View in Genome Browser
Species Human (GRCh38)
Location 10:103779371-103779393
Sequence CGGGGGTATCAGGAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6034
Summary {0: 1, 1: 0, 2: 0, 3: 62, 4: 5971}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073479803_1073479815 17 Left 1073479803 10:103779371-103779393 CCAGCATCCTCCTGATACCCCCG 0: 1
1: 0
2: 0
3: 62
4: 5971
Right 1073479815 10:103779411-103779433 CTTGTGAACTTCCCTCCCTTTGG No data
1073479803_1073479816 25 Left 1073479803 10:103779371-103779393 CCAGCATCCTCCTGATACCCCCG 0: 1
1: 0
2: 0
3: 62
4: 5971
Right 1073479816 10:103779419-103779441 CTTCCCTCCCTTTGGTCCCTAGG No data
1073479803_1073479806 -9 Left 1073479803 10:103779371-103779393 CCAGCATCCTCCTGATACCCCCG 0: 1
1: 0
2: 0
3: 62
4: 5971
Right 1073479806 10:103779385-103779407 ATACCCCCGTGTGCCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073479803 Original CRISPR CGGGGGTATCAGGAGGATGC TGG (reversed) Intronic
Too many off-targets to display for this crispr